FASTQ File Format

2. Data Files and Formats : 2.2 Format Requirements for Input FASTA and FASTQ Files : 2.2.2 FASTQ File Format

2.2.2

FASTQ File Format

A FASTQ file includes quality scores associated with each position in a sequence. For input read FASTQ file(s) to be readable by the 454 Sequencing System software, they must follow the industry standards for a FASTQ file. In particular:

•	The first line (descriptor line) of each sequence entry in the file should begin with a ‘@’, followed by a sequence identifier and an optional description.

•	Line 2 is the raw sequence, formatted in the same way as a FASTA file, but without line breaks.

•	Multi-line sequences are not supported.

•	Line 3 begins with a “+”, optionally followed by the sequence identifier and any description.

•	Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.

@SEQ_ID Ecolik12     4300K bp

CCTTGTGCAGTAGCACTTAATCATCATGTTTTAGCATTTTGATCTTCTGCTCAATTTCTT

!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

Reads retrieved from an SRA archive are in FASTQ file format, with specific naming conventions that allow automatic detection of Paired End libraries. Do not rename FASTQ files from an SRA archive. Use the ‑lib option with the addRun command to manually specify Paired End libraries for non-SRA archive FASTQ files.

The expected orientations of the halves of a Paired-end read are described in Section 4.8 in Part C of this manual. If the orientations of the halves of paired reads in the FASTQ files deviate from the expected orientations, the reads must be converted to FASTA format with the appropriate paired-end annotations (see Section 4.13.3 in Part C of this manual). In addition, it may be necessary to reverse-complement one or both halves.