| p-value: | 1e-529 |
| log p-value: | -1.219e+03 |
| Information Content per bp: | 1.587 |
| Number of Target Sequences with motif | 45161.0 |
| Percentage of Target Sequences with motif | 40.82% |
| Number of Background Sequences with motif | 36601.6 |
| Percentage of Background Sequences with motif | 33.71% |
| Average Position of motif in Targets | 99.5 +/- 56.1bp |
| Average Position of motif in Background | 99.9 +/- 61.9bp |
| Strand Bias (log2 ratio + to - strand density) | -0.0 |
| Multiplicity (# of sites on avg that occur together) | 1.15 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
PB0056.1_Rfxdc2_1/Jaspar
| Match Rank: | 1 |
| Score: | 0.66 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----TARCTMCG-- CCGCATAGCAACGGA |
|

|
|
PB0055.1_Rfx4_1/Jaspar
| Match Rank: | 2 |
| Score: | 0.65 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----TARCTMCG-- TACCATAGCAACGGT |
|

|
|
PB0054.1_Rfx3_1/Jaspar
| Match Rank: | 3 |
| Score: | 0.62 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------TARCTMCG------ TGTGACCCTTAGCAACCGATTAA |
|

|
|
POL013.1_MED-1/Jaspar
| Match Rank: | 4 |
| Score: | 0.62 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | TARCTMCG --GCTCCG |
|

|
|
PH0164.1_Six4/Jaspar
| Match Rank: | 5 |
| Score: | 0.58 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----TARCTMCG---- ATAAATGACACCTATCA |
|

|
|
Rfx5(HTH)/GM12878-Rfx5-ChIP-Seq(GSE31477)/Homer
| Match Rank: | 6 |
| Score: | 0.56 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---TARCTMCG- SCCTAGCAACAG |
|

|
|
HMBOX1/MA0895.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.56 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TARCTMCG GTTAACTAGN |
|

|
|
PH0022.1_Dlx3/Jaspar
| Match Rank: | 8 |
| Score: | 0.56 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------TARCTMCG--- TCGCGATAATTACCGAC |
|

|
|
NFIX/MA0671.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.56 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TARCTMCG NTTGGCANN- |
|

|
|
PB0159.1_Rfx4_2/Jaspar
| Match Rank: | 10 |
| Score: | 0.56 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----TARCTMCG-- TACCCTAGTTACCGA |
|

|
|