Integrated Project Script

3.5.15

Below is the commented text of an example script that could be used to set up and compute a Project (provided you have access to the Read Data files). You would execute this script by saving it to a file such as “projectSetupScript.ava” and executing it using the CLI (“doAmplicon projectSetupScript.ava”). Alternatively, you could start the CLI in interactive mode and type or copy and paste the commands into the interface individually. Note that the ‘#’ symbol at the beginning of a line is used to indicate a comment line that is ignored by the command interpreter. The data for the object types is supplied in tab-delimited “here” files. If you copy and paste the data, make sure that the space between fields in the “here” files remain tabs when you paste the data in the new location (in some combinations of applications the cut (or copy) and paste operation converts the tabs into spaces).

Due to the limitations of this printed document, certain lines of the script below appear on multiple lines. This occurs for certain tab-separated entries in the tables given as arguments to certain commands. Be aware that these should actually be single lines in the script.

# Script to create a project, compute it, and generate a report.

# Edit paths as necessary to conform to your system.

# Create the project architecture. Edit the path if you want to create the

# project in an alternate location.

create project /data/ampProjects/EGFR_CLI \

    -name EGFR_CLI \

    -annotation "CLI Example Project Creation Test"

# This command creates all the reference objects.

create reference -file - << HERE_TERMINATOR

"Name"     "Annotation"     "Sequence"

"EGFR_Exon_18"     "EGFR_Exon_18"     
"GACCCTTGTCTCTGTGTTCTTGTCCCCCCCAGCTTGTGGAGCCTCTTACACCCAGTGGAGAAGCTCCCAACCAAGCTCTCTTGAG
GATCTTGAAGGAAACTGAATTCAAAAAGATCAAAGTGCTGGGCTCCGGTGCGTTCGGCACGGTGTATAAGGTAAGGTCCCTGGCAC
AGGCCTCTGGGCTGGGCCGCAGGGCCTCTCATGGTCTGGTGGGG"

"EGFR_Exon_19"     "EGFR_Exon_19"     
"TCACAATTGCCAGTTAACGTCTTCCTTCTCTCTCTGTCATAGGGACTCTGGATCCCAGAAGGTGAGAAAGTTAAAATTCCCGTCG
CTATCAAGGAATTAAGAGAAGCAACATCTCCGAAAGCCAACAAGGAAATCCTCGATGTGAGTTTCTGCTTTGCTGTGTGGGGGTCC
ATGGCTCTGAACCTCAGGCCCACCTTTTCTC"

"EGFR_Exon_20"     "EGFR_Exon_20"     
"CCACACTGACGTGCCTCTCCCTCCCTCCAGGAAGCCTACGTGATGGCCAGCGTGGACAACCCCCACGTGTGCCGCCTGCTGGGCA
TCTGCCTCACCTCCACCGTGCAGCTCATCACGCAGCTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACAAT
ATTGGCTCCCAGTACCTGCTCAACTGGTGTGTGCAGATCGCAAAGGTAATCAGGGAAGGGAGATACGGGGAGGGGAGATAAGGAGC
CAGGATC"

"EGFR_Exon_21"     "EGFR_Exon_21"     
"TCTTCCCATGATGATCTGTCCCTCACAGCAGGGTCTTCTCTGTTTCAGGGCATGAACTACTTGGAGGACCGTCGCTTGGTGCACC
GCGACCTGGCAGCCAGGAACGTACTGGTGAAAACACCGCAGCATGTCAAGATCACAGATTTTGGGCTGGCCAAACTGCTGGGTGCG
GAAGAGAAAGAATACCATGCAGAAGGAGGCAAAGTAAGGAGGTGGCTTTAGGTCAGCCAGCAT"

"EGFR_Exon_22"     "EGFR_Exon_22"     
"CACTGCCTCATCTCTCACCATCCCAAGGTGCCTATCAAGTGGATGGCATTGGAATCAATTTTACACAGAATCTATACCCACCAGA
GTGATGTCTGGAGCTACGGTGAGTCATAATCCTGATGCTAATGAGTTTGTACTGAGGCCAAGCTGG"

