ENST00000461467.1 novel transcript ENST00000335577.4 putative novel transcript ENST00000448605.1 putative novel transcript ENST00000414688.1 putative novel transcript ENST00000447954.1 putative novel transcript ENST00000420190.1 alternative 5' UTR ENST00000437963.1 alternative 5' UTR ENST00000483767.1 novel transcript ENST00000327044.6 DKFZP564C186 ENST00000477976.1 novel transcript ENST00000496938.1 putative novel transcript ENST00000487214.1 novel transcript ENST00000469563.1 novel transcript ENST00000473277.1 novel transcript ENST00000463212.1 novel transcript ENST00000466300.1 novel transcript ENST00000481067.1 putative novel transcript ENST00000379410.3 DKFZP434H2010 ENST00000480267.1 novel transcript ENST00000491024.1 novel transcript ENST00000433695.1 putative novel transcript ENST00000451054.1 putative novel transcript ENST00000421241.2 FLJ20584 ENST00000487177.1 novel transcript ENST00000477196.1 novel transcript ENST00000467751.1 novel transcript ENST00000379319.1 alternative 5' UTR ENST00000482816.1 novel transcript ENST00000462097.1 novel transcript ENST00000475119.1 novel transcript ENST00000379288.3 FLJ36119 ENST00000460998.1 novel transcript ENST00000486379.1 novel transcript ENST00000494748.1 novel transcript ENST00000478938.1 novel transcript ENST00000403997.2 novel protein ENST00000459994.1 novel transcript ENST00000462849.1 novel transcript ENST00000478606.1 novel transcript ENST00000468365.1 novel transcript ENST00000486627.1 putative novel transcript ENST00000360466.2 alternative 5' UTR ENST00000435198.1 alternative 5' UTR ENST00000422076.1 alternative 5' UTR ENST00000502382.1 alternative 5' UTR ENST00000488418.1 alternative 5' UTR ENST00000453732.1 putative novel transcript ENST00000379116.5 NP_001123885.2 ENST00000379031.5 FLJ90811 ENST00000470520.1 novel transcript ENST00000463758.1 putative novel transcript ENST00000467712.1 novel transcript ENST00000493657.1 novel transcript ENST00000470030.2 novel transcript ENST00000470030.2 not organism-supported ENST00000435064.1 FLJ20542 ENST00000462432.1 novel transcript ENST00000421495.2 novel transcript ENST00000493534.2 novel transcript ENST00000490853.1 novel transcript ENST00000531019.1 alternative 3' UTR ENST00000464957.1 novel transcript ENST00000343938.4 MGC10334 ENST00000488011.1 novel transcript ENST00000474033.1 novel transcript ENST00000309212.6 MGC3047 ENST00000476718.1 novel transcript ENST00000464351.1 putative novel transcript ENST00000460473.1 putative novel transcript ENST00000338370.3 Variant 2; alternatively spliced in 5' UTR ENST00000321751.5 Variant 6; alternatively spliced in 5' UTR ENST00000378853.3 Variant 3; alternatively spliced in 5' UTR ENST00000418833.1 putative novel transcript ENST00000442470.1 putative novel transcript ENST00000436362.1 putative novel transcript ENST00000495558.1 putative novel transcript ENST00000338660.5 novel transcript ENST00000476993.1 FLJ22215 ENST00000471398.1 putative novel transcript ENST00000378785.2 LOC348498 ENST00000475091.2 novel transcript ENST00000484537.2 novel transcript ENST00000308647.7 LOC219293 ENST00000485748.1 novel transcript ENST00000474481.1 novel transcript ENST00000378756.3 FLJ10709 ENST00000291386.3 FLJ13048 ENST00000510793.1 alternative 5' UTR ENST00000503789.1 alternative 5' UTR ENST00000435358.1 retained intron causes frame-shifting creating a protein which significantly differs from the main variant ENST00000513088.1 In the current genomic assembly this gene is lacking exons 4-5, this may represent an artifactual deleated clone of bonafide polymorphism in the population ENST00000513088.1 Due to