| p-value: | 1e-7 |
| log p-value: | -1.636e+01 |
| Information Content per bp: | 1.613 |
| Number of Target Sequences with motif | 62.0 |
| Percentage of Target Sequences with motif | 10.18% |
| Number of Background Sequences with motif | 2243.1 |
| Percentage of Background Sequences with motif | 4.91% |
| Average Position of motif in Targets | 101.2 +/- 55.7bp |
| Average Position of motif in Background | 98.8 +/- 71.3bp |
| Strand Bias (log2 ratio + to - strand density) | 0.3 |
| Multiplicity (# of sites on avg that occur together) | 1.13 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
ZNF519(Zf)/HEK293-ZNF519.GFP-ChIP-Seq(GSE58341)/Homer
| Match Rank: | 1 |
| Score: | 0.72 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -AGACCGAK- GAGSCCGAGC |
|

|
|
SMZ/MA0553.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.72 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | AGACCGAK- -GTACGAGG |
|

|
|
ZAP1(WRKY(Zn))/Arabidopsis thaliana/AthaMap
| Match Rank: | 3 |
| Score: | 0.63 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -AGACCGAK TTGACCGAG |
|

|
|
SUT2/MA0400.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.62 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------AGACCGAK----- ATGATAAACTCCGAAAATTT |
|

|
|
ZAP1/MA0589.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.60 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -AGACCGAK-- TTGACCGAGCC |
|

|
|
Deaf1/dmmpmm(Pollard)/fly
| Match Rank: | 6 |
| Score: | 0.59 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | AGACCGAK --CACGAA |
|

|
|
Deaf1/MA0185.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.59 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | AGACCGAK --CACGAA |
|

|
|
PB0134.1_Hnf4a_2/Jaspar
| Match Rank: | 8 |
| Score: | 0.58 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------AGACCGAK-- GGCAAAAGTCCAATAA |
|

|
|
TEA1/MA0405.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.58 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -AGACCGAK ATGCCCGC- |
|

|
|
UPC2/MA0411.1/Jaspar
| Match Rank: | 10 |
| Score: | 0.58 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | AGACCGAK TATACGA- |
|

|
|