MEME

For further information on how to interpret these results or to get a copy of the MEME software please access http://meme.nbcr.net.

Discovered Motifs   |   Block diagrams of Motifs   |   Program information   |   Explanation

Discovered Motifs

Motif Overview

Motif 1
  • 1.3e+000
  • 25 sites
Motif 1 Logo Motif 1 Logo
Motif 2
  • 2.1e+001
  • 35 sites
Motif 2 Logo Motif 2 Logo
Motif 3
  • 1.5e+002
  • 7 sites
Motif 3 Logo Motif 3 Logo
Motif 4
  • 6.2e+002
  • 5 sites
Motif 4 Logo Motif 4 Logo
Motif 5
  • 1.3e+003
  • 5 sites
Motif 5 Logo Motif 5 Logo
Motif 6
  • 5.8e+003
  • 3 sites
Motif 6 Logo Motif 6 Logo
Motif 7
  • 2.6e+004
  • 5 sites
Motif 7 Logo Motif 7 Logo
Motif 8
  • 3.4e+004
  • 2 sites
Motif 8 Logo Motif 8 Logo
Motif 9
  • 2.4e+004
  • 2 sites
Motif 9 Logo Motif 9 Logo
Motif 10
  • 4.4e+004
  • 2 sites
Motif 10 Logo Motif 10 Logo

Further Analysis

Submit all motifs to  
      
      
      
 Mouse-over buttons for more information.

Motif 1

Next Top

Summary

Sequence Logo

E-value 1.3e+000
Width 8
Sites 25
show more
PNG LOGOS require CONVERT from ImageMagick; see MEME installation guide

Download LOGO
   Orientation:    SSC:    Format:    Width: cm    Height: cm   

Regular expression

[TA]G[AG][TG][AC]AGA

Further Analysis

Submit this motif to  
      
      
      
      
 Mouse-over buttons for more information.

Data Formats

View the motif in PSPM Format 
     PSSM Format 
     BLOCKS Format 
     FASTA Format 
     Raw Format 
     or Hide

Sites

Click on any row to highlight sequence in all motifs.

Name Start p-value Sites
chr7:126126668-126126818 84 2.70e-05 AAGGAAGCAT TGATAAGA AGTTCAGCAG
chr1:155039328-155039478 139 2.70e-05 GATCGAGCCC TGAGAAGA GTC
chr6:88190742-88190892 58 5.25e-05 TGGAAGGCAG AGATAAGA AACACCATTT
chr3:21996029-21996179 20 5.25e-05 ATGGTGGCCC AGATAAGA CTGTCACAGG
chr11:96941156-96941306 141 5.25e-05 TGTTTTTGGA AGATAAGA G
chr7:128672393-128672543 75 8.09e-05 AGGCGGGCGC TGAGCAGA CACCTCCTGG
chr7:103827921-103828071 71 8.09e-05 CTATCCTGTG TGAGCAGA TTGGCCCTTA
chr2:35336372-35336522 77 8.09e-05 GAAACAAGAA TGAGCAGA GGAGGCTGAA
chr16:17638345-17638495 95 8.09e-05 TTATCTCCTG TGAGCAGA AGGTACTATA
chr7:80629499-80629649 14 1.08e-04 TCCTCTCTGC AGATCAGA TGAAGCTCTG
chr6:38874495-38874645 37 1.35e-04 AGAGCCTGAA TGGTAAGA GAGTCCATGC
chr11:96918230-96918380 131 1.35e-04 GCTGCTGTAG TGGGAAGA CCAAGATTCT
chr8:122306903-122307053 4 2.46e-04 GCAG TGATAACA CAGTGATGGG
chr7:83695929-83696079 51 2.46e-04 AGATTAAGTC TGGGCAGA CGCCTAGGCT
chr7:100684791-100684941 87 2.46e-04 TTGGCCATGT TGATAACA AGATAACAAA
chr18:78123162-78123312 2 3.00e-04 GG GGATAAGA GTAAAGAGGA
chr11:78066028-78066178 129 3.00e-04 AAGGGGGTGG GGAGAAGA ACCTCCTAGC
chr7:103910176-103910326 140 3.27e-04 TTAAGCCTTG AGAGTAGA AC
chr2:27393862-27394012 82 3.27e-04 TGGGACTCCT AGAGTAGA TAAACAGGTG
chr7:83898433-83898583 32 4.37e-04 GTGTTCAGTG AGTGAAGA TAACTGTGCC
chr7:65300566-65300716 74 4.94e-04 TTCCTCAAAC TGTTCAGA AATATGCTTC
chr7:66079514-66079664 36 7.74e-04 CCCCGCCCTC TGGTCACA CCCCCCCTGT
chr9:96241534-96241684 89 8.32e-04 AACTGAGGGC TGTGTAGA AATAGCCCCA
chr8:122309313-122309463 111 9.69e-04 CGGCTCCCAC AGATAGGA ATTTCTGTGC
chr11:121433465-121433615 50 1.05e-03 AGCCCATGAC AGGTCACA AGGACCCTGG

Block Diagrams

The height of the motif "block" is proportional to -log(p-value), truncated at the height for a motif with a p-value of 1e-10.
Click on any row to highlight sequence in all motifs. Mouse over the center of the motif blocks to see more information.

