******************************************************************************** MAST - Motif Alignment and Search Tool ******************************************************************************** MAST version 5.0.2 (Release date: Wed Aug 22 15:26:53 2018 -0700) For further information on how to interpret these results please access http://localhost:8080/meme_5.0.1. To get a copy of the MAST software please access http://meme-suite.org. ******************************************************************************** ******************************************************************************** REFERENCE ******************************************************************************** If you use this program in your research, please cite: Timothy L. Bailey and Michael Gribskov, "Combining evidence using p-values: application to sequence homology searches", Bioinformatics, 14(48-54), 1998. ******************************************************************************** ******************************************************************************** DATABASE AND MOTIFS ******************************************************************************** DATABASE crp0.s (nucleotide) Last updated on Tue Jun 20 11:02:46 2017 Database contains 18 sequences, 1890 residues Scores for positive and reverse complement strands are combined. MOTIFS meme.crp0.de.zoops.xml (nucleotide) MOTIF ID ALT ID WIDTH BEST POSSIBLE MATCH ----- ------------ ------ ----- ------------------- 1 KGMGYDDKBTCA MEME-1 12 TGCGTGGGCTCA 2 TSTKTAAYTGTG MEME-2 12 TGTGTAATTGTG PAIRWISE MOTIF CORRELATIONS: MOTIF 1 ----- ----- 2 0.25 No overly similar pairs (correlation > 0.60) found. Random model letter frequencies (from non-redundant database): A 0.274 C 0.225 G 0.225 T 0.274 ******************************************************************************** ******************************************************************************** SECTION I: HIGH-SCORING SEQUENCES ******************************************************************************** - Each of the following 15 sequences has E-value less than 10. - The E-value of a sequence is the expected number of sequences in a random database of the same size that would match the motifs as well as the sequence does and is equal to the combined p-value of the sequence times the number of sequences in the database. - The combined p-value of a sequence measures the strength of the match of the sequence to all the motifs and is calculated by o finding the score of the single best match of each motif to the sequence (best matches may overlap), o calculating the sequence p-value of each score, o forming the product of the p-values, o taking the p-value of the product. - The sequence p-value of a score is defined as the probability of a random sequence of the same length containing some match with as good or better a score. - The score for the match of a position in a sequence to a motif is computed by by summing the appropriate entry from each column of the position-dependent scoring matrix that represents the motif. - Sequences shorter than one or more of the motifs are skipped. - The table is sorted by increasing E-value. ******************************************************************************** SEQUENCE NAME DESCRIPTION E-VALUE LENGTH ------------- ----------- -------- ------ lac 9 80 5.7e-05 105 tdc 78 0.0009 105 deop2 7 60 0.0015 105 bglr1 76 0.0033 105 male 14 0.0041 105 pbr322 53 0.022 105 tnaa 71 0.03 105 malt 41 0.64 105 ara 17 55 1.4 105 malk 29 61 1.5 105 ce1cg 17 61 2.6 105 ilv 39 7.1 105 ompa 48 7.9 105 trn9cat 1 84 8.7 105 cya 50 8.9 105 ******************************************************************************** ******************************************************************************** SECTION II: MOTIF DIAGRAMS ******************************************************************************** - The ordering and spacing of all non-overlapping motif occurrences are shown for each high-scoring sequence listed in Section I. - A motif occurrence is defined as a position in the sequence whose match to the motif has POSITION p-value less than 0.0001. - The POSITION p-value of a match is the probability of a single random subsequence of the length of the motif scoring at least as well as the observed match. - For each sequence, all motif occurrences are shown unless there are overlaps. In that case, a motif occurrence is shown only if its p-value is less than the product of the p-values of the other (lower-numbered) motif occurrences that it overlaps. - The table also shows the E-value of each sequence. - Spacers and motif occurences are indicated by o -d- `d' residues