lacking two coding exons this gene has been annotated as a pseudogene ENST00000467737.1 isoform 7 ENST00000404249.3 isoform 1 ENST00000357760.2 isoform 3 ENST00000358779.5 isoform 4 ENST00000479362.1 alternative 5' UTR ENST00000341426.5 alternatively spliced 5' UTR compared to variant 2 ENST00000341426.5 alternative 5' UTR ENST00000498806.1 novel transcript ENST00000497747.1 novel transcript ENST00000497615.1 novel transcript ENST00000480542.1 novel transcript ENST00000461893.1 novel transcript ENST00000471354.1 novel transcript ENST00000472614.1 novel transcript ENST00000378604.3 LOC163688 ENST00000482402.1 novel transcript ENST00000462293.1 novel transcript ENST00000310991.3 LOC339456 ENST00000470931.1 novel transcript ENST00000464311.1 LOC348524 ENST00000450874.3 LOC339459 ENST00000495347.1 alternative 5' UTR ENST00000470596.1 alternative 5' UTR ENST00000496325.1 alternative 5' UTR ENST00000481140.1 alternative 5' UTR ENST00000482686.1 alternative 5' UTR ENST00000470986.1 alternative 5' UTR ENST00000470511.1 alternative 5' UTR ENST00000471018.2 alternative 5' UTR ENST00000466352.1 alternative 5' UTR ENST00000333854.2 FLJ10346 ENST00000469733.1 FLJ46112 ENST00000414253.1 FLJ31031 ENST00000487186.1 FLJ44922 ENST00000478223.2 novel transcript ENST00000378531.3 FLJ13941 ENST00000469374.1 novel transcript ENST00000475812.1 novel transcript ENST00000494279.1 novel transcript ENST00000493207.1 novel transcript ENST00000420406.1 novel transcript (KIAA0450) ENST00000378483.1 FLJ00417 ENST00000343889.3 FLJ00414, FLJ00222 ENST00000473964.1 KIAA0450 ENST00000449660.1 FLJ11705 ENST00000416860.2 FLJ46690 ENST00000426449.1 alternative 5' UTR ENST00000434817.1 alternative 5' UTR ENST00000435221.2 alternative 5' UTR ENST00000451778.1 alternative 5' UTR ENST00000493183.1 novel transcript ENST00000474659.1 novel transcript ENST00000378424.4 FLJ32465 ENST00000486099.1 novel transcript ENST00000464043.1 novel transcript ENST00000465233.1 novel transcript ENST00000498083.1 novel transcript ENST00000481683.1 novel transcript ENST00000484099.1 novel transcript (FLJ37582) ENST00000477045.1 novel transcript ENST00000476686.1 novel transcript (DKFZp547M123) ENST00000378344.2 FLJ39108, FLJ21756 and FLJ21811 ENST00000270708.7 FLJ20430 ENST00000471223.1 DKFZp686F1866 ENST00000378295.4 alpha ENST00000354437.4 beta ENST00000294600.2 FLJ32825 ENST00000462521.1 novel transcript ENST00000378251.1 KIAA1185 ENST00000462356.1 novel transcript ENST00000479239.1 novel transcript ENST00000378230.3 KIAA0562 ENST00000484420.1 novel transcript ENST00000461667.1 novel transcript ENST00000460038.1 novel transcript ENST00000494653.1 novel transcript ENST00000474140.1 novel transcript (FLJ43102) ENST00000486765.1 novel transcript ENST00000412674.1 FLJ42718 ENST00000423197.1 FLJ36179 ENST00000378190.3 NMD exception ENST00000378191.3 NMD exception ENST00000466761.1 putative novel trancript ENST00000378111.1 non-canonical acceptor splice site at final exon ENST00000378006.1 non-canonical donor splice site at exon 24 and non-canonical acceptor splice site at exon 25 (final exon) ENST00000377999.1 translation extended by 137 amino acids at the N-terminal compared to the translation in Em:AK126012.1 ENST00000496404.1 non-canonical donor splice site at exon 23 ENST00000377939.4 FLJ45800 ENST00000496676.1 FLJ32096 ENST00000377836.4 alternative 5' UTR ENST00000377834.4 FLJ33803 and FLJ13692 ENST00000377748.1 FLJ39028 and KIAA0720 ENST00000489097.1 novel transcript FLJ00260 ENST00000400915.3 FLJ43562 ENST00000377728.3 FLJ21023 ENST00000491384.1 non-canonical splice sites between exons 1 and 2 