import os
from textwrap import dedent
import pytest

from dnaio import Sequence
from cutadapt.adapters import LinkedAdapter, BackAdapter, FrontAdapter, InvalidCharacter
from cutadapt.parser import AdapterParser, AdapterSpecification
from cutadapt.modifiers import ModificationInfo


def test_expand_braces():
    expand_braces = AdapterSpecification.expand_braces
    assert expand_braces("") == ""
    assert expand_braces("A") == "A"
    assert expand_braces("A{0}") == ""
    assert expand_braces("A{1}") == "A"
    assert expand_braces("A{2}") == "AA"
    assert expand_braces("A{2}C") == "AAC"
    assert expand_braces("ACGTN{3}TGACCC") == "ACGTNNNTGACCC"
    assert expand_braces("ACGTN{10}TGACCC") == "ACGTNNNNNNNNNNTGACCC"
    assert expand_braces("ACGTN{3}TGA{4}CCC") == "ACGTNNNTGAAAACCC"
    assert expand_braces("ACGTN{0}TGA{4}CCC") == "ACGTTGAAAACCC"


def test_expand_braces_fail():
    for expression in [
        "{",
        "}",
        "{}",
        "{5",
        "{1}",
        "A{-7}",
        "A{",
        "A{1",
        "N{7",
        "AN{7",
        "A{4{}",
        "A{4}{3}",
        "A{b}",
        "A{6X}",
        "A{X6}",
        "A}A",
    ]:
        with pytest.raises(ValueError):
            AdapterSpecification.expand_braces(expression)


def test_parse_file_notation(tmp_path):
    tmp = tmp_path / "adapters.fasta"
    tmp.write_text(
        dedent(
            """>first_name
            ADAPTER1
            >second_name
            ADAPTER2
            """
        )
    )
    parser = AdapterParser(
        max_errors=0.2,
        min_overlap=4,
        read_wildcards=False,
        adapter_wildcards=False,
        indels=False,
    )

    adapters = list(parser.parse("file:" + os.fspath(tmp), cmdline_type="back"))
    assert len(adapters) == 2
    assert adapters[0].name == "first_name"
    assert adapters[0].sequence == "ADAPTER1"
    assert adapters[1].name == "second_name"
    assert adapters[1].sequence == "ADAPTER2"
    for a in adapters:
        assert a.max_error_rate == 0.2
        assert a.min_overlap == 4
        assert not a.read_wildcards
        assert not a.adapter_wildcards
        assert not a.indels


def test_parse_not_linked():
    p = AdapterSpecification.parse
    assert p("A", "front") == AdapterSpecification(None, None, "A", {}, "front")
    assert p("A", "back") == AdapterSpecification(None, None, "A", {}, "back")
    assert p("A", "anywhere") == AdapterSpecification(None, None, "A", {}, "anywhere")
    assert p("^A", "front") == AdapterSpecification(None, "anchored", "A", {}, "front")
    assert p("XXXA", "front") == AdapterSpecification(
        None, "noninternal", "A", {}, "front"
    )
    assert p("A$", "back") == AdapterSpecification(None, "anchored", "A", {}, "back")
    assert p("AXXXX", "back") == AdapterSpecification(
        None, "noninternal", "A", {}, "back"
    )
    assert p("a_name=ADAPT", "front") == AdapterSpecification(
        "a_name", None, "ADAPT", {}, "front"
    )


@pytest.mark.parametrize("where", ("front", "back"))
@pytest.mark.parametrize("reqopt", ("required", "optional"))
def test_parse_invalid_adapter_specific_parameter(where, reqopt):
    parser = AdapterParser()
    with pytest.raises(ValueError) as e:
        parser._parse_not_linked("A;{}".format(reqopt), "name", where)
    assert "can only be used within linked adapters" in e.value.args[0]


def test_parse_invalid_cmdline_type():
    with pytest.raises(ValueError) as e:
        AdapterSpecification._parse("A", "invalid_type")
    assert "cmdline_type must be front, back or anywhere" in e.value.args[0]


