QC Analysis Report

Contract Information	Contract Content
Contract ID	H202SC25117278
Contract Name	BVT-US-Stanford-3-premade-Flex-3-UG100_Wafers-WOBI--NVUS2025111710
Batch ID	X202SC25117278-Z01-F001
Report Time	2026-01-14

Novogene Co., Ltd

A. Library Preparation and Sequencing

For pre-made Ultima libraries, Library QC is conducted prior to loading. If conversion is required, non-Ultima libraries must be stored separately in individual tubes and undergo a pre-conversion check. Qualified libraries will then have their adapters replaced with Ultima adapters to ensure compatibility with the UG100 system.

From the sample input to the final data, each step—including sample processing, library preparation, and sequencing—can impact data quality. To ensure reliability, quality control is implemented throughout the workflow.

1 Library Quality Control and Sequencing

Library quality control is then performed to confirm the loading concentration for sequencing on the Ultima UG100 platform. Once sequencing is complete, the data undergoes QC to generate a data QC report for settlement.

Novogene Co., Ltd

B. Results and Instructions

1 Data Quality Control

1.1 Distribution of Sequencing Quality

The “e” represents the sequence error rate and Q_phred represents the base quality value,Q_phred=-10log₁₀(e). The relationship between sequencing error rate (e) and sequencing base quality value (Q_phred) is shown in the table below:

Phred score	Error base	Right base	Q-score
10	1/10	90%	Q10
20	1/100	99%	Q20
30	1/1000	99.9%	Q30
40	1/10000	99.99%	Q40

The distribution of quality score is shown in Fig.1:

Fig.1 Distribution of Sequencing Quality

The base position is on the horizontal axis and the sequencing quality is on the vertical axis.

Novogene Co., Ltd

1.2 Distribution of Sequencing Error Rate

The error rate of this project is shown in Fig.2:

Fig.2 Error Rate Distribution

The base position is on the horizontal axis and the single base error rate is on the vertical axis

Novogene Co., Ltd

1.3 Distribution of A/T/G/C Base

It is used to assess the distribution of GC content to determine the separation between AT and GC. According to the principle of complementary base pairing, the proportions of AT and GC should be equal at each sequencing cycle and remain constant throughout the sequencing process.

The distribution of GC content is shown in Fig.3:

Fig.3 A/T/G/C Distribution

The base position is on the horizontal axis and the single base percentage is on the vertical axis

Novogene Co., Ltd

1.4 Results of Raw Data Filtering

Sequenced reads (raw reads) often contain low-quality reads and adapter sequences, which can impact analysis quality. Therefore, filtering is necessary to obtain clean reads. The filtering process includes:

(1) Remove reads containing N > 10% (N represents the base cannot be determined).

(2) Remove reads containing low quality (Qscore<= 5) base which is over 50% of the total base.

The Sequencing data filtration of this project can be seen in Fig.4 :

Fig.4 Composition of Raw Data

Different color for different components:

(1)Containing N: (reads with more than 10% N) / (total raw reads)

(2)Low quality: (reads of low quality) / (total raw reads)

(3)Clean reads: (clean reads) / (total raw reads)

Novogene Co., Ltd

2 Summary of Sequencing Data Information

The total output of data on the sequencer: Raw data 23429.5 M rawreads; 6315.4 G.

The detail statistics for the quality of sequencing data are shown in Table 1.