Name Lowest p-value Motif Location
chr11:78066028-78066178 3.00e-04
chr11:96941156-96941306 5.25e-05
chr11:96918230-96918380 1.35e-04
chr11:121433465-121433615 1.05e-03
chr16:17638345-17638495 8.09e-05
chr18:78123162-78123312 3.00e-04
chr1:155039328-155039478 2.70e-05
chr2:27393862-27394012 3.27e-04
chr2:35336372-35336522 8.09e-05
chr3:21996029-21996179 5.25e-05
chr6:88190742-88190892 5.25e-05
chr6:38874495-38874645 1.35e-04
chr7:103827921-103828071 8.09e-05
chr7:128672393-128672543 8.09e-05
chr7:100684791-100684941 2.46e-04
chr7:66079514-66079664 7.74e-04
chr7:80629499-80629649 1.08e-04
chr7:83695929-83696079 2.46e-04
chr7:65300566-65300716 4.94e-04
chr7:83898433-83898583 4.37e-04
chr7:126126668-126126818 2.70e-05
chr7:103910176-103910326 3.27e-04
chr8:122306903-122307053 2.46e-04
chr8:122309313-122309463 9.69e-04
chr9:96241534-96241684 8.32e-04
 
0
20
40
60
80
100
120
140

Time 3.5 secs.

Motif 2

Previous Next Top

Summary

Sequence Logo

E-value 2.1e+001
Width 8
Sites 35
show more
PNG LOGOS require CONVERT from ImageMagick; see MEME installation guide

Download LOGO
   Orientation:    SSC:    Format:    Width: cm    Height: cm   

Regular expression

C[AT]G[GCT][CGT]C[TA]G

Further Analysis

Submit this motif to  
      
      
      
      
 Mouse-over buttons for more information.

Data Formats

View the motif in PSPM Format 
     PSSM Format 
     BLOCKS Format 
     FASTA Format 
     Raw Format 
     or Hide

Sites

Click on any row to highlight sequence in all motifs.

Name Start p-value Sites
chr7:81371603-81371753 83 1.52e-05 ATCTCCAAGA CAGGCCTG GGCACCAGGG
chr6:88190742-88190892 103 3.11e-05 AAACAATTCC CAGCCCTG TACAACCCCA
chr16:17638345-17638495 73 4.72e-05 GGTGACATGC CTGGCCTG GTGCTTATCT
chr8:122329088-122329238 122 6.18e-05 TGATGTCATC CAGGGCTG GGGGGAGGGA
chr7:103827921-103828071 40 7.86e-05 CTTATATGCT CTGCCCTG GCTCCTGCCC
chr7:81828551-81828701 4 9.30e-05 GAAG CAGGCCAG CCTGATACCT
chr9:96241534-96241684 51 1.55e-04 CATTCCTGGT CTGGGCTG CCACCTGTGA
chr9:110668725-110668875 41 2.01e-04 GCCTAAACCT CAGCTCTG TTCATCCTAG
chr7:100684791-100684941 36 2.01e-04 TTACTGCATC CAGCTCTG TGCATCTTTA
chr5:147442057-147442207 126 2.01e-04 TTGCCCAGGA CTGGCCAG TGAATGGCAA
chr2:27393862-27394012 115 2.01e-04 GGGTGACAAG CTGGCCAG ACAGTCCCCA
chr1:133825587-133825737 121 2.01e-04 GTCTCTTCAC CAGCTCTG TGTCTGCATT
chr2:35336372-35336522 136 2.50e-04 CTGCCAGGGT CTGTCCTG GTCTGC
chr7:83898433-83898583 15 2.95e-04 GCCGTATGGG CAGTGCTG TGTTCAGTGA
chr7:65300566-65300716 117 4.32e-04 ATGCTACTCA CTGTGCTG AGTGTTCAAT
chr7:126348298-126348448 42 4.63e-04 GGGCGGGCTG CAGCTCAG GGTTTATCTC
chr11:121433465-121433615 75 4.63e-04 TGGGGATGGC CAGCACTG ACAGGCTTTG
chr11:96918230-96918380 100 5.25e-04 TTAGTGGACC CTGGACTG AACTGCCTGG
chr11:96941156-96941306 25 5.25e-04 CCTTAGGAAC CTGTCCAG GAGGTATAAG
chr6:38874495-38874645 73 5.57e-04 AATTCATTTA GAGCCCTG GTACTAATAA
chr8:122309313-122309463 123 7.38e-04 ATAGGAATTT CTGTGCAG TGGGCAGCGA
chr7:103910176-103910326 39 7.38e-04 GCTGCTGGCA GAGGCCAG CTGAAGTGCC
chr7:90129365-90129515 61 8.13e-04 CGCTGGTTGT CAGCCTTG TAGGGTCAAG
chr1:155039328-155039478 97 8.13e-04 CAGACTATCA GAGTCCTG CTGCAAAGAG
chr7:80629499-80629649 128 8.74e-04 ATCTGTCTCC CTGGCTTG TCCCCAGACC
chr18:78123162-78123312 26 1.14e-03 AGGACGAAGG CAGCCCTC AGCAAGGACT
chr11:78066028-78066178 5 1.14e-03 GTTAA GAGGGCAG GAATCCGTGC
chr7:126126668-126126818 51 1.25e-03 GCTACAGGCA CAGGTTTG CCTTGCTTTG
chr7:128672393-128672543 89 1.25e-03 CAGACACCTC CTGGCCTC CAGCAGGAGC
chr7:126396946-126397096 6 1.67e-03 TCGATT CTGTACAG TTCATCCATT
chr8:122306903-122307053 93 1.81e-03 TTGGTGGCTG GAGCTCAG ATGCCAGCCA
chr3:21996029-21996179 54 2.23e-03 GACCCATGCC CATGGCTG CCTAAGAAAA
chr7:66079514-66079664 102 2.39e-03 TCAGTACCGC CACGGCAG TGAGCGCCAC
chr6:38850125-38850275 120 2.72e-03 AAATAGAACT CTCCTCTG TGAGTGTTTC
chr7:83695929-83696079 62 2.90e-03 GGGCAGACGC CTAGGCTG TCATTTTTCT

