| p-value: | 1e-18 |
| log p-value: | -4.237e+01 |
| Information Content per bp: | 1.872 |
| Number of Target Sequences with motif | 36.0 |
| Percentage of Target Sequences with motif | 3.72% |
| Number of Background Sequences with motif | 239.5 |
| Percentage of Background Sequences with motif | 0.53% |
| Average Position of motif in Targets | 19.8 +/- 12.8bp |
| Average Position of motif in Background | 21.7 +/- 11.3bp |
| Strand Bias (log2 ratio + to - strand density) | -1.1 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
MA0037.2_GATA3/Jaspar
| Match Rank: | 1 |
| Score: | 0.97 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | AGATAAAA AGATAAGA |
|

|
|
GATA3(Zf)/iTreg-Gata3-ChIP-Seq(GSE20898)/Homer
| Match Rank: | 2 |
| Score: | 0.95 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | AGATAAAA AGATAASR |
|

|
|
MA0482.1_Gata4/Jaspar
| Match Rank: | 3 |
| Score: | 0.93 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---AGATAAAA NNGAGATAAGA |
|

|
|
MA0035.3_Gata1/Jaspar
| Match Rank: | 4 |
| Score: | 0.93 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --AGATAAAA- ANAGATAAGAA |
|

|
|
Gata2(Zf)/K562-GATA2-ChIP-Seq(GSE18829)/Homer
| Match Rank: | 5 |
| Score: | 0.92 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -AGATAAAA- NAGATAAGNN |
|

|
|
Gata4(Zf)/Heart-Gata4-ChIP-Seq(GSE35151)/Homer
| Match Rank: | 6 |
| Score: | 0.91 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --AGATAAAA NBWGATAAGR |
|

|
|
Gata1(Zf)/K562-GATA1-ChIP-Seq(GSE18829)/Homer
| Match Rank: | 7 |
| Score: | 0.90 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -AGATAAAA- CAGATAAGGN |
|

|
|
MA0036.2_GATA2/Jaspar
| Match Rank: | 8 |
| Score: | 0.90 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --AGATAAAA---- NCAGATAAGAANNN |
|

|
|
PB0023.1_Gata6_1/Jaspar
| Match Rank: | 9 |
| Score: | 0.88 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----AGATAAAA---- TATAGAGATAAGAATTG |
|

|
|
PB0021.1_Gata3_1/Jaspar
| Match Rank: | 10 |
| Score: | 0.86 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------AGATAAAA------- TTTTTAGAGATAAGAAATAAAG |
|

|
|