Table 1 Data Quality Summary

Sample	Library_Flowcell_Lane	Raw reads	Raw data	Effective(%)	Error(%)	Q20(%)	Q30(%)	GC(%)
L4897	WKDL250008800-1A_436948_L1	3184905519	785.5	100.00	0.38	85.81	68.04	51.10
L4618	WKDL250008800-1A_436948_L1	5214910897	1420.0	100.00	0.26	87.65	70.41	34.03
L4616	WKDL250008800-1A_436948_L1	5263039296	1330.3	100.00	0.22	88.99	73.20	36.47
L4507	WKDL250008801-1A_438501_L1	199157984	53.8	100.00	0.20	81.08	53.57	46.93
L4508	WKDL250008801-1A_438501_L1	295152716	79.6	100.00	0.13	81.37	54.87	46.52
L4510	WKDL250008801-1A_438501_L1	9095089	2.4	100.00	0.29	81.53	56.06	51.25
L4515	WKDL250008801-1A_438501_L1	27840311	7.9	100.00	0.31	82.25	57.73	45.39
L4518	WKDL250008801-1A_438501_L1	292735238	86.0	100.00	0.38	80.71	56.14	42.71
L4493	WKDL250008801-1A_438501_L1	14810783	4.0	100.00	0.41	80.82	55.19	40.51
L4503	WKDL250008801-1A_438501_L1	14996472	4.1	100.00	0.29	81.47	56.92	50.04
L4504	WKDL250008801-1A_438501_L1	58461571	15.1	100.00	0.33	79.84	50.16	49.73
L4513	WKDL250008801-1A_438501_L1	32004058	8.8	100.00	0.28	81.67	55.77	46.30
L4492	WKDL250008801-1A_438501_L1	4241712	1.1	100.00	0.35	79.74	53.46	54.01
L4521	WKDL250008801-1A_438501_L1	425571307	122.6	100.00	0.24	82.00	57.33	46.00
L4491	WKDL250008801-1A_438501_L1	9189677	2.5	100.00	0.34	81.73	56.09	47.46
L4499	WKDL250008801-1A_438501_L1	236365349	63.2	100.00	0.20	80.43	52.24	45.87
L4500	WKDL250008801-1A_438501_L1	10784918	3.0	100.00	0.26	81.86	55.90	47.54
L4509	WKDL250008801-1A_438501_L1	10312878	2.7	100.00	0.28	81.67	56.27	50.75
L4511	WKDL250008801-1A_438501_L1	20039998	5.5	100.00	0.27	82.51	58.33	47.98
L4512	WKDL250008801-1A_438501_L1	210170585	56.0	100.00	0.13	80.43	52.16	46.37
L4494	WKDL250008801-1A_438501_L1	6877142	1.8	100.00	0.31	80.19	54.52	52.19
L4495	WKDL250008801-1A_438501_L1	55102123	13.2	100.00	0.36	77.81	46.05	49.72
L4498	WKDL250008801-1A_438501_L1	136372016	36.6	100.00	0.35	80.54	52.36	47.43
L4502	WKDL250008801-1A_438501_L1	11887928	3.2	100.00	0.33	81.46	56.65	49.02
L4514	WKDL250008801-1A_438501_L1	23442141	6.3	100.00	0.29	81.27	54.09	48.24
L4519	WKDL250008801-1A_438501_L1	323029215	93.8	100.00	0.28	82.32	58.22	48.86
L4488	WKDL250008801-1A_438501_L1	202618942	57.4	100.00	0.09	81.60	55.67	45.15
L4490	WKDL250008801-1A_438501_L1	208272184	58.2	100.00	0.33	81.09	54.94	45.70
L4497	WKDL250008801-1A_438501_L1	260825168	74.0	100.00	0.22	81.28	55.20	42.22
L4516	WKDL250008801-1A_438501_L1	27005800	7.7	100.00	0.25	83.11	59.26	48.26
L4505	WKDL250008801-1A_438501_L1	4609288	1.2	100.00	0.31	80.98	54.52	44.25
L4489	WKDL250008801-1A_438501_L1	210104301	57.4	100.00	0.35	81.26	53.88	45.06
L4506	WKDL250008801-1A_438501_L1	317275170	89.8	100.00	0.25	81.82	56.10	44.66
L4517	WKDL250008801-1A_438501_L1	48541901	14.1	100.00	0.31	82.28	59.31	46.93
L4520	WKDL250008801-1A_438501_L1	455183227	131.7	100.00	0.32	81.03	55.83	46.11
L4496	WKDL250008801-1A_438501_L1	16887816	4.4	100.00	0.32	80.79	53.71	51.66
L4501	WKDL250008801-1A_438501_L1	3027235	0.8	100.00	0.29	80.72	54.69	55.50
L4525	WKDL250008802-1A_438534_L1	4944823	1.3	100.00	0.31	79.50	50.74	47.44
L4554	WKDL250008802-1A_438534_L1	299006468	84.4	100.00	0.07	82.46	56.39	48.11
L4529	WKDL250008802-1A_438534_L1	8894124	2.2	100.00	0.30	80.85	52.73	54.61
L4539	WKDL250008802-1A_438534_L1	5247727	1.5	100.00	0.26	83.06	57.48	49.05
L4542	WKDL250008802-1A_438534_L1	222401310	59.9	100.00	0.12	81.53	53.97	47.73
L4538	WKDL250008802-1A_438534_L1	15969724	4.5	100.00	0.25	83.81	59.42	50.25
L4546	WKDL250008802-1A_438534_L1	16440179	4.4	100.00	0.26	82.21	54.50	48.81
L4523	WKDL250008802-1A_438534_L1	441030459	129.7	100.00	0.05	83.61	57.93	47.81
L4533	WKDL250008802-1A_438534_L1	7081663	1.9	100.00	0.27	82.94	56.44	51.52
L4534	WKDL250008802-1A_438534_L1	212072842	59.5	100.00	0.06	82.44	56.03	48.16
L4535	WKDL250008802-1A_438534_L1	427058997	123.1	100.00	0.08	82.84	56.18	44.95
L4541	WKDL250008802-1A_438534_L1	12416129	3.4	100.00	0.27	82.46	55.29	50.85
L4531	WKDL250008802-1A_438534_L1	33737226	9.3	100.00	0.27	82.73	56.00	49.70
L4550	WKDL250008802-1A_438534_L1	338214249	98.4	100.00	0.08	83.24	58.56	46.03
L4555	WKDL250008802-1A_438534_L1	410829197	119.9	100.00	0.29	82.97	57.93	45.37
L4556	WKDL250008802-1A_438534_L1	60619210	17.8	100.00	0.29	83.48	59.03	45.36
L4558	WKDL250008802-1A_438534_L1	329231397	97.1	100.00	0.08	82.55	57.46	45.09
L4559	WKDL250008802-1A_438534_L1	319081067	90.4	100.00	0.34	82.23	55.65	49.34
L4530	WKDL250008802-1A_438534_L1	29317731	8.2	100.00	0.30	83.34	56.38	48.87
L4532	WKDL250008802-1A_438534_L1	16966649	4.8	100.00	0.27	83.48	58.39	51.25
L4543	WKDL250008802-1A_438534_L1	261026753	71.3	100.00	0.06	81.50	53.77	47.22
L4545	WKDL250008802-1A_438534_L1	14780958	4.0	100.00	0.26	82.46	54.94	49.41
L4547	WKDL250008802-1A_438534_L1	18901049	5.2	100.00	0.30	81.96	55.21	46.93
L4549	WKDL250008802-1A_438534_L1	16826112	4.1	100.00	0.30	79.11	47.95	49.12
L4551	WKDL250008802-1A_438534_L1	309165668	90.1	100.00	0.05	83.56	58.96	47.32
L4552	WKDL250008802-1A_438534_L1	41223303	11.5	100.00	0.26	83.40	58.13	49.45
L4524	WKDL250008802-1A_438534_L1	583578147	175.2	100.00	0.07	83.27	58.86	45.60
L4526	WKDL250008802-1A_438534_L1	6897565	1.8	100.00	0.33	79.53	49.52	48.16
L4527	WKDL250008802-1A_438534_L1	390784085	115.2	100.00	0.08	83.05	58.14	48.39
L4537	WKDL250008802-1A_438534_L1	11151207	3.0	100.00	0.30	81.73	54.53	53.25
L4540	WKDL250008802-1A_438534_L1	20682106	5.8	100.00	0.26	83.57	58.62	50.14
L4544	WKDL250008802-1A_438534_L1	34023414	9.8	100.00	0.29	83.63	59.57	47.45
L4548	WKDL250008802-1A_438534_L1	22274143	6.3	100.00	0.28	82.34	55.29	44.96
L4536	WKDL250008802-1A_438534_L1	19385052	5.6	100.00	0.19	83.02	57.34	47.75
L4553	WKDL250008802-1A_438534_L1	27100385	7.4	100.00	0.26	82.79	56.36	53.10
L4557	WKDL250008802-1A_438534_L1	54239814	15.6	100.00	0.29	82.70	57.85	48.49
L4560	WKDL250008802-1A_438534_L1	59689628	16.8	100.00	0.11	82.62	57.04	48.96
L4561	WKDL250008802-1A_438534_L1	34944965	9.8	100.00	0.27	83.03	56.91	48.03
L4522	WKDL250008802-1A_438534_L1	447416974	129.2	100.00	0.09	82.82	57.04	45.89
L4528	WKDL250008802-1A_438534_L1	3749	0.0	100.00	0.15	83.38	62.37	48.19