Block Diagrams

The height of the motif "block" is proportional to -log(p-value), truncated at the height for a motif with a p-value of 1e-10.
Click on any row to highlight sequence in all motifs. Mouse over the center of the motif blocks to see more information.

Name Lowest p-value Motif Location
chr11:78066028-78066178 1.14e-03
chr11:96941156-96941306 5.25e-04
chr11:96918230-96918380 5.25e-04
chr11:121433465-121433615 4.63e-04
chr16:17638345-17638495 4.72e-05
chr18:78123162-78123312 1.14e-03
chr1:133825587-133825737 2.01e-04
chr1:155039328-155039478 8.13e-04
chr2:27393862-27394012 2.01e-04
chr2:35336372-35336522 2.50e-04
chr3:21996029-21996179 2.23e-03
chr5:147442057-147442207 2.01e-04
chr6:88190742-88190892 3.11e-05
chr6:38874495-38874645 5.57e-04
chr6:38850125-38850275 2.72e-03
chr7:103827921-103828071 7.86e-05
chr7:128672393-128672543 1.25e-03
chr7:81828551-81828701 9.30e-05
chr7:100684791-100684941 2.01e-04
chr7:66079514-66079664 2.39e-03
chr7:80629499-80629649 8.74e-04
chr7:126396946-126397096 1.67e-03
chr7:126348298-126348448 4.63e-04
chr7:83695929-83696079 2.90e-03
chr7:65300566-65300716 4.32e-04
chr7:83898433-83898583 2.95e-04
chr7:126126668-126126818 1.25e-03
chr7:81371603-81371753 1.52e-05
chr7:103910176-103910326 7.38e-04
chr7:90129365-90129515 8.13e-04
chr8:122306903-122307053 1.81e-03
chr8:122329088-122329238 6.18e-05
chr8:122309313-122309463 7.38e-04
chr9:110668725-110668875 2.01e-04
chr9:96241534-96241684 1.55e-04
 
0
20
40
60
80
100
120
140

Time 6.6 secs.

Motif 3

Previous Next Top

Summary

Sequence Logo

E-value 1.5e+002
Width 14
Sites 7
show more
PNG LOGOS require CONVERT from ImageMagick; see MEME installation guide

Download LOGO
   Orientation:    SSC:    Format:    Width: cm    Height: cm   

Regular expression

C[AC]GG[GA]GCC[TA][GA]GC[AT]G

Further Analysis

Submit this motif to  
      
      
      
      
 Mouse-over buttons for more information.

Data Formats

View the motif in PSPM Format 
     PSSM Format 
     BLOCKS Format 
     FASTA Format 
     Raw Format 
     or Hide

Sites

Click on any row to highlight sequence in all motifs.

Name Start p-value Sites
chr7:128672393-128672543 100 2.05e-08 TGGCCTCCAG CAGGAGCCTGGCAG TGTTCATTTA
chr1:133825587-133825737 97 2.05e-08 ATGCAAGGAA CAGGGGCCTGGCTG GTCTCTTCAC
chr8:122309313-122309463 79 3.06e-08 TTTGCATCCT CCGGGGCCAGGCAG TGCACTATCG
chr6:88190742-88190892 136 6.51e-07 GGGCAGCCTC CGGGAGCCGGGCAG
chr7:81371603-81371753 96 2.71e-06 GCCTGGGCAC CAGGGGCTTAGATG GATCATATCT
chr7:81828551-81828701 40 2.85e-06 TATTATCTTC CAGAGTCCTGACAG CAAACCGTGG
chr9:96241534-96241684 114 3.45e-06 CCACCCCTCG CCTGGGCAAAGCAG GATAGCTGGC

Block Diagrams

The height of the motif "block" is proportional to -log(p-value), truncated at the height for a motif with a p-value of 1e-10.
Click on any row to highlight sequence in all motifs. Mouse over the center of the motif blocks to see more information.

Name Lowest p-value Motif Location
chr1:133825587-133825737 2.05e-08
chr6:88190742-88190892 6.51e-07
chr7:128672393-128672543 2.05e-08
chr7:81828551-81828701 2.85e-06
chr7:81371603-81371753 2.71e-06
chr8:122309313-122309463 3.06e-08
chr9:96241534-96241684 3.45e-06
 
0
20
40
60
80
100
120
140

Time 9.4 secs.