ENST00000491384.1 novel transcript ENST00000487949.1 novel transcript FLJ33882 ENST00000377705.5 FLJ33965 and FLJ23323 ENST00000319084.5 alternative 5' UTR ENST00000435905.1 alternative 5' UTR ENST00000377658.4 FLJ90824 and FLJ32602 ENST00000377663.3 KIAA0469 ENST00000467612.1 novel transcript ENST00000496707.1 novel transcript ENST00000463043.1 novel transcript ENST00000377648.4 FLJ40396 and FLJ14586 ENST00000484676.1 novel transcript ENST00000377627.3 FLJ38898 ENST00000484669.1 novel transcript ENST00000487819.1 novel transcript ENST00000472925.1 novel transcript ENST00000480647.1 novel transcript ENST00000377577.5 FLJ10737 and DKFZp727C181 ENST00000465508.1 novel transcript (FLJ38067, FLJ36390) ENST00000472414.1 novel transcript ENST00000473993.1 novel transcript ENST00000469318.1 novel transcript ENST00000485073.1 novel transcript ENST00000460594.1 novel transcript ENST00000465911.1 novel transcript ENST00000338639.5 alternatively spliced 5' UTR, sharesd CDS with CTA-215D11.1-001 ENST00000338639.5 alternative 5' UTR ENST00000377491.1 alternatively spliced 5' UTR, shares CDS with CTA-215D11.1-001 ENST00000377491.1 alternative 5' UTR ENST00000377488.1 alternatively spliced 5' UTR, shares CDS with CTA-215D11.1-001 ENST00000377488.1 alternative 5' UTR ENST00000474874.1 novel transcript ENST00000467067.1 novel transcript ENST00000487559.1 novel transcript ENST00000445300.1 FLJ26758 ENST00000377464.1 KIAA0458 ENST00000400908.2 alternative 5' UTR ENST00000480342.1 FLJ38775 ENST00000495451.1 FLJ22807 ENST00000450402.1 alternative 5' UTR ENST00000357898.3 alternative 5' UTR ENST00000377399.2 alternative 5' UTR ENST00000400904.3 alternatively spliced 5' UTR, shares CDS with RP11-84A14.1-001 ENST00000400904.3 alternative 5' UTR ENST00000377258.1 alternatively spliced 5' UTR, shares CDS with RP11-84A14.1-001 ENST00000377258.1 alternative 5' UTR ENST00000377256.1 alternatively spliced 5' UTR, shares CDS with RP11-84A14.1-001 ENST00000377256.1 alternative 5' UTR ENST00000377213.1 alternatively spliced 5' UTR, shares CDS with RP11-84A14.3-001 ENST00000377213.1 alternative 5' UTR ENST00000377086.1 KIAA0591 ENST00000377083.1 KIAA1448 ENST00000495136.1 this variant and one or more of variant fragments RP4-736L20.1-007 through RP4-736L20.1-010 could be part of a single variant ENST00000497835.1 this variant and one or more of variant fragments RP4-736L20.1-006 through RP4-736L20.1-010 could be part of a single variant ENST00000465635.1 this variant and one or more of variant fragments RP4-736L20.1-006, 007 or 010 could be part of a single variant ENST00000483340.1 this variant and one or more of variant fragments RP4-736L20.1-006, 007 or 010 could be part of a single variant ENST00000470616.1 this variant and one or more of variant fragments RP4-736L20.1-006 through RP4-736L20.1-009 could be part of a single variant ENST00000309048.2 LOC374945 ENST00000377049.3 upstream ATG ENST00000478524.1 novel transcript ENST00000344008.5 FLJ34970, FLJ20321 ENST00000490176.1 novel transcript ENST00000496432.2 novel transcript ENST00000492173.1 novel transcript (FLJ12223) ENST00000478728.2 novel transcript ENST00000472814.1 novel transcript ENST00000476357.1 FLJ37833 ENST00000418570.2 FLJ37118 ENST00000473118.1 this variant and one or more of variant fragments RP4-635E18.2-007 through RP4-635E18.2-009 could be part of a single variant ENST00000476201.1 this variant and one or more of variant fragments RP4-635E18.2-007 through RP4-635E18.2-009 could be part of a single variant ENST00000472476.1 this variant and one or more of variant fragments RP4-635E18.2-007 through