HERE_TERMINATOR

# This command creates the amplicon objects.

create amplicon -file - << HERE_TERMINATOR

"Name"  "Annotation"  "Reference"  "Primer1"  "Primer2"  "Start"  "End"

"EGFR_18_1"  "Amplifies EGFR_Exon_18 from 23 to 66"  "EGFR_Exon_18"  
"GACCCTTGTCTCTGTGTTCTTG"  "CCTCAAGAGAGCTTGGTTGG"  "23"  "66"

"EGFR_18_2"  "Amplifies EGFR_Exon_18 from 60 to 136"  "EGFR_Exon_18"  
"AGCCTCTTACACCCAGTGGA"  "CCTTATACACCGTGCCGAAC"  "60"  "136"

"EGFR_18_3"  "Amplifies EGFR_Exon_18 from 123 to 197"  "EGFR_Exon_18"  
"TGAATTCAAAAAGATCAAAGTG"  "CCCCACCAGACCATGAGA"  "123"  "197"

"EGFR_19_1"  "Amplifies EGFR_Exon_19 from 23 to 115"  "EGFR_Exon_19"  
"TCACAATTGCCAGTTAACGTCT"  "GATTTCCTTGTTGGCTTTCG"  "23"  "115"

"EGFR_19_2"  "Amplifies EGFR_Exon_19 from 67 to 183"  "EGFR_Exon_19"  
"TCTGGATCCCAGAAGGTGAG"  "GAGAAAAGGTGGGCCTGAG"  "67"  "183"

"EGFR_20_1"  "Amplifies EGFR_Exon_20 from 20 to 108"  "EGFR_Exon_20"  
"CCACACTGACGTGCCTCTC"  "GCATGAGCTGCGTGATGAG"  "20"  "108"

"EGFR_20_2"  "Amplifies EGFR_Exon_20 from 102 to 194"  "EGFR_Exon_20"  
"GCATCTGCCTCACCTCCAC"  "GCGATCTGCACACACCAG"  "102"  "194"

"EGFR_20_3"  "Amplifies EGFR_Exon_20 from 153 to 244"  "EGFR_Exon_20"  
"GGCTGCCTCCTGGACTATGT"  "GATCCTGGCTCCTTATCTCC"  "153"  "244"

"EGFR_21_1"  "Amplifies EGFR_Exon_21 from 23 to 113"  "EGFR_Exon_21"  
"TCTTCCCATGATGATCTGTCCC"  "GACATGCTGCGGTGTTTTC"  "23"  "113"

"EGFR_21_2"  "Amplifies EGFR_Exon_21 from 111 to 215"  "EGFR_Exon_21"  
"GGCAGCCAGGAACGTACT"  "ATGCTGGCTGACCTAAAGC"  "111"  "215"

"EGFR_22_1"  "Amplifies EGFR_Exon_22 from 21 to 132"  "EGFR_Exon_22"  
"CACTGCCTCATCTCTCACCA"  "CCAGCTTGGCCTCAGTACA"  "21"  "132"

HERE_TERMINATOR

# This command seeds the project with a few known variants.

create variant -file - << HERE_TERMINATOR

"Name"  "Annotation"  "Reference"  "Pattern"  "Status"

"15BP_DEL_93-107"  "Pattern entered manually"  "EGFR_Exon_19"  "d(93-107)"  "accepted"

"HAP_97C_126A"  "Created from selections"  "EGFR_Exon_18"  "s(97,C)s(126,A)"  
"accepted"

"SUB_A_to_C_97"  "Created from selections"  "EGFR_Exon_18"  "s(97,C)"  "accepted"

"SUB_G_to_A_126"  "Created from selections"  "EGFR_Exon_18"  "s(126,A)"  "accepted"

HERE_TERMINATOR

# This command creates all the sample objects.

create sample -file - << HERE_TERMINATOR

"Name"        "Annotation"

"Sample1"     "Sample1"

"Sample2"     "Sample2"

"Sample3"     "Sample3"

"Sample4"     "Sample4"

"Sample5"     "Sample5"

"Sample6"     "Sample6"

"Sample7"     "Sample7"