Motif 4

Previous Next Top

Summary

Sequence Logo

E-value 6.2e+002
Width 14
Sites 5
show more
PNG LOGOS require CONVERT from ImageMagick; see MEME installation guide

Download LOGO
   Orientation:    SSC:    Format:    Width: cm    Height: cm   

Regular expression

[GA][AG][AG][GAT]C[CT][AG][CA]AG[AG][AG][GA]A

Further Analysis

Submit this motif to  
      
      
      
      
 Mouse-over buttons for more information.

Data Formats

View the motif in PSPM Format 
     PSSM Format 
     BLOCKS Format 
     FASTA Format 
     Raw Format 
     or Hide

Sites

Click on any row to highlight sequence in all motifs.

Name Start p-value Sites
chr7:126396946-126397096 135 3.90e-08 CTCATTCTCG GAAGCCACAGAAAA A
chr2:35336372-35336522 92 2.31e-07 AGAGGAGGCT GAAGCTGCAGAAGA GGCGCCTCTA
chr1:155039328-155039478 4 2.31e-07 AGTA GGAACCAAAGAAGA CAACAAGTAC
chr7:80629499-80629649 31 4.39e-07 ATGAAGCTCT GAGGCCACAGGGGA ACCACAGGGA
chr8:122329088-122329238 86 4.80e-07 GAGCAGGCTC AGATCCACAGGAGA ATTTAAAGTG

Block Diagrams

The height of the motif "block" is proportional to -log(p-value), truncated at the height for a motif with a p-value of 1e-10.
Click on any row to highlight sequence in all motifs. Mouse over the center of the motif blocks to see more information.

Name Lowest p-value Motif Location
chr1:155039328-155039478 2.31e-07
chr2:35336372-35336522 2.31e-07
chr7:80629499-80629649 4.39e-07
chr7:126396946-126397096 3.90e-08
chr8:122329088-122329238 4.80e-07
 
0
20
40
60
80
100
120
140

Time 12.1 secs.

Motif 5

Previous Next Top

Summary

Sequence Logo

E-value 1.3e+003
Width 21
Sites 5
show more
PNG LOGOS require CONVERT from ImageMagick; see MEME installation guide

Download LOGO
   Orientation:    SSC:    Format:    Width: cm    Height: cm   

Regular expression

[AC][AC][GA]G[GAT][CAG][TC][CAG][ACT][AGT][TAG][GC]GCA[CA][AT]C[AT][GAC]C

Further Analysis

Submit this motif to  
      
      
      
      
 Mouse-over buttons for more information.

Data Formats

View the motif in PSPM Format 
     PSSM Format 
     BLOCKS Format 
     FASTA Format 
     Raw Format 
     or Hide

Sites

Click on any row to highlight sequence in all motifs.

Name Start p-value Sites
chr7:103910176-103910326 83 1.14e-11 GGATAAAGTT AAGGGCTCAATCGCAAACAGC CCGTTGCTTT
chr11:96941156-96941306 93 1.35e-09 TACCCCCCTT AAGGGATGTATGGCACACTGC CCTAACCACC
chr18:78123162-78123312 37 2.22e-09 AGCCCTCAGC AAGGACTCATTGGCAATCAAC AGAAATGAGG
chr7:126126668-126126818 19 6.23e-09 GTTGACCTGC CAGGGGCAAGAGGCACACAGC AGCTACAGGC
chr2:27393862-27394012 123 2.20e-08 AGCTGGCCAG ACAGTCCCCAGGGCACACACC AAGGCC

Block Diagrams

The height of the motif "block" is proportional to -log(p-value), truncated at the height for a motif with a p-value of 1e-10.
Click on any row to highlight sequence in all motifs. Mouse over the center of the motif blocks to see more information.

Name Lowest p-value Motif Location
chr11:96941156-96941306 1.35e-09
chr18:78123162-78123312 2.22e-09
chr2:27393862-27394012 2.20e-08
chr7:126126668-126126818 6.23e-09
chr7:103910176-103910326 1.14e-11
 
0
20
40
60
80
100
120
140

Time 14.8 secs.

Motif 6

Previous Next Top

Summary

Sequence Logo

E-value 5.8e+003
Width 15
Sites 3
show more
PNG LOGOS require CONVERT from ImageMagick; see MEME installation guide

Download LOGO
   Orientation:    SSC:    Format:    Width: cm    Height: cm   

Regular expression

G[AC][AC]A[AG]G[AG][AG]A[ACT]AAG[GA]A

Further Analysis

Submit this motif to  
      
      
      
      
 Mouse-over buttons for more information.

Data Formats

View the motif in PSPM Format 
     PSSM Format 
     BLOCKS Format 
     FASTA Format 
     Raw Format 
     or Hide

Sites

Click on any row to highlight sequence in all motifs.