RP4-635E18.2-009 could be part of a single variant ENST00000477447.1 this variant and one or more of variant fragments RP4-635E18.2-004 through RP4-635E18.2-006 could be part of a single variant ENST00000496840.1 this variant and one or more of variant fragments RP4-635E18.2-004 through RP4-635E18.2-006 could be part of a single variant ENST00000480464.1 this variant and one or more of variant fragments RP4-635E18.2-004 through RP4-635E18.2-006 could be part of a single variant ENST00000474216.1 this variant and variant fragment RP4-635E18.5-008 could be part of a single variant ENST00000474216.1 FLJ41371 ENST00000490565.1 this variant and one or more of variant fragments RP4-635E18.5-007 or RP4-635E18.5-008 could be part of a single variant ENST00000469634.1 FLJ36636 ENST00000469634.1 this variant and one or more of variant fragments RP4-635E18.5-007 or RP4-635E18.5-008 could be part of a single variant ENST00000478271.1 this variant and one or more of variant fragments RP4-635E18.5-007 or RP4-635E18.5-008 could be part of a single variant ENST00000498576.1 this variant and one or more of variant fragments RP4-635E18.5-004 through RP4-635E18.5-006 and RP4-635E18.5-008 could be part of a single variant ENST00000460196.1 this variant and one or more of variant fragments RP4-635E18.5-003 through RP4-635E18.5-007 could be part of a single variant ENST00000452378.1 FLJ30609 ENST00000294484.6 KIAA1337 ENST00000376590.3 alternatively spliced 5' UTR, shares CDS with RP11-56N19.4-001 ENST00000376590.3 alternative 5' UTR ENST00000418034.1 alternatively spliced 5' UTR, shares CDS with RP11-56N19.4-001 (partial) ENST00000418034.1 alternative 5' UTR ENST00000413656.1 alternatively spliced 5' UTR, shares CDS with RP11-56N19.4-001 (partial) ENST00000413656.1 alternative 5' UTR ENST00000423400.1 23 additional amino acids at N-terminal of translation compared to translation in Em:AY046561.1 ENST00000431243.1 alternatively spliced 5' UTR, shares CDS with RP11-56N19.4-001 (partial) ENST00000431243.1 alternative 5' UTR ENST00000376486.2 alternatively spliced 5' UTR, shares CDS with RP11-56N19.4-001 (partial) ENST00000376486.2 alternative 5' UTR ENST00000346436.6 ClC-6a ENST00000376490.3 ClC-6b ENST00000376491.3 ClC-6d ENST00000376492.3 ClC-6c ENST00000376572.3 MGC33867 ENST00000376576.3 KIAA2013 ENST00000412236.1 alternatively spliced 5' UTR, shares CDS with RP5-1077B9.3-001 (partial) ENST00000412236.1 alternative 5' UTR ENST00000358136.3 KIAA0453 and FLJ33113 ENST00000356315.4 DKFZp686D20110 ENST00000460333.1 FLJ43128 ENST00000487188.1 FLJ10619 ENST00000471923.1 FLJ23066 ENST00000376223.2 DKFZp686A22160 ENST00000464917.1 novel transcript ENST00000482265.1 novel transcript ENST00000332530.3 FLJ45931 ENST00000288048.5 MGC35194 ENST00000474179.1 novel transcript ENST00000332296.7 FLJ43580 ENST00000437584.1 LOC343068 ENST00000317869.6 LOC343069 ENST00000240189.2 LOC65122 ENST00000235349.5 LOC343070 ENST00000235347.4 LOC343071 ENST00000330881.5 possible pseudogene ENST00000355096.2 possible pseudogene ENST00000436041.1 not best-in-genome evidence ENST00000423177.1 not best-in-genome evidence ENST00000513143.1 alternative 5' UTR ENST00000487038.1 alternative 5' UTR ENST00000475043.1 novel transcript ENST00000488631.1 novel transcript ENST00000413440.1 alternative 5' UTR ENST00000407521.3 alternative 5' UTR ENST00000376030.2 KIAA1026 ENST00000376030.2 NP_963922 ENST00000376028.4 alternative 5' UTR ENST00000469734.1 novel transcript ENST00000310916.3 FLJ23703 ENST00000376008.1 FLJ10199 ENST00000303840.4 alternative 5' UTR ENST00000436024.2 non-canonical splice donor site