skip to main content
Roche logo
4. GS De Novo Assembler and GS Reference Mapper Appendices : 4.16 Types of Structural Rearrangements : 4.16.6 Duplication, Interspersed (May or May Not Be Inverted)
4.16.6
Duplication, Interspersed (May or May Not Be Inverted)
Interspersed duplications involve a segment of the genome being copied to another positions of the genome. The reference of origin, start position, end position, and length of the segment are given, along with its destination (“To”) reference and start position. The segment’s end position in the reference of origin is not listed in the summary, but may appear below if it is supported by shotgun reads. The origin and destination references may or may not be the same.
Example output:
======================================================================
DUPLICATION, INTERSPERSED, INVERTED
OrigSubjAccno   OrigSubjStart   RegionName1     OrigSubjEnd     RegionName2     ToSubjAccno     
ToSubjPos       RegionName3     Length  Confidence
gi|85666114|ref|NC_001136.7|    139931          167891          gi|85666114|ref|NC_001136.7|    
1330001         27960   High
 
Consensus: gi|85666114|ref          139891+ 
TGAAAAAATTGCCGTTGTCCCACAAGGCGGTAACACGGGGTTGGTAGGTGGTTCTGTGCCCATTTTTGATGAATTAATT 139969
                                                            *
# supporting shotgun reads, pos 139931: 3
# non-supporting shotgun reads, pos 139931: 5
 
# supporting shotgun reads, pos 167891: 5
# non-supporting shotgun reads, pos 167891: 8
 
Consensus: gi|85666114|ref         1329961+ 
TCCAAGAGATGCATACAGAACCAGAGATGCTCCACGTGAAAGATCACCAACCAGGTAAGCCATTTATATAGTTGAGAAAA 1330040
                                        *
 
# supporting shotgun reads, pos 1330001: 8
# non-supporting shotgun reads, pos 1330001: 0
 
6 mate pairs inverted, 3' to 3', coverage = 6, frequency = 100.00
From position 140564 to position 1330083
+1185913
+1186047
+1186653
+1187282
+1188394
+1189059
 
11 mate pairs inverted, 5' to 5', coverage = 11, frequency = 100.00
From position 167891 to position 1329830
+1157647        1
+1158077        0
+1158507        1
+1158937        2
+1159367        0
+1159797        1
+1160227        2
+1160657        1
+1161087        1
+1161517        2
 
 
Individual Variation IDs: 73, 74, 101, 102
 
======================================================================