<tool id="cshl_fastx_renamer" name="Rename sequences" version="0.0.11" >
	<description></description>
	<command>
cat '$input' |
fastx_renamer
#if $input.ext == "fastqsanger":
 -Q 33
#elif $input.ext == "fastq":
 -Q 64
#end if
 -n $TYPE -o '$output' -v
</command>
	<inputs>
		<param format="fastq,fastqsanger,fasta" name="input" type="data" label="FASTQ/A Library to rename" />

		<param name="TYPE" type="select" label="Rename sequence identifiers to">
			<option value="SEQ">Nucleotides sequence</option>
			<option value="COUNT">Numeric Counter</option>
		</param>
	</inputs>
	<tests>
		<test>
			<param name="input" value="fastx_renamer1.fastq" ftype="fastq"/>
			<param name="TYPE" value="SEQ" />
			<output name="output" file="fastx_renamer1.out" />
		</test>
	</tests>

	<outputs>
		<data format="input" name="output" metadata_source="input" />
	</outputs>

<help>

**What it does**

This tool renames the sequence identifiers in a FASTQ/A file.

.. class:: infomark

Use this tool at the beginning of your workflow, as a way to keep the original sequence (before trimming, clipping, barcode-removal, etc).

--------

**Example**

The following Solexa-FASTQ file::

    @CSHL_4_FC042GAMMII_2_1_517_596
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    +CSHL_4_FC042GAMMII_2_1_517_596
    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
  
Renamed to **nucleotides sequence**::

    @GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    +GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40

Renamed to **numeric counter**::

    @1
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    +1
    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40

------

This tool is based on `FASTX-toolkit`__ by Assaf Gordon.

 .. __: http://hannonlab.cshl.edu/fastx_toolkit/   
</help>
</tool>
<!-- FASTX-renamer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