Name Start p-value Sites
chr2:35336372-35336522 62 7.11e-09 CGCTGGGGCA GAAAAGAAACAAGAA TGAGCAGAGG
chr1:155039328-155039478 107 4.43e-08 GAGTCCTGCT GCAAAGAGATAAGGA CCATTCTGAT
chr7:80629499-80629649 102 7.14e-08 ACTCTCCTCA GACAGGGAAAAAGGA TATCTGTCTC

Block Diagrams

The height of the motif "block" is proportional to -log(p-value), truncated at the height for a motif with a p-value of 1e-10.
Click on any row to highlight sequence in all motifs. Mouse over the center of the motif blocks to see more information.

Name Lowest p-value Motif Location
chr1:155039328-155039478 4.43e-08
chr2:35336372-35336522 7.11e-09
chr7:80629499-80629649 7.14e-08
 
0
20
40
60
80
100
120
140

Time 17.4 secs.

Motif 7

Previous Next Top

Summary

Sequence Logo

E-value 2.6e+004
Width 25
Sites 5
show more
PNG LOGOS require CONVERT from ImageMagick; see MEME installation guide

Download LOGO
   Orientation:    SSC:    Format:    Width: cm    Height: cm   

Regular expression

GCA[GC][TA][AT]G[AGC][ACG][CGA][AC][TC][AG]T[GC][TC][TCG][AC][AC][CG][ACT][TA][GCT][TA][GA]

Further Analysis

Submit this motif to  
      
      
      
      
 Mouse-over buttons for more information.

Data Formats

View the motif in PSPM Format 
     PSSM Format 
     BLOCKS Format 
     FASTA Format 
     Raw Format 
     or Hide

Sites

Click on any row to highlight sequence in all motifs.

Name Start p-value Sites
chr7:126126668-126126818 98 6.32e-12 AAGAAGTTCA GCAGTAGCAGATATGCTAACAAGTG TGTCTAATGT
chr16:17638345-17638495 5 2.37e-11 GGCAG GCACAAGGCCACATGTTCCCATGTG TGAGCTGGTG
chr7:83695929-83696079 88 3.24e-10 CTATCGAGCA GCAGATGGCGCTGTGTTAACCTGAG CAAGATTACC
chr7:126348298-126348448 82 4.77e-10 TTCCTTCCTT GCAGTAGAAAATGTGCCCACATTTA AACCCTTGGT
chr8:122306903-122307053 33 3.02e-09 GCGATAACGG GCACTAGAGCATATCTGACGTTCAG GCGGGTCCAA

Block Diagrams

The height of the motif "block" is proportional to -log(p-value), truncated at the height for a motif with a p-value of 1e-10.
Click on any row to highlight sequence in all motifs. Mouse over the center of the motif blocks to see more information.

Name Lowest p-value Motif Location
chr16:17638345-17638495 2.37e-11
chr7:126348298-126348448 4.77e-10
chr7:83695929-83696079 3.24e-10
chr7:126126668-126126818 6.32e-12
chr8:122306903-122307053 3.02e-09
 
0
20
40
60
80
100
120
140

Time 20 secs.

Motif 8

Previous Next Top

Summary

Sequence Logo

E-value 3.4e+004
Width 8
Sites 2
show more
PNG LOGOS require CONVERT from ImageMagick; see MEME installation guide

Download LOGO
   Orientation:    SSC:    Format:    Width: cm    Height: cm   

Regular expression

CAAAAATA

Further Analysis

Submit this motif to  
      
      
      
      
 Mouse-over buttons for more information.

Data Formats

View the motif in PSPM Format 
     PSSM Format 
     BLOCKS Format 
     FASTA Format 
     Raw Format 
     or Hide

Sites

Click on any row to highlight sequence in all motifs.

Name Start p-value Sites
chr8:122306903-122307053 125 1.35e-05 GATTTATAGC CAAAAATA ATAGGACTTT
chr6:38850125-38850275 107 1.35e-05 ATCCTATTTA CAAAAATA GAACTCTCCT

Block Diagrams

The height of the motif "block" is proportional to -log(p-value), truncated at the height for a motif with a p-value of 1e-10.
Click on any row to highlight sequence in all motifs. Mouse over the center of the motif blocks to see more information.

Name Lowest p-value Motif Location
chr6:38850125-38850275 1.35e-05
chr8:122306903-122307053 1.35e-05
 
0
20
40
60
80
100
120
140

Time 22.5 secs.

Motif 9

Previous Next Top

Summary

Sequence Logo

E-value 2.4e+004
Width 9
Sites 2
show more
PNG LOGOS require CONVERT from ImageMagick; see MEME installation guide

Download LOGO
   Orientation:    SSC:    Format:    Width: cm    Height: cm   

Regular expression

GCAAGAAGG

Further Analysis

Submit this motif to  
      
      
      
      
 Mouse-over buttons for more information.

Data Formats

View the motif in PSPM Format 
     PSSM Format 
     BLOCKS Format 
     FASTA Format 
     Raw Format 
     or Hide

Sites

Click on any row to highlight sequence in all motifs.

Name Start p-value Sites
chr7:126348298-126348448 15 3.20e-06 CAGGTTCCTT GCAAGAAGG CAGACGTCGG
chr11:78066028-78066178 114 3.20e-06 AGCTGTCTTA GCAAGAAGG GGGTGGGGAG

Block Diagrams

The height of the motif "block" is proportional to -log(p-value), truncated at the height for a motif with a p-value of 1e-10.
Click on any row to highlight sequence in all motifs. Mouse over the center of the motif blocks to see more information.

