******************************************************************************** MEME - Motif discovery tool ******************************************************************************** MEME version 5.0.1 (Release date: Wed Aug 22 15:26:53 2018 -0700) For further information on how to interpret please access http://meme-suite.org. To get a copy of the MEME software please access http://meme-suite.org. ******************************************************************************** ******************************************************************************** REFERENCE ******************************************************************************** If you use this program in your research, please cite: Timothy L. Bailey and Charles Elkan, "Fitting a mixture model by expectation maximization to discover motifs in biopolymers", Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park, California, 1994. ******************************************************************************** ******************************************************************************** TRAINING SET ******************************************************************************** PRIMARY SEQUENCES= common/Klf1-200.fa CONTROL SEQUENCES= --none-- ALPHABET= ACGT ******************************************************************************** ******************************************************************************** COMMAND LINE SUMMARY ******************************************************************************** This information can also be useful in the event you wish to report a problem with the MEME software. command: meme common/Klf1-200.fa -oc results/meme37 -mod oops -dna -revcomp -brief 0 -nmotifs 2 -objfun cd -maxw 30 -searchsize 40000 -norand -nostatus model: mod= oops nmotifs= 2 evt= inf objective function: em= Central Enrichment: p-value of mean distance starts= Mean distance of best site from center strands: + - width: minw= 8 maxw= 30 nsites: minsites= 200 maxsites= 200 wnsites= 0.8 theta: spmap= uni spfuzz= 0.5 em: prior= dirichlet b= 0.01 maxiter= 50 distance= 1e-05 data: n= 100000 N= 200 sample: seed= 0 hsfrac= 0.5 searchsize= 40000 norand= yes csites= -1 Letter frequencies in dataset: A 0.256 C 0.244 G 0.244 T 0.256 Background letter frequencies (from file dataset with add-one prior applied): A 0.256 C 0.244 G 0.244 T 0.256 Background model order: 0 ******************************************************************************** ******************************************************************************** MOTIF RGMWGGGTGTGGCYNSNKNN MEME-1 width = 20 sites = 200 llr = 1434 p-value = 1.8e-004 E-value = 1.8e-004 ******************************************************************************** -------------------------------------------------------------------------------- Motif RGMWGGGTGTGGCYNSNKNN MEME-1 Description -------------------------------------------------------------------------------- Simplified A 4234:::1:12111223122 pos.-specific C 113::::2:::164232222 probability G 2521999:937611343433 matrix T 222511:7:61233322333 bits 2.0 1.8 1.6 * * 1.4 *** * Relative 1.2 *** * Entropy 1.0 *** * (10.3 bits) 0.8 *** * * 0.6 ******** 0.4 ********** 0.2 ** *********** * 0.0 -------------------- Multilevel AGCTGGGTGTGGCCGGGGGT consensus GTAA G TTTTCATTG sequence C T AC C C -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif RGMWGGGTGTGGCYNSNKNN MEME-1 position-specific scoring matrix -------------------------------------------------------------------------------- log-odds matrix: alength= 4 w= 20 n= 67785 bayes= 9.40269 E= 1.8e-004 74 -94 2 -37 -53 -94 100 -30 31 51 -54 -61 60 -383 -186 104 -250 -406 186 -221 -333 -406 188 -197 -286 -331 192 -406 -115 -32 -331 138 -406 -331 192 -286 -221 -281 12 133 -55 -331 155 -159 -159 -122 121 -6 -143 121 -171 5 -92 80 -136 43 -39 -12 27 16 -47 22 62 -72 -1 -18 27 -12 -115 -32 80 5 -12 -18 27 -1 -39 -18 22 25 -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif RGMWGGGTGTGGCYNSNKNN MEME-1 position-specific probability matrix -------------------------------------------------------------------------------- letter-probability matrix: alength= 4 w= 20 nsites= 200 E= 1.8e-004 0.427940 0.127060 0.247060 0.197940 0.177940 0.127060 0.487060 0.207940 0.317940 0.347060 0.167060 0.167940 0.387940 0.017060 0.067060 0.527940 0.045377 0.014623 0.884623 0.055377 0.025377 0.014623 0.894623 0.065377 0.035377 0.024623 0.924623 0.015377 0.115377 0.194623 0.024623 0.665377 0.015377 0.024623 0.924623 0.035377 0.055377 0.034623 0.264623 0.645377 0.175377 0.024623 0.714623 0.085377 0.085377 0.104623 0.564623 0.245377 0.095377 0.564623 0.074623 