******************************************************************************** MAST - Motif Alignment and Search Tool ******************************************************************************** MAST version 5.0.1 (Release date: Wed Aug 22 15:26:53 2018 -0700) For further information on how to interpret these results please access http://meme-suite.org. To get a copy of the MAST software please access http://meme-suite.org. ******************************************************************************** ******************************************************************************** REFERENCE ******************************************************************************** If you use this program in your research, please cite: Timothy L. Bailey and Michael Gribskov, "Combining evidence using p-values: application to sequence homology searches", Bioinformatics, 14(48-54), 1998. ******************************************************************************** ******************************************************************************** DATABASE AND MOTIFS ******************************************************************************** DATABASE crp0.s (nucleotide) Last updated on Tue Jun 20 11:02:46 2017 Database contains 18 sequences, 1890 residues Scores for positive and reverse complement strands are combined. MOTIFS meme.crp0.de.oops.txt (nucleotide) MOTIF ID ALT ID WIDTH BEST POSSIBLE MATCH ----- ------------ ------ ----- ------------------- 1 AHSGYAWWWAAT MEME-1 12 ACGGCAAATAAT 2 GTGADYDDDNTC MEME-2 12 GTGAGCGGTGTC PAIRWISE MOTIF CORRELATIONS: MOTIF 1 ----- ----- 2 0.13 No overly similar pairs (correlation > 0.60) found. Random model letter frequencies (from non-redundant database): A 0.274 C 0.225 G 0.225 T 0.274 ******************************************************************************** ******************************************************************************** SECTION I: HIGH-SCORING SEQUENCES ******************************************************************************** - Each of the following 18 sequences has E-value less than 10. - The E-value of a sequence is the expected number of sequences in a random database of the same size that would match the motifs as well as the sequence does and is equal to the combined p-value of the sequence times the number of sequences in the database. - The combined p-value of a sequence measures the strength of the match of the sequence to all the motifs and is calculated by o finding the score of the single best match of each motif to the sequence (best matches may overlap), o calculating the sequence p-value of each score, o forming the product of the p-values, o taking the p-value of the product. - The sequence p-value of a score is defined as the probability of a random sequence of the same length containing some match with as good or better a score. - The score for the match of a position in a sequence to a motif is computed by by summing the appropriate entry from each column of the position-dependent scoring matrix that represents the motif. - Sequences shorter than one or more of the motifs are skipped. - The table is sorted by increasing E-value. ******************************************************************************** SEQUENCE NAME DESCRIPTION E-VALUE LENGTH ------------- ----------- -------- ------ lac 9 80 0.00023 105 bglr1 76 0.0098 105 tdc 78 0.043 105 deop2 7 60 0.055 105 pbr322 53 0.055 105 malk 29 61 0.14 105 tnaa 71 0.69 105 male 14 0.91 105 ara 17 55 0.94 105 cya 50 1 105 ompa 48 2.1 105 ilv 39 2.6 105 gale 42 3.1 105 malt 41 3.2 105 crp 63 4.5 105 ce1cg 17 61 4.8 105 trn9cat 1 84 5.9 105 uxu1 17 6.6 105 ******************************************************************************** ******************************************************************************** SECTION II: MOTIF DIAGRAMS ******************************************************************************** - The ordering and spacing of all non-overlapping motif occurrences are shown for each high-scoring sequence listed in Section I. - A motif occurrence is defined as a position in the sequence whose match to the motif has POSITION p-value less than 0.0001. - The POSITION p-value of a match is the probability of a single random subsequence of the length of the motif scoring at least as well as the observed match. - For each sequence, all motif occurrences are shown unless there are overlaps. In that case, a motif occurrence is shown only if its p-value is less than the product of the p-values of the other (lower-numbered) motif occurrences that it overlaps. - The table also shows the E-value of each