Name Lowest p-value Motif Location
chr11:78066028-78066178 3.20e-06
chr7:126348298-126348448 3.20e-06
 
0
20
40
60
80
100
120
140

Time 25 secs.

Motif 10

Previous Top

Summary

Sequence Logo

E-value 4.4e+004
Width 15
Sites 2
show more
PNG LOGOS require CONVERT from ImageMagick; see MEME installation guide

Download LOGO
   Orientation:    SSC:    Format:    Width: cm    Height: cm   

Regular expression

AAACC[GT]TGG[AG]GACCC

Further Analysis

Submit this motif to  
      
      
      
      
 Mouse-over buttons for more information.

Data Formats

View the motif in PSPM Format 
     PSSM Format 
     BLOCKS Format 
     FASTA Format 
     Raw Format 
     or Hide

Sites

Click on any row to highlight sequence in all motifs.

Name Start p-value Sites
chr7:81828551-81828701 55 1.70e-09 TCCTGACAGC AAACCGTGGAGACCC TGACAACCCC
chr7:81371603-81371753 131 3.48e-09 CATAAGGTTG AAACCTTGGGGACCC TTGT

Block Diagrams

The height of the motif "block" is proportional to -log(p-value), truncated at the height for a motif with a p-value of 1e-10.
Click on any row to highlight sequence in all motifs. Mouse over the center of the motif blocks to see more information.

Name Lowest p-value Motif Location
chr7:81828551-81828701 1.70e-09
chr7:81371603-81371753 3.48e-09
 
0
20
40
60
80
100
120
140

Time 27.5 secs.

All Motifs

Top

Combined Block Diagrams

Non-overlapping sites with a p-value better than 0.0001.
The height of the motif "block" is proportional to -log(p-value), truncated at the height for a motif with a p-value of 1e-10.
Click on any row to highlight sequence in all motifs. The motif blocks have tool tips with more information.

Motif 1
Motif 2
Motif 3
Motif 4
Motif 5
Motif 6
Motif 7
Motif 8
Motif 9
Motif 10
Name Combined p-value Motif Location
chr11:78066028-78066178 1.74e-02
chr11:96941156-96941306 8.02e-05
chr11:121433465-121433615 8.05e-03
chr16:17638345-17638495 1.88e-06
chr18:78123162-78123312 1.78e-07
chr1:133825587-133825737 2.75e-04
chr1:155039328-155039478 7.42e-08
chr2:27393862-27394012 1.34e-04
chr2:35336372-35336522 1.73e-09
chr3:21996029-21996179 3.03e-03
chr6:88190742-88190892 2.42e-05
chr6:38850125-38850275 4.13e-01
chr7:103827921-103828071 5.63e-02
chr7:128672393-128672543 1.31e-04
chr7:81828551-81828701 2.15e-07
chr7:80629499-80629649 1.10e-07
chr7:126396946-126397096 1.57e-02
chr7:126348298-126348448 1.28e-06
chr7:83695929-83696079 4.70e-06
chr7:126126668-126126818 2.25e-12
chr7:81371603-81371753 1.49e-06
chr7:103910176-103910326 1.51e-06
chr8:122306903-122307053 1.91e-06
chr8:122329088-122329238 9.05e-03
chr8:122309313-122309463 4.58e-03
chr9:96241534-96241684 1.12e-03
 
0
20
40
60
80
100
120
140
Motif 1
Motif 2
Motif 3
Motif 4
Motif 5
Motif 6
Motif 7
Motif 8
Motif 9
Motif 10
Top
MEME version
4.6.1 (Release date: Mon Mar 21 15:08:38 EST 2011)
Reference
Timothy L. Bailey and Charles Elkan, "Fitting a mixture model by expectation maximization to discover motifs in biopolymers", Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp. 28-36, AAAI Press, Menlo Park, California, 1994.
show training set...
Command line summary

Letter frequencies in dataset
A: 0.243   C: 0.255   G: 0.245   T: 0.257

Background letter frequencies (from dataset with add-one prior applied):
A: 0.243   C: 0.255   G: 0.245   T: 0.257

Stopping Reason
Stopped because nmotifs = 10 reached. Program ran on pongo.
show model parameters...

Explanation of MEME Results

Top

The MEME results consist of

  • The overview of all discovered motifs.
  • Information on each of the motifs MEME discovered, including:
    1. A summary table showing the width, number of contributing sites, log likelihood ratio, statistical significance, information content and relative entropy of the motif.
    2. A sequence LOGO.
    3. Downloadable LOGO files suitable for publication.
    4. A regular expression describing the motif.
    5. Some further analysis that can be performed on the motif.
    6. A list of data formats describing the motif.
    7. The contributing sites of the motif sorted by p-value and aligned with each other.
    8. The block diagrams of the contributing sites of the motif within each sequence in the training set.
  • A combined block diagram showing an optimized (non-overlapping) tiling of all of the motifs onto each of the sequences in the training set.
  • The version of MEME and the date it was released.
  • The reference to cite if you use MEME in your research.
  • A description of the sequences you submitted (the "training set") showing the name, "weight" and length of each sequence.
  • The command line summary detailing the parameters with which you ran MEME.
  • The reason why MEME stopped and the name of the CPU on which it ran.
  • This explanation of how to interpret MEME results.