between exon 16 and exon 17 ENST00000314668.9 FLJ36564 ENST00000477846.1 novel transcript ENST00000472086.1 novel transcript ENST00000472449.1 novel transcript ENST00000428747.1 FLJ31291 ENST00000375980.4 MGC4342 ENST00000375890.4 NP_127463.2 ENST00000447522.1 alternative 5' UTR ENST00000375847.3 KIAA0962, FLJ13743, FLJ12468 ENST00000375838.1 FLJ34529 ENST00000475133.1 alternative 3' UTR ENST00000483270.1 novel transcript DKFZp434K0423 ENST00000472665.1 alternative 3' UTR ENST00000479655.1 novel transcript ENST00000490811.1 novel transcript ENST00000495523.1 novel transcript ENST00000375826.3 FLJ23384 ENST00000428945.1 FLJ34180 ENST00000486680.1 novel transcript ENST00000320153.6 novel transcript FLJ32812 ENST00000483899.1 novel transcript ENST00000375799.3 KIAA0842 ENST00000462455.1 novel transcript ENST00000477849.1 novel transcript ENST00000294454.5 FLJ14182 ENST00000489568.1 novel transcript ENST00000465495.1 novel transcript ENST00000465575.1 novel transcript ENST00000496928.2 alternative 5' UTR ENST00000508310.1 alternative 5' UTR ENST00000510393.1 alternative 5' UTR ENST00000430076.1 alternative 5' UTR ENST00000510929.1 alternative 5' UTR ENST00000502638.1 alternative 5' UTR ENST00000375766.3 alternative 5' UTR ENST00000375766.3 FLJ30697 ENST00000483633.2 alternative 5' UTR ENST00000502739.1 alternative 5' UTR ENST00000431771.2 alternative 5' UTR ENST00000332305.5 FLJ14538 ENST00000317122.1 FLJ42024 ENST00000375759.3 KIAA0929, FLJ35013 and FLJ45672 ENST00000329454.2 FLJ45517 ENST00000411503.1 DKFZp686A14192 ENST00000442459.2 FLJ90670 and DKFZp686P1416 ENST00000311890.9 FLJ32733, FLJ38592 ENST00000375718.4 FLJ34956 ENST00000463576.1 NAGNAG splice site ENST00000487046.1 NAGNAG splice site ENST00000375662.4 FLJ36766 ENST00000478117.1 novel transcript ENST00000270747.3 FLJ33962 ENST00000478210.1 novel transcript ENST00000488510.1 novel transcript ENST00000375599.2 MGC10731 ENST00000375592.3 KIAA1332 ENST00000478089.1 novel transcript ENST00000401088.4 DKFZp566C0424 ENST00000335496.1 LOC374955 ENST00000375577.1 LOC374956 ENST00000337132.5 FLJ10420 ENST00000486390.1 novel transcript ENST00000449853.1 novel transcript ENST00000270691.4 LOC284729 ENST00000545160.1 upstream uORF ENST00000375541.4 KIAA0445 ENST00000326735.8 novel protein ENST00000341676.5 novel protein ENST00000466561.1 novel transcript ENST00000463860.1 novel transcript (FLJ26510) ENST00000479534.1 FLJ41169 ENST00000466151.1 FLJ45061 ENST00000412427.1 FLJ45933 ENST00000460293.1 FLJ45608 ENST00000468945.1 this variant and variant fragment RP1-20B21.1-005 could be part of a single variant ENST00000467001.1 this variant and variant fragment RP1-20B21.1-003 could be part of a single variant ENST00000434762.2 suspected genomic sequence error affecting CDS in exon 9 ENST00000474892.1 novel transcript ENST00000375433.3 alternative 5' UTR ENST00000361221.3 KIAA1626 ENST00000482892.1 this variant and one or more of variant fragments RP11-473A10.0-006, 008 and 009 could be part of a single variant ENST00000482892.1 novel transcript ENST00000469726.1 novel transcript FLJ44929 ENST00000375408.3 FLJ34701 ENST00000475356.1 novel transcript FLJ10521 ENST00000482359.1 this variant and one or more of variant fragments RP11-473A10.0-006, 007 and 009 could be part of a single variant ENST00000466782.1 this variant and one or more of variant fragments RP11-473A10.0-006, 007 and 008 could be part of a single variant ENST00000466782.1 novel transcript ENST00000495593.1 this variant and one or more of variant fragments RP11-473A10.0-007, 008 and 009 could be part of a single variant ENST00000375406.1 