| p-value: | 1e-10 |
| log p-value: | -2.386e+01 |
| Information Content per bp: | 1.806 |
| Number of Target Sequences with motif | 100.0 |
| Percentage of Target Sequences with motif | 6.20% |
| Number of Background Sequences with motif | 1355.0 |
| Percentage of Background Sequences with motif | 3.04% |
| Average Position of motif in Targets | 96.1 +/- 60.3bp |
| Average Position of motif in Background | 95.9 +/- 65.7bp |
| Strand Bias (log2 ratio + to - strand density) | -0.4 |
| Multiplicity (# of sites on avg that occur together) | 1.10 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
TOD6?/SacCer-Promoters/Homer
| Match Rank: | 1 |
| Score: | 0.89 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --CTCATCCC AKCTCATCGC |
|

|
|
TOD6/MA0350.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.82 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------CTCATCCC----- AGGCACAGCTCATCGCGTTTT |
|

|
|
DOT6/MA0351.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.80 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------CTCATCCC----- TTCTGCACCTCATCGCATCCT |
|

|
|
CHA4(MacIsaac)/Yeast
| Match Rank: | 4 |
| Score: | 0.79 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CTCATCCC- CTCATCGCA |
|

|
|
GZF3/Literature(Harbison)/Yeast
| Match Rank: | 5 |
| Score: | 0.77 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CTCATCCC CTTATC-- |
|

|
|
GZF3(MacIsaac)/Yeast
| Match Rank: | 6 |
| Score: | 0.77 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CTCATCCC CTTATC-- |
|

|
|
DAL82/DAL82_SM/3-DAL82(Harbison)/Yeast
| Match Rank: | 7 |
| Score: | 0.75 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CTCATCCC TCTTATC-- |
|

|
|
GLN3/GLN3_RAPA/8-GZF3,11-GLN3(Harbison)/Yeast
| Match Rank: | 8 |
| Score: | 0.74 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---CTCATCCC TATCTTATC-- |
|

|
|
GAT1/GAT1_RAPA/1-GZF3,2-GLN3(Harbison)/Yeast
| Match Rank: | 9 |
| Score: | 0.73 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CTCATCCC CTTATCT- |
|

|
|
GAT1(MacIsaac)/Yeast
| Match Rank: | 10 |
| Score: | 0.73 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CTCATCCC CTTATCT- |
|

|
|