Motifs

For each motif that it discovers in the training set, MEME prints the following information:

Summary Table

This summary table gives the main attributes of the motif.

E-value
The statistical significance of the motif. MEME usually finds the most statistically significant (low E-value) motifs first. The E-value of a motif is based on its log likelihood ratio, width, sites, the background letter frequencies (given in the command line summary), and the size of the training set. The E-value is an estimate of the expected number of motifs with the given log likelihood ratio (or higher), and with the same width and site count, that one would find in a similarly sized set of random sequences. (In random sequences each position is independent with letters chosen according to the background letter frequencies.)
Width
The width of the motif. Each motif describes a pattern of a fixed with as no gaps are allowed in MEME motifs.
Sites
The number of sites contributing to the construction of the motif.
Log Likelihood Ratio
The log likelihood ratio of the motif.The log likelihood ratio is the logarithm of the ratio of the probability of the occurrences of the motif given the motif model (likelihood given the motif) versus their probability given the background model (likelihood given the null model). (Normally the background model is a 0-order Markov model using the background letter frequencies, but higher order Markov models may be specified via the -bfile option to MEME.)
Information Content
The information content of the motif in bits. It is equal to the sum of the uncorrected information content, R(), in the columns of the LOGO. This is equal relative entropy of the motif relative to a uniform background frequency model.
Relative Entropy
The relative entropy of the motif, computed in bits and relative to the background letter frequencies given in the command line summary. It is equal to the log-likelihood ratio (llr) divided by the number of contributing sites of the motif times 1/ln(2),

re = llr / (sites * ln(2)).
Sequence LOGO

MEME motifs are represented by position-specific probability matrices that specify the probability of each possible letter appearing at each possible position in an occurrence of the motif. These are displayed as "sequence LOGOS", containing stacks of letters at each position in the motif. The total height of the stack is the "information content" of that position in the motif in bits. The height of the individual letters in a stack is the probability of the letter at that position multiplied by the total information content of the stack.

Note: The MEME LOGO differs from those produced by the Weblogo program because a small-sample correction is NOT applied. However, MEME LOGOs in PNG and encapsulated postscript (EPS) formats with small-sample correction (SSC) are available by clicking on the download button with "SSC" set to "on" under Download LOGO. The MEME LOGOs without small sample correction are similarly available. Error bars are included in the LOGOs with small-sample correction.

Modern web browsers supporting the canvas element and it's text manipulation functions as described in the html 5 standard, can render the sequence LOGOs without needing the images. The browsers which work with this feature are:

  • Firefox 3.5 and above
  • Safari 4 and above
  • Google Chrome 4 and above

Unfortunately Internet Explorer 8 does not support any html 5 features.

The information content of each motif position is computed as described in the paper by Schneider and Stephens, "Sequence Logos: A New Way to Display Consensus Sequences" but the small-sample correction, e(n), is set to zero for the LOGO displayed in the MEME output. The corrected information content of position i is given by

            R(i) for amino acids   = log2(20) - (H(i) + e(n))   (1a) 
            R(i) for nucleic acids =    2    - (H(i) + e(n))    (1b)
          

where H(i) is the entropy of position i,

            H(l) = - (Sum f(a,i) * log2[ f(a,i) ]).             (2)
          

Here, f(a,i) is the frequency of base or amino acid a at position i, and e(n) is the small-sample correction for an alignment of n letters. The height of letter a in column i is given by

            height = f(a,i) * R(i)                              (3)
          

The approximation for the small-sample correction, e(n), is given by:

            e(n) = (s-1) / (2 * ln(2) * n),                     (4)
          

where s is 4 for nucleotides, 20 for amino acids, and n is the number of sequences in the alignment.

The letters in the logos are colored as follows.
For DNA sequences, the letter categories contain one letter each.

NUCLEIC ACIDS COLOR
A RED
C BLUE
G ORANGE
T GREEN

For proteins, the categories are based on the biochemical properties of the various amino acids.

AMINO ACIDS COLOR PROPERTIES
A, C, F, I, L, V, W and M BLUE Most hydrophobic[Kyte and Doolittle, 1982]
NQST GREEN Polar, non-charged, non-aliphatic residues
DE MAGENTA Acidic
KR RED Positively charged
H PINK  
G ORANGE  
P YELLOW  
Y TURQUOISE  

J. Kyte and R. Doolittle, 1982. "A Simple Method for Displaying the Hydropathic Character of a Protein", J. Mol Biol. 157, 105-132.

Note: the "text" output format of MEME preserves the historical MEME format where LOGOS are replaced by a simplified probability matrix, a relative entropy plot, and a multi-level consensus sequence.

Download LOGO

Logos can be generated on the fly by the meme webservice and you may specify a number of options to customize them to your needs. The options are:

Orientation
Only valid for nucleotide motifs. Generate the standard view or the reverse complemented view of the motif.
SSC
Use small sample correction and show errorbars on the image. Small sample correction is used by the Weblogo program.
Format
The format of the generated image. If the image is to be used on the web then png is recommend. If the image is to be published then eps is recommended.
Width
The width of the generated image in centimetres.
Height
The height of the generated image in centimetres.

