skip to main content
Roche logo
3. GS Amplicon Variant Analyzer Command Line Interface : 3.5 Creating and Computing a Project with the AVA-CLI : 3.5.4 Creating Amplicons
3.5.4
Creating Amplicons
Now that there are Reference Sequences in the system, Amplicons can be completely specified for the Project. This is done using the “create amplicon” command (see section 3.4.4.1 for the usage statement). To add multiple Amplicons, it is best to use tabular input, as shown for the Reference Sequences, in section 3.5.3. (To best illustrate each command and parameters, the rest of this Project setup tutorial will show all tabular inputs using inline “here” files.)
create amplicon -file - << HERE_TERMINATOR
"Name"   "Annotation"   "Reference"   "Primer1"   "Primer2"   "Start"   "End"
"EGFR_18_1"  "Amplifies EGFR_Exon_18 from 23 to 66"  "EGFR_Exon_18"   
"GACCCTTGTCTCTGTGTTCTTG"   "CCTCAAGAGAGCTTGGTTGG"   "23"   "66"
"EGFR_18_2" "Amplifies EGFR_Exon_18 from 60 to 136"   "EGFR_Exon_18"   
"AGCCTCTTACACCCAGTGGA"   "CCTTATACACCGTGCCGAAC"   "60"   "136"
"EGFR_18_3"  "Amplifies EGFR_Exon_18 from 123 to 197"  "EGFR_Exon_18"  
"TGAATTCAAAAAGATCAAAGTG"  "CCCCACCAGACCATGAGA"  "123"  "197"
"EGFR_19_1"  "Amplifies EGFR_Exon_19 from 23 to 115"  "EGFR_Exon_19"  
"TCACAATTGCCAGTTAACGTCT"  "GATTTCCTTGTTGGCTTTCG"  "23"  "115"
"EGFR_19_2"  "Amplifies EGFR_Exon_19 from 67 to 183"  "EGFR_Exon_19"  
"TCTGGATCCCAGAAGGTGAG"  "GAGAAAAGGTGGGCCTGAG"  "67"  "183"
"EGFR_20_1"  "Amplifies EGFR_Exon_20 from 20 to 108"  "EGFR_Exon_20"  
"CCACACTGACGTGCCTCTC"  "GCATGAGCTGCGTGATGAG"  "20"  "108"
"EGFR_20_2"  "Amplifies EGFR_Exon_20 from 102 to 194"  "EGFR_Exon_20"  
"GCATCTGCCTCACCTCCAC"  "GCGATCTGCACACACCAG"  "102"  "194"
"EGFR_20_3"  "Amplifies EGFR_Exon_20 from 153 to 244"  "EGFR_Exon_20"  
"GGCTGCCTCCTGGACTATGT"  "GATCCTGGCTCCTTATCTCC"  "153"  "244"
"EGFR_21_1"  "Amplifies EGFR_Exon_21 from 23 to 113"  "EGFR_Exon_21"  
"TCTTCCCATGATGATCTGTCCC"  "GACATGCTGCGGTGTTTTC"  "23"  "113"
"EGFR_21_2"  "Amplifies EGFR_Exon_21 from 111 to 215"  "EGFR_Exon_21"  
"GGCAGCCAGGAACGTACT"  "ATGCTGGCTGACCTAAAGC"  "111"  "215"
"EGFR_22_1"  "Amplifies EGFR_Exon_22 from 21 to 132"  "EGFR_Exon_22"  
"CACTGCCTCATCTCTCACCA"  "CCAGCTTGGCCTCAGTACA"  "21"  "132"
HERE_TERMINATOR
The Amplicons in this example are fully specified: the Reference Sequences used happen to have enough context to include both the Primer1 and Primer2 matches, and the exact “Start” and “End” target coordinates are known and specified. If the exact coordinates of the targets were not known, asterisks (“*”) could be used as wild cards for the Start and End fields. This would force the application to try and determine the target coordinates by finding perfect matches for the primers, just as the GUI does (see section 2.2.4). “N” characters are counted as matches as long as they don’t make up more than 50% of the match. The results of an automatic primer match must yield one and only one pair of primer matches. If no pair match is found or if more than one match is found for a primer, an error is generated.
The software carries out the primer search, even if the asterisk notation is not used, to validate the target coordinates you supplied manually. This could lead to an error in the cases where your primers have an intentional mismatch with the reference, or where your primers are not included as part of the Reference Sequences. In such cases you would need to supply the correct target coordinates manually, and disable the automatic verification of the target coordinates using the “‑checkPrimerMatch false” option to the “create amplicon” command.
The “create amplicons” command also has an “‑orUpdate” flag like the one discussed for the create reference example (section 3.5.3), which can be used if a script terminates prematurely but after creating and saving one or more Amplicons: this flag will prevent errors due to “pre-existing” Amplicon names if you re-run the script (after fixing it), and will update the existing Amplicons with the new data instead.
Unlike with the creation of Reference Sequences, however, Amplicons cannot always rely solely on the use of the “‑orUpdate” flag because the uniqueness requirement for the naming of Amplicons is only at the level of each Reference Sequence, not for the whole Project. In the case where Amplicons with the same name have been defined relative to different Reference Sequences, the “‑orUpdate” flag would not know which Amplicon it is intended for. Such a situation can be resolved by using an “‑ofRef” parameter to specify the Reference Sequence of the intended Amplicon. Without an “‑ofRef” to properly disambiguate identically named Amplicons when using an “‑orUpdate”, the “create amplicon” command will fail and throw an error.