skip to main content
Roche logo
2. Data Files and Formats : 2.2 Format Requirements for Input FASTA and FASTQ Files : 2.2.1 FASTA File Format
2.2.1
FASTA File Format
For the reference or input read FASTA file(s) to be readable by the 454 Sequencing System software, they must follow the industry standards for a FASTA file. In particular:
•
The first line (descriptor line) of each sequence entry in the file should begin with a ‘>’.
•
There may be one or more additional header lines for a sequence entry, each beginning with a ‘>’ or ‘;’ character. The first line not beginning with a ‘>’ or ‘;’ starts the sequence region of the entry.
•
The sequence region may contain any characters, but only the alphabetic characters will be used to form the sequence. All alphabetic characters are converted to uppercase, and any alphabetic character that is not A, C, G or T will be treated as an N.
•
Multiple sequences may be included in the file (each starting with a ‘>’).
•
Only the characters between the ‘>’ and the first whitespace character are used to identify the sequence (i.e., the “accno” for the sequence). For clarity, each sequence in a project should be identified uniquely within the characters prior to the first whitespace in their respective descriptor lines.
For example:
>Ecolik12     4300K bp
CCTTGTGCAGTAGCACTTAATCATCATGTTTTAGCATTTTGATCTTCTGCTCAATTTCTT
AAGCTAGACGCTCAATCTTCTTATGATGAACGATTTCTTCTTCATGGTGTTTTTTCATAT
……