@pytest.mark.parametrize(
    "spec,cmdline_type",
    [
        ("^XA", "front"),
        ("^AX", "front"),
        ("XA$", "back"),
        ("AX$", "back"),
    ],
)
def test_parse_double_placement_restrictions(spec, cmdline_type):
    with pytest.raises(ValueError) as e:
        AdapterSpecification._parse(spec, cmdline_type)
    assert "cannot use multiple placement restrictions" in e.value.args[0]


def test_parse_misplaced_placement_restrictions():
    with pytest.raises(ValueError) as e:
        AdapterSpecification._parse("A$", "front")
    assert "Allowed placement restrictions for a 5' adapter" in e.value.args[0]
    with pytest.raises(ValueError) as e:
        AdapterSpecification._parse("^A", "back")
    assert "Allowed placement restrictions for a 3' adapter" in e.value.args[0]


def test_restriction_to_class():
    with pytest.raises(ValueError) as e:
        AdapterSpecification._restriction_to_class("anywhere", "noninternal")
    assert "No placement may be specified" in e.value.args[0]


def test_parse_parameters():
    p = AdapterSpecification._parse_parameters
    assert p("e=0.1") == {"max_errors": 0.1}
    assert p("error_rate=0.1") == {"max_errors": 0.1}
    assert p("max_errors=2") == {"max_errors": 2}
    assert p("o=5") == {"min_overlap": 5}
    assert p("min_overlap=5") == {"min_overlap": 5}
    assert p("o=7; e=0.4") == {"min_overlap": 7, "max_errors": 0.4}
    assert p("anywhere") == {"anywhere": True}
    assert p("required") == {"required": True}
    assert p("optional") == {"required": False}
    assert p("noindels") == {"indels": False}
    assert p("indels") == {"indels": True}

    with pytest.raises(ValueError):
        p("e=hallo")
    with pytest.raises(KeyError):
        p("bla=0.1")
    with pytest.raises(ValueError):
        p("e=")
    with pytest.raises(KeyError) as e:
        p("e=0.1;e=0.1")
    assert "specified twice" in e.value.args[0]
    with pytest.raises(KeyError) as e:
        p("e=0.1;max_errors=0.1")
    assert "specified twice" in e.value.args[0]
    with pytest.raises(ValueError) as e:
        p("optional; required")
    assert "cannot be specified at the same time" in e.value.args[0]


def test_parse_with_parameters(tmp_path):
    parser = AdapterParser(
        max_errors=0.2,
        min_overlap=4,
        read_wildcards=False,
        adapter_wildcards=False,
        indels=False,
    )
    a = parser._parse("ACGTACGT; e=0.15", "front")
    assert isinstance(a, FrontAdapter)
    assert a.max_error_rate == 0.15
    assert a.min_overlap == 4

    a = parser._parse("ACGTAAAA; o=5; e=0.11", "back")
    assert isinstance(a, BackAdapter)
    assert a.max_error_rate == 0.11
    assert a.min_overlap == 5

    a = parser._parse("ACGTAAAA; noindels", "back")
    assert isinstance(a, BackAdapter)
    assert a.indels is False

    a = parser._parse("ACGTAAAA; indels", "back")
    assert isinstance(a, BackAdapter)
    assert a.indels is True

    for spec in (
        "thename=ACG;e=0.15 ... TGT;e=0.17",
        "thename=ACG;e=0.15...TGT;e=0.17",
    ):
        a = parser._parse(spec, "back")
        assert isinstance(a, LinkedAdapter)
        assert a.front_adapter.max_error_rate == 0.15
        assert a.back_adapter.max_error_rate == 0.17

    with pytest.raises(ValueError) as e:
        parser._parse("A", "invalid-cmdline-type")
    assert "cmdline_type cannot be" in e.value.args[0]

    with pytest.raises(ValueError) as e:
        parser._parse("ACGT$;min_overlap=3", "back")
    assert "not possible" in e.value.args[0]
    with pytest.raises(ValueError) as e:
        parser._parse("^ACGT;min_overlap=3", "front")
    assert "not possible" in e.value.args[0]

    with pytest.raises(ValueError) as e:
        parser._parse("ACGT;min_overlap=5", "back")
    assert "exceeds" in e.value.args[0]


def test_parse_with_adapter_sequence_as_a_path(tmp_path):
    parser = AdapterParser()
    with pytest.raises(InvalidCharacter):
        parser._parse("invalid.character", "back")
    # user forgot to write "file:"
    path = tmp_path / "afile.fasta"
    path.write_text(">abc\nACGT\n")
    with pytest.raises(InvalidCharacter) as e:
        list(parser.parse(str(path), "back"))
    assert "A file exists named" in e.value.args[0]


def test_parse_multi():
    parser = AdapterParser()
    with pytest.raises(ValueError) as e:
        parser.parse_multi([("invalid-type", "A")])
    assert "adapter type must be" in e.value.args[0]


def test_normalize_ellipsis():
    ne = AdapterParser._normalize_ellipsis
    assert ne("ACGT", "", "back") == ("ACGT", "front")  # -a ACGT...
    assert ne("ACGT", "", "front") == ("ACGT", "front")  # -g ACGT...
    assert ne("", "ACGT", "back") == ("ACGT", "back")  # -a ...ACGT
    with pytest.raises(ValueError) as e:
        # -g ...ACGT
        ne("", "ACGT", "front")
    assert "Invalid adapter specification" in e.value.args[0]

    with pytest.raises(ValueError) as e:
        ne("A", "C", "back")
    assert "either" in e.value.args[0]
    with pytest.raises(ValueError) as e:
        ne("A", "", "anywhere")
    assert "No ellipsis" in e.value.args[0]