separate the end of the preceding motif occurrence and the start of the following motif occurrence o [sn] occurrence of motif `n' with p-value less than 0.0001. A minus sign indicates that the occurrence is on the reverse complement strand. ******************************************************************************** SEQUENCE NAME E-VALUE MOTIF DIAGRAM ------------- -------- ------------- lac 5.7e-05 13-[+1]-50-[+2]-18 tdc 0.0009 34-[+2]-36-[+1]-11 deop2 0.0015 54-[+2]-39 bglr1 0.0033 55-[-2]-13-[+1]-13 male 0.0041 14-[+2]-20-[+1]-47 pbr322 0.022 2-[+2]-43-[-1]-36 tnaa 0.03 85-[-2]-8 malt 0.64 105 ara 1.4 105 malk 1.5 105 ce1cg 2.6 105 ilv 7.1 105 ompa 7.9 105 trn9cat 8.7 105 cya 8.9 105 ******************************************************************************** ******************************************************************************** SECTION III: ANNOTATED SEQUENCES ******************************************************************************** - The positions and p-values of the non-overlapping motif occurrences are shown above the actual sequence for each of the high-scoring sequences from Section I. - A motif occurrence is defined as a position in the sequence whose match to the motif has POSITION p-value less than 0.0001 as defined in Section II. - For each sequence, the first line specifies the name of the sequence. - The second (and possibly more) lines give a description of the sequence. - Following the description line(s) is a line giving the length, combined p-value, and E-value of the sequence as defined in Section I. - The next line reproduces the motif diagram from Section II. - The entire sequence is printed on the following lines. - Motif occurrences are indicated directly above their positions in the sequence on lines showing o the motif number of the occurrence (a minus sign indicates that the occurrence is on the reverse complement strand), o the position p-value of the occurrence, o the best possible match to the motif (or its reverse complement), and o columns whose match to the motif has a positive score (indicated by a plus sign). ******************************************************************************** lac 9 80 LENGTH = 105 COMBINED P-VALUE = 3.18e-06 E-VALUE = 5.7e-05 DIAGRAM: 13-[+1]-50-[+2]-18 [+1] 4.1e-06 TGCGTGGGCTCA ++++++ +++++ 1 AACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTG [+2] 1.3e-06 TGTGTAATTGTG ++++ +++++++ 76 TGTGGAATTGTGAGCGGATAACAATTTCAC tdc 78 LENGTH = 105 COMBINED P-VALUE = 5.01e-05 E-VALUE = 0.0009 DIAGRAM: 34-[+2]-36-[+1]-11 [+2] 1.5e-05 TGTGTAATTGTG + +++++++++ 1 GATTTTTATACTTTAACTTGTTGATATTTAAAGGTATTTAATTGTAATAACGATACTCTGGAAAGTATTGAAAGT [+1] 7.2e-06 TGCGTGGGCTCA ++++++++++++ 76 TAATTTGTGAGTGGTCGCACATATCCTGTT deop2 7 60 LENGTH = 105 COMBINED P-VALUE = 8.44e-05 E-VALUE = 0.0015 DIAGRAM: 54-[+2]-39 [+2] 1.1e-06 TGTGTAATTGTG ++++++++++++ 1 AGTGAATTATTTGAACCAGATCGCATTACAGTGATGCAAACTTGTAAGTAGATTTCCTTAATTGTGATGTGTATC bglr1 76 LENGTH = 105 COMBINED P-VALUE = 1.83e-04 E-VALUE = 0.0033 DIAGRAM: 55-[-2]-13-[+1]-13 [-2] 1.6e-05 CACAATTACACA + +++++++++ 1 ACAAATCCCAATAACTTAATTATTGGGATTTGTTATATATAACTTTATAAATTCCTAAAATTACACAAAGTTAAT [+1] 2.6e-05 TGCGTGGGCTCA +++++ +++++ 76 AACTGTGAGCATGGTCATATTTTTATCAAT male 14 LENGTH = 105 COMBINED P-VALUE = 2.26e-04 E-VALUE = 0.0041 DIAGRAM: 14-[+2]-20-[+1]-47 [+2] [+1] 4.8e-05 1.1e-05 TGTGTAATTGTG TGCGTGGGCTCA ++++++++ + + +++++ ++++++ 1 ACATTACCGCCAATTCTGTAACAGAGATCACACAAAGCGACGGTGGGGCGTAGGGGCAAGGAGGATGGAAAGAGG pbr322 53 LENGTH = 105 COMBINED P-VALUE = 1.23e-03 E-VALUE = 0.022 DIAGRAM: 2-[+2]-43-[-1]-36 [+2] [-1] 3.7e-05 9.5e-05 TGTGTAATTGTG TGAGCCCACGCA ++++++++ ++ +++ + + ++++ 1 CTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATG tnaa 71 LENGTH = 105 COMBINED P-VALUE = 1.68e-03 E-VALUE = 0.03 DIAGRAM: 85-[-2]-8 [-2] 1.8e-06 CACAATTACACA ++++ +++++++ 76 TGATTCGATTCACATTTAAACAATTTCAGA malt 41 LENGTH = 105 COMBINED P-VALUE = 3.55e-02 E-VALUE = 0.64 DIAGRAM: 105 ara 17 55 LENGTH = 105 COMBINED P-VALUE = 8.02e-02 E-VALUE = 1.4 DIAGRAM: 105 malk 29 61 LENGTH = 105 COMBINED P-VALUE = 8.24e-02 E-VALUE = 1.5 DIAGRAM: 105 ce1cg 17 61 LENGTH = 105 COMBINED P-VALUE = 1.44e-01 E-VALUE = 2.6 DIAGRAM: 105 ilv 39 LENGTH = 105 COMBINED P-VALUE = 3.92e-01 E-VALUE = 7.1 DIAGRAM: 105 ompa 48 LENGTH = 105 COMBINED P-VALUE = 4.36e-01 E-VALUE = 7.9 DIAGRAM: 105 trn9cat 1 84 LENGTH = 105 COMBINED P-VALUE = 4.86e-01 E-VALUE = 8.7 DIAGRAM: 105 cya 50 LENGTH = 105 COMBINED P-VALUE = 4.95e-01 E-VALUE = 8.9 DIAGRAM: 105 ******************************************************************************** CPU: Timothys-iMac.rd.unr.edu Time 0.007 secs. mast -oc results/mast5 -nostatus meme/meme.crp0.de.zoops.xml common/crp0.s