0.265377 0.135377 0.424623 0.094623 0.345377 0.195377 0.224623 0.294623 0.285377 0.185377 0.284623 0.374623 0.155377 0.255377 0.214623 0.294623 0.235377 0.115377 0.194623 0.424623 0.265377 0.235377 0.214623 0.294623 0.255377 0.195377 0.214623 0.284623 0.305377 -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif RGMWGGGTGTGGCYNSNKNN MEME-1 regular expression -------------------------------------------------------------------------------- [AG][GT][CA][TA]GGGTG[TG]G[GT][CT][CT][GTC][GC][GATC][GT][GTAC][TGC] -------------------------------------------------------------------------------- Time 4.60 secs. ******************************************************************************** ******************************************************************************** MOTIF TNVHHBCTBNYYBNHHYYYCTTVTCTCTGB MEME-2 width = 30 sites = 200 llr = 1155 p-value = 7.6e-001 E-value = 1.3e+000 ******************************************************************************** -------------------------------------------------------------------------------- Motif TNVHHBCTBNYYBNHHYYYCTTVTCTCTGB MEME-2 Description -------------------------------------------------------------------------------- Simplified A 12223112121112332111114:11:112 pos.-specific C 222423524243332345352222717122 probability G 2341132122112221111211221:1:63 matrix T 532243253434434333516626181713 bits 2.0 1.8 1.6 1.4 Relative 1.2 Entropy 1.0 * (8.3 bits) 0.8 *** 0.6 **** 0.4 ** ****** 0.2 * ****** ** ****** ****** 0.0 ------------------------------ Multilevel TTGCTCCTCTCTTTTACCTCTTATCTCTGG consensus CGCAATTATCTCCCATTTC CC T sequence AATCG GA CC G C G -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif TNVHHBCTBNYYBNHHYYYCTTVTCTCTGB MEME-2 position-specific scoring matrix -------------------------------------------------------------------------------- log-odds matrix: alength= 4 w= 30 n= 65785 bayes= 9.43658 E= 1.3e+000 -114 -14 -66 99 -31 -45 16 42 -31 -7 69 -62 -5 79 -114 -22 3 1 -155 68 -158 42 16 30 -158 108 -45 -22 -31 -35 -155 102 -106 63 -1 1 -33 -1 -27 46 -81 67 -105 45 -81 51 -123 65 -95 33 -30 50 -56 27 -30 39 -1 -11 -63 50 33 13 -123 27 -68 86 -143 27 -128 98 -105 20 -128 27 -105 92 -81 114 -40 -95 -88 -56 -210 132 -138 -25 -82 112 58 -16 -16 -51 -252 -35 -69 126 -191 153 -72 -165 -198 -166 -274 168 -264 158 -101 -124 -88 -154 -250 152 -103 -45 126 -119 -75 1 42 10 -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif TNVHHBCTBNYYBNHHYYYCTTVTCTCTGB MEME-2 position-specific probability matrix -------------------------------------------------------------------------------- letter-probability matrix: alength= 4 w= 30 nsites= 200 E= 1.3e+000 0.116055 0.221783 0.154216 0.507947 0.207186 0.177949 0.272544 0.342321 0.207186 0.232003 0.394165 0.166645 0.247727 0.421192 0.110382 0.220699 0.261240 0.245517 0.083355 0.409889 0.085564 0.326598 0.272544 0.315294 0.085564 0.515787 0.177949 0.220699 0.207186 0.191463 0.083355 0.517997 0.122642 0.377358 0.242223 0.257777 0.203723 0.242223 0.201683 0.352371 0.146205 0.387579 0.117308 0.348908 0.146205 0.347038 0.103795 0.402962 0.132692 0.306498 0.198389 0.362421 0.173232 0.292984 0.198389 0.335394 0.254313 0.225416 0.157849 0.362421 0.321881 0.265957 0.103795 0.308367 0.159719 0.441633 0.090281 0.308367 0.105665 0.482173 0.117308 0.294854 0.105665 0.292984 0.117308 0.484043 0.146205 0.536227 0.184876 0.132692 0.139278 0.164776 0.056668 0.639278 0.098738 0.205316 0.137749 0.558197 0.382522 0.218830 0.218830 0.179819 0.044684 0.191803 0.151262 0.612251 0.068247 0.702023 0.147969 0.081761 0.064784 0.077108 0.036567 0.821541 0.041220 0.729050 0.120942 0.108788 0.139278 0.083695 0.043154 0.733873 0.125765 0.178289 0.583695 0.112251 0.152792 0.245857 0.326938 0.274414 -------------------------------------------------------------------------------- -------------------------------------------------------------------------------- Motif TNVHHBCTBNYYBNHHYYYCTTVTCTCTGB MEME-2 regular expression -------------------------------------------------------------------------------- [TC][TGA][GCA][CAT][TAC][CTG][CT][TA][CTG][TCAG][CT][TC][TC][TC][TAC][ATC][CT][CT][TC]CT[TC][ACG]TCTCTG[GTC] -------------------------------------------------------------------------------- Time 8.94 secs. ******************************************************************************** ******************************************************************************** Stopped because requested number of motifs (2) found. ******************************************************************************** CPU: Timothys-iMac.rd.unr.edu ********************************************************************************