sequence. - Spacers and motif occurences are indicated by o -d- `d' residues separate the end of the preceding motif occurrence and the start of the following motif occurrence o [sn] occurrence of motif `n' with p-value less than 0.0001. A minus sign indicates that the occurrence is on the reverse complement strand. ******************************************************************************** SEQUENCE NAME E-VALUE MOTIF DIAGRAM ------------- -------- ------------- lac 0.00023 [+1]-2-[-2]-79 bglr1 0.0098 79-[+2]-14 tdc 0.043 30-[+1]-39-[+2]-12 deop2 0.055 19-[+1]-74 pbr322 0.055 58-[-2]-35 malk 0.14 32-[+2]-61 tnaa 0.69 105 male 0.91 105 ara 0.94 105 cya 1 105 ompa 2.1 105 ilv 2.6 105 gale 3.1 105 malt 3.2 105 crp 4.5 105 ce1cg 4.8 105 trn9cat 5.9 105 uxu1 6.6 105 ******************************************************************************** ******************************************************************************** SECTION III: ANNOTATED SEQUENCES ******************************************************************************** - The positions and p-values of the non-overlapping motif occurrences are shown above the actual sequence for each of the high-scoring sequences from Section I. - A motif occurrence is defined as a position in the sequence whose match to the motif has POSITION p-value less than 0.0001 as defined in Section II. - For each sequence, the first line specifies the name of the sequence. - The second (and possibly more) lines give a description of the sequence. - Following the description line(s) is a line giving the length, combined p-value, and E-value of the sequence as defined in Section I. - The next line reproduces the motif diagram from Section II. - The entire sequence is printed on the following lines. - Motif occurrences are indicated directly above their positions in the sequence on lines showing o the motif number of the occurrence (a minus sign indicates that the occurrence is on the reverse complement strand), o the position p-value of the occurrence, o the best possible match to the motif (or its reverse complement), and o columns whose match to the motif has a positive score (indicated by a plus sign). ******************************************************************************** lac 9 80 LENGTH = 105 COMBINED P-VALUE = 1.30e-05 E-VALUE = 0.00023 DIAGRAM: [+1]-2-[-2]-79 [+1] [-2] 3.4e-06 7.2e-06 ACGGCAAATAAT GACACCGCTCAC ++++++++++++ ++ ++++++++ 1 AACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTG bglr1 76 LENGTH = 105 COMBINED P-VALUE = 5.42e-04 E-VALUE = 0.0098 DIAGRAM: 79-[+2]-14 [+2] 9.1e-06 GTGAGCGGTGTC ++++++ ++++ 76 AACTGTGAGCATGGTCATATTTTTATCAAT tdc 78 LENGTH = 105 COMBINED P-VALUE = 2.39e-03 E-VALUE = 0.043 DIAGRAM: 30-[+1]-39-[+2]-12 [+1] 7.8e-05 ACGGCAAATAAT ++++ +++++++ 1 GATTTTTATACTTTAACTTGTTGATATTTAAAGGTATTTAATTGTAATAACGATACTCTGGAAAGTATTGAAAGT [+2] 9.4e-05 GTGAGCGGTGTC +++++++++ + 76 TAATTTGTGAGTGGTCGCACATATCCTGTT deop2 7 60 LENGTH = 105 COMBINED P-VALUE = 3.05e-03 E-VALUE = 0.055 DIAGRAM: 19-[+1]-74 [+1] 9.0e-05 ACGGCAAATAAT ++++++++++++ 1 AGTGAATTATTTGAACCAGATCGCATTACAGTGATGCAAACTTGTAAGTAGATTTCCTTAATTGTGATGTGTATC pbr322 53 LENGTH = 105 COMBINED P-VALUE = 3.06e-03 E-VALUE = 0.055 DIAGRAM: 58-[-2]-35 [-2] 9.4e-05 GACACCGCTCAC ++ +++ +++++ 1 CTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATG malk 29 61 LENGTH = 105 COMBINED P-VALUE = 8.04e-03 E-VALUE = 0.14 DIAGRAM: 32-[+2]-61 [+2] 7.1e-05 GTGAGCGGTGTC ++++++++ + + 1 GGAGGAGGCGGGAGGATGAGAACACGGCTTCTGTGAACTAAACCGAGGTCATGTAAGGAATTTCGTGATGTTGCT tnaa 71 LENGTH = 105 COMBINED P-VALUE = 3.85e-02 E-VALUE = 0.69 DIAGRAM: 105 male 14 LENGTH = 105 COMBINED P-VALUE = 5.05e-02 E-VALUE = 0.91 DIAGRAM: 105 ara 17 55 LENGTH = 105 COMBINED P-VALUE = 5.22e-02 E-VALUE = 0.94 DIAGRAM: 105 cya 50 LENGTH = 105 COMBINED P-VALUE = 5.58e-02 E-VALUE = 1 DIAGRAM: 105 ompa 48 LENGTH = 105 COMBINED P-VALUE = 1.17e-01 E-VALUE = 2.1 DIAGRAM: 105 ilv 39 LENGTH = 105 COMBINED P-VALUE = 1.46e-01 E-VALUE = 2.6 DIAGRAM: 105 gale 42 LENGTH = 105 COMBINED P-VALUE = 1.70e-01 E-VALUE = 3.1 DIAGRAM: 105 malt 41 LENGTH = 105 COMBINED P-VALUE = 1.78e-01 E-VALUE = 3.2 DIAGRAM: 105 crp 63 LENGTH = 105 COMBINED P-VALUE = 2.48e-01 E-VALUE = 4.5 DIAGRAM: 105 ce1cg 17 61 LENGTH = 105 COMBINED P-VALUE = 2.68e-01 E-VALUE = 4.8 DIAGRAM: 105 trn9cat 1 84 LENGTH = 105 COMBINED P-VALUE = 3.26e-01 E-VALUE = 5.9 DIAGRAM: 105 uxu1 17 LENGTH = 105 COMBINED P-VALUE = 3.66e-01 E-VALUE = 6.6 DIAGRAM: 105 ******************************************************************************** CPU: Timothys-iMac.rd.unr.edu Time 0.008 secs. mast -oc results/mast4 -nostatus meme/meme.crp0.de.oops.txt common/crp0.s