<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA">
	<description>converter</description>
	<command>
cat '$input' |
fastq_to_fasta
#if $input.ext == "fastqsanger":
 -Q 33
#elif $input.ext == "fastq":
 -Q 64
#end if
 $SKIPN $RENAMESEQ -o '$output' -v
</command>
	<inputs>
		<param format="fastq,fastqsanger" name="input" type="data" label="FASTQ Library to convert" />

		<param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases ">
			<option value="">yes</option>
			<option value="-n">no</option>
		</param>

		<param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)">
			<option value="-r">yes</option>
			<option value="">no</option>
		</param>

	</inputs>

	<tests>
		<test>
			<!-- FASTQ-To-FASTA, keep N, don't rename -->
			<param name="input" value="fastq_to_fasta1.fastq" />
			<param name="SKIPN" value=""/>
			<param name="RENAMESEQ" value=""/>
			<output name="output" file="fastq_to_fasta1a.out" />
		</test>
		<test>
			<!-- FASTQ-To-FASTA, discard N, rename -->
			<param name="input" value="fastq_to_fasta1.fastq" />
			<param name="SKIPN" value="no"/>
			<param name="RENAMESEQ" value="yes"/>
			<output name="output" file="fastq_to_fasta1b.out" />
		</test>
	</tests>

	<outputs>
		<data format="fasta" name="output" metadata_source="input"
		/>
	</outputs>

<help>

**What it does**

This tool converts data from Solexa format to FASTA format (scroll down for format description).

--------

**Example**

The following data in Solexa-FASTQ format::

    @CSHL_4_FC042GAMMII_2_1_517_596
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    +CSHL_4_FC042GAMMII_2_1_517_596
    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
  
Will be converted to FASTA (with 'rename sequence names' = NO)::

    >CSHL_4_FC042GAMMII_2_1_517_596
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    
Will be converted to FASTA (with 'rename sequence names' = YES)::

    >1
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    
------

This tool is based on `FASTX-toolkit`__ by Assaf Gordon.

 .. __: http://hannonlab.cshl.edu/fastx_toolkit/    
</help>
</tool>
<!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