HERE_TERMINATOR

# This command sets up the Sample-Amplicon associations.

assoc -file - << HERE_TERMINATOR

"sample"      "amplicon"      "ofRef"

"Sample1"     "EGFR_20_1"     "EGFR_Exon_20"

"Sample1"     "EGFR_20_2"     "EGFR_Exon_20"

"Sample1"     "EGFR_20_3"     "EGFR_Exon_20"

"Sample2"     "EGFR_18_1"     "EGFR_Exon_18"

"Sample2"     "EGFR_18_2"     "EGFR_Exon_18"

"Sample2"     "EGFR_18_3"     "EGFR_Exon_18"

"Sample3"     "EGFR_18_1"     "EGFR_Exon_18"

"Sample3"     "EGFR_18_2"     "EGFR_Exon_18"

"Sample3"     "EGFR_18_3"     "EGFR_Exon_18"

"Sample4"     "EGFR_19_2"     "EGFR_Exon_19"

"Sample4"     "EGFR_19_1"     "EGFR_Exon_19"

"Sample5"     "EGFR_20_2"     "EGFR_Exon_20"

"Sample5"     "EGFR_20_1"     "EGFR_Exon_20"

"Sample5"     "EGFR_20_3"     "EGFR_Exon_20"

"Sample6"     "EGFR_21_2"     "EGFR_Exon_21"

"Sample6"     "EGFR_21_1"     "EGFR_Exon_21"

"Sample7"     "EGFR_22_1"     "EGFR_Exon_22"

HERE_TERMINATOR

# This load command assumes that the data is sitting in an official analysis

# directory where the data is actually sitting in an sff subdirectory of the

# analysisDir. If you have data sitting in an alternate analysis directory,

# you can specify the analysis path

load   -analysisDir /data/sequencingRuns/EGFR_Run_Dir/EGFR_Analysis_Dir/ \

          -readGroup ReadGrp_1 -regions 1,2,3,4 \

          -symLink false -alias EGFR_reads

# If your read data is in a generic repository, rather than an official

# analysis directory, you can comment out the load above and replace it with

# one like the following where you have edited the sffDir path to point to the

# sff files on your system.

#load –sffDir /data/sffFiles/EGFR_sff_files \

#       –readGroup ReadGrp_1 -filePrefix DGVS90J \

#       –regions 1,2,3,4 –symLink “false”

# If you don’t have access to the specific Read Data for this project

# you have already set up as much of the project as you can and

# you won’t be able to run a computation on it. You should save the

# project setup here and exit. You can open the project in the

# GUI to see how the commands above have been translated into a

# project setup.

# save

# exit

# This command creates the associations between the Read Data and

# the Sample-Amplicon pairs. This command is only valid if you have

# imported the Read Data from an analysis directory using EGFR_reads

# as an alias. If you instead imported the Read Data from a

# repository using actual file names, you would need to change the aliases

# to actual file names (i.e. EGFR_reads01 to DGVS90J01).

assoc -file - << HERE_TERMINATOR

"readData"         "sample"

"EGFR_reads01"     "Sample1"

"EGFR_reads02"     "Sample2"

"EGFR_reads03"     "Sample6"

"EGFR_reads03"     "Sample7"

"EGFR_reads03"     "Sample3"

"EGFR_reads03"     "Sample5"

"EGFR_reads03"     "Sample4"

HERE_TERMINATOR

# The region 4 Read Data file is actually empty, so we should mark it as

# not active so it gets excluded from the analysis.

update readData EGFR_reads04 -active false

# You should save the project setup now.

save

# Run the validateNames utility to be on the safe side.

utility validateNames

# Check to see if there are any other problems with the project.

utility validateForComputation

# Trigger the start of the computation.

computation start

# Load the automatically detected variants discovered as part of the

# computation.

computation loadDetectedVariants

# Report the measured variant frequencies to a tab-delimited output file.

report variantHits -outputFile EGFR_variant_hits.txt

# Close the project without saving. This will prevent the automatically

# detected variants from being permanently added to the project.

# You will receive a warning about unsaved changes to the project.

close

# Exit the CLI. Your project setup and your computation results should now be

# able to be viewed if you open the project in the GUI.

exit