@pytest.mark.parametrize(
    "seq,req1,req2",
    [
        ("ACG...TGT", False, False),
        ("ACG...TGT$", False, True),
        ("^ACG...TGT", True, False),
        ("^ACG...TGT$", True, True),
    ],
)
def test_anchoring_makes_front_linked_adapter_required(seq, req1, req2):
    # -a X...Y
    a = AdapterParser()._parse(seq, "back")
    assert isinstance(a, LinkedAdapter)
    assert a.front_required is req1
    assert a.back_required is req2


@pytest.mark.parametrize(
    "r1,r2,req1,req2",
    [
        ("", "", False, False),
        ("", ";required", False, True),
        (";required", "", True, False),
        (";required", ";required", True, True),
        ("", ";optional", False, False),
        (";optional", "", False, False),
        (";optional", ";optional", False, False),
    ],
)
def test_linked_adapter_back_required_optional(r1, r2, req1, req2):
    # -a X...Y
    a = AdapterParser()._parse("ACG" + r1 + "...TGT" + r2, "back")
    assert isinstance(a, LinkedAdapter)
    assert a.front_required is req1
    assert a.back_required is req2


@pytest.mark.parametrize(
    "r1,r2,exp1,exp2",
    [
        ("", "", True, True),
        ("", ";required", True, True),
        (";required", "", True, True),
        (";required", ";required", True, True),
        ("", ";optional", True, False),
        (";optional", "", False, True),
        (";optional", ";optional", False, False),
    ],
)
def test_linked_adapter_front_required_optional(r1, r2, exp1, exp2):
    # -g X...Y
    a = AdapterParser()._parse("ACG" + r1 + "...TGT" + r2, "front")
    assert isinstance(a, LinkedAdapter)
    assert a.front_required is exp1
    assert a.back_required is exp2


def test_linked_adapter_parameters():
    # issue #394
    a = AdapterParser(max_errors=0.17, indels=False)._parse("ACG...TGT")
    assert isinstance(a, LinkedAdapter)
    assert a.front_adapter.max_error_rate == 0.17
    assert a.back_adapter.max_error_rate == 0.17
    assert not a.front_adapter.indels
    assert not a.back_adapter.indels


def test_linked_adapter_name():
    # issue #414
    a = AdapterParser()._parse("the_name=^ACG...TGT")
    assert isinstance(a, LinkedAdapter)
    assert a.create_statistics().name == "the_name"


def test_anywhere_parameter_back():
    parser = AdapterParser(
        max_errors=0.2,
        min_overlap=4,
        read_wildcards=False,
        adapter_wildcards=False,
        indels=True,
    )
    adapter = list(parser.parse("CTGAAGTGAAGTACACGGTT;anywhere", "back"))[0]
    assert isinstance(adapter, BackAdapter)
    assert adapter._force_anywhere

    # TODO move the rest to a separate test
    read = Sequence("foo1", "TGAAGTACACGGTTAAAAAAAAAA")
    from cutadapt.modifiers import AdapterCutter

    cutter = AdapterCutter([adapter])
    trimmed_read = cutter(read, ModificationInfo(read))
    assert trimmed_read.sequence == ""


def test_anywhere_parameter_front():
    parser = AdapterParser(
        max_errors=0.2,
        min_overlap=4,
        read_wildcards=False,
        adapter_wildcards=False,
        indels=True,
    )
    adapter = list(parser.parse("CTGAAGTGAAGTACACGGTT;anywhere", "front"))[0]
    assert isinstance(adapter, FrontAdapter)
    assert adapter._force_anywhere

    # TODO move the rest to a separate test
    read = Sequence("foo1", "AAAAAAAAAACTGAAGTGAA")
    from cutadapt.modifiers import AdapterCutter

    cutter = AdapterCutter([adapter])
    trimmed_read = cutter(read, ModificationInfo(read))
    assert trimmed_read.sequence == ""