Sample: sample name
Library_Flowcell_Lane: Library ID_Flowcell ID_lane ID, for raw data file naming.
Raw reads: total amount of reads of raw data, each four lines taken as one unit. For paired-end sequencing, it equals the amount of read1 and read2, otherwise it equals the amount of read1 for single-end sequencing.
Raw data: (Raw reads) * (sequence length), calculating in G. For paired-end sequencing like PE150, sequencing length equals 150, otherwise it equals 50 for sequencing like SE50.
Effective: (Clean reads/Raw reads)*100%
Error: base error rate
Q20, Q30: (Base count of Phred value > 20 or 30) / (Total base count)
GC: (G & C base count) / (Total base count)

Novogene Co., Ltd

C. Appendix

1 Introduction of Sequencing Data Format

The original raw data from UG100 platform are transformed to Sequenced Reads, known as Raw Data or RAW Reads, by base calling. Raw data are recorded in a FASTQ file, which contains sequencing reads and corresponding sequencing quality. Every read in FASTQ format is stored in four lines, as indicated below (Cock P.J.A. et al. 2010):

@V150:418291:NA:NA:1:1:1:277:13:1:868:N:0.756:CAGTTCATCTGTGAT:NA:1379
NAAGAACACGTTCGGTCACCTCAGCACACTTGTGAATGTCATGGGATCCAT
+
#55???BBBBB?BA@DEEFFCFFHHFFCFFHHHHHHHFAE0ECFFD/AEHH

Line 1 begins with a '@' character and is followed by the Ultima Sequence Identifiers and an optional description.

