Experimental Design

2.1	Experimental Design

In this example, we will look for Variants in five exons from the human Epidermal Growth Factor Receptor gene, EGFR exons 18 through 22, in a single DNA source. The sequences of the 5 exons are known (e.g. from public databases), and are shown in Figure 2‑1. We further posit that there is a known Variant in exon 19 that we want to track: a 15 bp deletion at positions 93-107 (inclusive) of the exon.

In order to be able to gather sequencing data from both orientations over the full length of the exons (as much as possible), we define a set of overlapping Amplicons whereby every nucleotide is within about 100 bp from each of two facing primers, providing nearly full coverage of each exon in both orientations (see Figure 2‑1). A Primer Design software can be used to assist in this task.

Note that this example was created for the Genome Sequencer 20 System but that the GS Junior and GS FLX+ Systems feature read lengths of over 400 bp for the GS FLX Titanium chemistry: this would allow a GS Junior or GS FLX+ System user to design longer Amplicons than those used in this example. See the other Manuals and Guides for the relevant chemistry for more details.

Overall, we define 11 Amplicons, as listed in Table 2‑1. To ensure proper representation of all Amplicons in our experiment, we will generate 11 single-peak Amplicon libraries (as opposed to attempting a multiplex amplification). Amplicon libraries are made using Fusion Primers; for our experiment, all forward primers (“Primer1” from Table 2‑1) are fused to Primer A, in the configuration 5’-PrimerA-Primer1-3’; and all reverse primers (“Primer2” from Table 2‑1) are fused to Primer B, in the configuration 5’-PrimerB-Primer2-3’. Since the experiment comprises only one Sample, we do not need to use MIDs; the software will recognize the Amplicon to which each read belongs by looking at the Primer 1 or Primer 2 sequence that it will see at the beginning of the read.

Amplicon Name	Primer1 (Forward; 5’-->3’)	Primer2 (Reverse; 5’-->3’)
EGFR_18_1	GACCCTTGTCTCTGTGTTCTTG	CCTCAAGAGAGCTTGGTTGG
EGFR_18_2	AGCCTCTTACACCCAGTGGA	CCTTATACACCGTGCCGAAC
EGFR_18_3	TGAATTCAAAAAGATCAAAGTG	CCCCACCAGACCATGAGA
EGFR_19_1	TCACAATTGCCAGTTAACGTCT	GATTTCCTTGTTGGCTTTCG
EGFR_19_2	TCTGGATCCCAGAAGGTGAG	GAGAAAAGGTGGGCCTGAG
EGFR_20_1	CCACACTGACGTGCCTCTC	GCATGAGCTGCGTGATGAG
EGFR_20_2	GCATCTGCCTCACCTCCAC	GCGATCTGCACACACCAG
EGFR_20_3	GGCTGCCTCCTGGACTATGT	GATCCTGGCTCCTTATCTCC
EGFR_21_1	TCTTCCCATGATGATCTGTCCC	GACATGCTGCGGTGTTTTC
EGFR_21_2	GGCAGCCAGGAACGTACT	ATGCTGGCTGACCTAAAGC
EGFR_22_1	CACTGCCTCATCTCTCACCA	CCAGCTTGGCCTCAGTACA

Table 2‑1: Names of the Amplicons defined for the EGFR experiment, and the Primers used to create them

Figure 2‑1: DNA sequence of the five human EGFR exons in which we will be searching for Variants, including the location of the regions (colored underlines) with Primers (colored arrows) used to generate Amplicon libraries for sequencing. The known deletion Variant in exon 19 is boxed.

With these Fusion Primers on hand (and the initial DNA sample), we can proceed with the preparation of the 11 Amplicon libraries. Proper amounts are subjected to the emPCR Amplification process using both emPCR Amplification kits II and III (GS FLX standard chemistry), so that we will have reads that will start from both the Primer A and Primer B ends of each Amplicon.

For the GS FLX Titanium chemistry, one would use the GS FLX Titanium emPCR Kit Lib-A (of the appropriate size for the number of reads desired for each Amplicon) to prepare Amplicons in both the A and the B orientations.

Preparing for the sequencing proper, we calculate that with an expected minimum of 33,000 high quality reads per medium region of a PicoTiterPlate Device, we can pool all 11 Amplicon libraries and load them together in a single region and carry out a single sequencing Run: we can then expect approximately 3000 reads for each Amplicon (about 1500 in each orientation), not counting for overlaps, a depth of coverage sufficient to detect and reasonably quantitate Variants down to a frequency of approximately 3-5% (this depends on the nature of the variation, the sequence environment, and other factors), which is sufficient for our purpose. (As above, this example was created for the Genome Sequencer 20 System; for the GS Junior or GS FLX+ Systems, with the GS FLX Titanium chemistry, one would typically expect 70,000 reads per PicoTiterPlate Device, or 130,000 to 200,000 reads per medium region of a PicoTiterPlate Device, respectively, for a good quality library.)