Regular Expression

This is a regular expression (RE) describing the motif. In each column, all letters with observed frequencies greater than 0.2 are shown; less-frequent letters are not included in the RE. MEME regular expressions are interpreted as follows: single letters match that letter; groups of letters in square brackets match any of the letters in the group. Regular expressions can be used for searching for the motif in sequences (using, for example, PatMatch) but the search accuracy will usually be better with the PSSM (using, for example MAST.)

Further Analysis

Either as a group or individually the motifs have a number of options for further analysis.

MAST
Finds the best matching positions for a set of motifs in each sequence provided to it, ranked by the combined score of each sequence. For more information about MAST please read the introduction.
FIMO
Finds all matches for a motif. For more information about FIMO please read the introduction.
TOMTOM
Compares a single motif to a database of motifs. For more information about TOMTOM please read the introduction.
GOMO
Identifies possible roles of DNA binding motifs. For more information about GOMO please read the introduction.
BLOCKS
Submit to Blocks Multiple Alignment Processor where you can do several things like create phylogeny trees and search the blocks against a database of other blocks (protein only). For more information about BLOCKS Multiple Alignment Processor please visit the website.
Data Formats

The extracted data is avaliable in the following formats.

PSPM Format
The motif itself is a position-specific probability matrix giving, for each position in the pattern, the observed frequency ("probability") of each possible letter. The probability matrix is printed "sideways"--columns correspond to the letters in the alphabet (in the same order as shown in the simplified motif) and rows corresponding to the positions of the motif, position one first. The motif is preceded by a line starting with "letter-probability matrix:" and containing the length of the alphabet, width of the motif, number of occurrences of the motif, and the E-value of the motif.
Note: Earlier versions of MEME gave the posterior probabilities--the probability after applying a prior on letter frequencies--rather than the observed frequencies. These versions of MEME also gave the number of possible positions for the motif rather than the actual number of occurrences. The output from these earlier versions of MEME can be distinguished by "n=" rather than "nsites=" in the line preceding the matrix.
PSSM Format
The position-specific scoring matrix corresponding to the motif is printed for use by database search programs such as MAST. This matrix is a log-odds matrix calculated by taking 100 times the log (base 2) of the ratio p/f at each position in the motif where p is the probability of a particular letter at that position in the motif, and f is the background frequency of the letter (given in the command line summary section.) This is the same matrix that is used above in computing the p-values of the occurrences of the motif in the Sites and Block Diagrams sections. The scoring matrix is printed "sideways"--columns correspond to the letters in the alphabet (in the same order as shown in the simplified motif) and rows corresponding to the positions of the motif, position one first. The scoring matrix is preceded by a line starting with "log-odds matrix:" and containing the length of the alphabet, width of the motif, number of characters in the training set, the scoring threshold (obsolete) and the motif E-value.
Note: The probability p used to compute the PSSM is not exactly the same as the corresponding value in the Position Specific Probability Matrix (PSPM). The values of p used to compute the PSSM take into account the motif prior, whereas the values in the PSPM are just the observed frequencies of letters in the motif sites.
BLOCKS Format
For use with BLOCKS tools.
FASTA Format
The FASTA format as described here.
Raw Format
Just the sites of the sequences that contributed to the motif. One site per line.
Sites

MEME displays the occurrences (sites) of the motif in the training set. The sites are shown aligned with each other, and the ten sequence positions preceding and following each site are also shown. Each site is identified by the name of the sequence where it occurs, the strand (if both strands of DNA sequences are being used), and the position in the sequence where the site begins. When the DNA strand is specified, '+' means the sequence in the training set, and '-' means the reverse complement of the training set sequence. (For '-' strands, the 'start' position is actually the position on the positive strand where the site ends.) The sites are listed in order of increasing statistical significance (p-value). The p-value of a site is computed from the the match score of the site with the position specific scoring matrix for the motif. The p-value gives the probability of a random string (generated from the background letter frequencies) having the same match score or higher. (This is referred to as the position p-value by the MAST algorithm.)

Block Diagrams

The occurrences of the motif in the training set sequences are shown as coloured blocks on a line. One diagram is printed for each sequence showing all the sites contributating to that motif in that sequence. The sequences are listed in the same order as in the input to make it easier to compare multiple block diagrams. Additionally the best p-value for the sequence/motif combination is listed though this may not be in ascending order as with the sites. The p-value of an occurrence is the probability of a single random subsequence the length of the motif, generated according to the 0-order background model, having a score at least as high as the score of the occurrence. When the DNA strand is specified '+', it means the motif appears from left to right on the sequence, and '-' means the motif appears from right to left on the complementary strand. A sequence position scale is shown at the end of each table of block diagrams.

Combined Block Diagrams

The motif occurrences shown in the motif summary may not be exactly the same as those reported in each motif section because only motifs with a position p-value of 0.0001 that don't overlap other, more significant motif occurrences are shown.

See the documentation for MAST output for the definition of position and combined p-values.