skip to main content
Roche logo
4. GS De Novo Assembler and GS Reference Mapper Appendices : 4.16 Types of Structural Rearrangements : 4.16.7 Translocation (May or May Not Be Inverted)
4.16.7
Translocation (May or May Not Be Inverted)
A translocation is similar to an interspersed duplication, but instead of a segment of the genome being copied to another place in the genome, it is deleted from its original place and moved to the new location. The original reference, start position, end position, and length of the segment are given, along with its target reference and target start position. The original segment’s end position is not listed in the summary, but may appear below if it is supported by shotgun reads. The origin and target reference may or may not be the same.
Example output:
======================================================================
TRANSLOCATION
OrigSubjAccno   OrigSubjStart   RegionName1     OrigSubjEnd     RegionName2     
ToSubjAccno     ToSubjPos       RegionName3     Length  Confidence
gi|6322016|ref|NC_001141.1|     70001           97999           
gi|44829554|ref|NC_001145.2|    105000          27998   High
Consensus: gi|6322016|ref|           69961+ 
AACCTAAATCGCGCCTTATCATCTTGGTAGAAAGTAAACCATCCACTTTAGGCATCTGGACATCCATGAAAATCATATTAT 70041
                                        **
# supporting shotgun reads, pos 70001: 7
# non-supporting shotgun reads, pos 70001: 0
Consensus: gi|6322016|ref|           97959+ 
CCCGCACTGTTTGGTGTTTCGCAAGGTGCCTTATATTTTGCAGTTTACGATACCTTAAAGCAAAGAAAATTGCGACGGAA 98038
                                        *
# supporting shotgun reads, pos 97999: 6
# non-supporting shotgun reads, pos 97999: 0
Consensus: gi|44829554|ref          104960+ 
CTATGCCACATCTGTACAAGGGGGTTCGTGAGACAAGAGCATTTAAAACGACATCAAAGAGCACATACGAACGAGAAACC 105039
                                        *
# supporting shotgun reads, pos 105000: 7
# non-supporting shotgun reads, pos 105000: 0
Individual Variation IDs: 337, 338, 339
======================================================================