Identifier	Meaning
V150	Instrument ID
418291	Run ID
NA	reserved (NA)
NA	reserved (NA)
1	Camera
1	Ring
1	Tile
277	X pos
13	Y pos
1	Segment num
868	First flow signal
N	Filtered (Y/N)
0.756	RSQ (Read quality)
CAGTTCATCTGTGAT	Barcode
NA	UMI
1379	Bead index

Line 2 is the raw sequence of the read.

Line 3 begins with a '+' character and is optionally followed by the same sequence identifiers and descriptions as in Line 1.

Line 4 encodes the quality values for the bases in Line 2 and contains the same number of characters as the bases in the read (Cock, 2009.).

2 Explanation of Sequencing Data Related

(1) Q-Score Comparison It is not recommended to directly compare Q-scores between the Ultima sequencing platform and other sequencing platforms (e.g., Illumina) due to differences in how sequencing error rates are calculated. The Ultima platform determines error rates primarily based on base length accuracy, whereas the Illumina platform relies on fluorescence color, intensity, and background noise.

(2) Data Integrity Check The sequencing data is provided as a compressed file in the '.fq.gz' format. Before data delivery, we calculate the MD5 checksum for each compressed file, which should be verified upon receipt. In a Linux environment, use the command: md5sum -c <*md5.txt>. In a Windows environment, a checksum verification tool (e.g., HashMyFiles) can be used. If the MD5 value of the compressed file does not match the one provided in the MD5 file, the file may have been corrupted during transmission.

(3) Single-Cell Sequencing Data on UG100 For single-cell sequencing data generated on the UG100 platform, each sample consists of two data files: a Read 1 file and a Read 2 file. These files contain the same number of lines. In a Linux environment, you can verify this using the command: wc -l . The total line count divided by 4 gives the number of reads.

(4) Data Size and Storage The data size refers to the storage space occupied on the hard disk, which depends on the disk format and compression ratio. It does not affect the total number of sequenced bases. As a result, the file sizes of Read 1 and Read 2 may not be identical.

(5) Clean Data Delivery We will apply strict filtering standards to ensure high-quality data suitable for further research and publication. The data filtered using this standard has been recognized in high-impact publications (e.g., Yan L.Y. et al., 2013). For more details, please contact us.

(6) Read Processing The Read 1 and Read 2 sequences are assigned based on the index read. Since both reads represent sample sequences, there is no need to trim the beginning or end of the reads during downstream analysis (e.g., mapping).

(7) Data Retention Policy Outdated data will be deleted 30 days after data delivery. Please ensure that you store your data properly. If you have any questions or concerns, contact us as soon as possible.

3 Result File Decompression Method

Compressed.format	Customer.type	Uncompressed.method
compressed files in the fomat of *.tar:	Unix/Linux/Mac user	use tar -xvf *.tar command
compressed files in the fomat of *.tar:	Windows user	use uncompressed software such as WinRAR, 7-Zip et al
compressed files in the format of *.gz:	Unix/Linux/Mac user	use gzip –d *.gz command
compressed files in the format of *.gz:	Windows user	use uncompressed software such as WinRAR, 7-Zip et al
compressed files in the format of *.zip:	Unix/Linux/Mac user	use unzip *.zip command
compressed files in the format of *.zip:	Windows user	use uncompressed software such as WinRAR, 7-Zip et al

4 References

Cock P.J.A. et al (2010). The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic acids research 38, 1767-1771.

Hansen K.D. et al (2010). Biases in Illumina transcriptome sequencing caused by random hexamer priming. Nucleic acids research 38, e131-e131.

Erlich Y.et al (2008). Alta-Cyclic: a self-optimizing base caller for next-generation sequencing.Nature Methods,5,679-682.

Jiang L.C. et al (2011). Synthetic spike-in standards for RNA-seq experiments. Genome research 21, 1543-1551.

Yan L.Y. et al (2013). Single-cell RNA-Seq profiling of human preimplantation embryos and embryonic stem cells. Nat Struct Mol Biol.