LOC81569 ENST00000251296.1 MGC15730 and FLJ90835 ENST00000473951.1 putative novel transcript ENST00000494072.2 subject to nonsense-mediated decay ENST00000494072.2 not organism-supported ENST00000455833.2 NP_001129737.1 ENST00000477853.1 KIAA0090 ENST00000375197.2 non-canonical donor splice site at exon thirteen ENST00000375153.3 alternative 5' UTR ENST00000413711.1 alternatively spliced 5' UTR, shares CDS with RP4-657E11.7-001 (partial) ENST00000413711.1 alternative 5' UTR ENST00000462646.1 novel transcript ENST00000467029.1 novel transcript ENST00000481464.1 novel transcript ENST00000498642.1 novel transcript ENST00000479642.1 novel transcript ENST00000428975.1 alternative 5' UTR ENST00000451758.1 alternative 5' UTR ENST00000439664.1 alternative 5' UTR ENST00000425400.1 alternative 5' UTR ENST00000294543.6 novel protein (LOC255104) ENST00000375127.1 novel protein (LOC255104) ENST00000489814.1 this variant and one or more of variant fragments RP5-1056L3.6-007 through .010 could be part of a single variant ENST00000489814.1 novel transcript (FLJ45636) ENST00000494342.1 this variant and one or more of variant fragments RP5-1056L3.6-004, .007 through .010 could be part of a single variant ENST00000494342.1 novel transcript ENST00000489135.1 novel transcript ENST00000496528.1 this variant and one of variant fragments RP5-1056L3.6-005 or .006 could be part of a single variant ENST00000496528.1 novel transcript ENST00000462171.1 this variant and one of variant fragments RP5-1056L3.6-005 or .006 could be part of a single variant ENST00000462171.1 novel transcript ENST00000466661.1 this variant and one of variant fragments RP5-1056L3.6-005 or .006 could be part of a single variant ENST00000466661.1 novel transcript ENST00000488449.1 this variant and one of variant fragments RP5-1056L3.6-005 or .006 could be part of a single variant ENST00000488449.1 novel transcript ENST00000375120.3 novel protein (KIAA0459) ENST00000466697.1 RP11-91K11.3-003 ENST00000466697.1 novel transcript ENST00000481686.1 RP11-91K11.3-002 ENST00000481686.1 novel transcript ENST00000429261.2 confirm experimentally ENST00000429261.2 novel protein similar to part of phospholipase A2 ENST00000429261.2 not organism-supported ENST00000495760.2 novel transcript ENST00000375099.3 novel protein (FLJ25429) ENST00000473325.1 novel transcript (FLJ43845) ENST00000530722.1 alternative 5' UTR ENST00000534075.1 alternative 5' UTR ENST00000467486.1 novel transcript (FLJ32784) ENST00000426428.1 novel protein (LOC339505) ENST00000418743.1 novel transcript ENST00000423486.1 novel transcript ENST00000264198.3 FLJ12875 ENST00000492302.1 FLJ27236 ENST00000451424.1 FLJ00387 ENST00000475210.1 this variant and one or both of variant fragments RP11-401M16.6.002 and .004 could be part of a single variant ENST00000486473.1 this variant and one or both of variant fragments RP11-401M16.6.003 and .004 could be part of a single variant ENST00000477229.1 this variant and one or both of variant fragments RP11-401M16.6.002 and .003 could be part of a single variant ENST00000400463.3 Splice acceptor of exon 13 differs by three nucleotides from that of RP11-401M16.8-009 ENST00000493818.1 this variant and one or more of variant fragments RP11-401M16.8-004 through 007 could be part of a single variant ENST00000247986.2 Splice acceptor of exon 13 differs by three nucleotides from that of RP11-401M16.8-004 ENST00000462858.1 this variant and one or more of variant fragments RP11-401M16.8-004 and 008 could be part of a single variant ENST00000498225.1 this variant and one or more of variant fragments RP11-401M16.8-004 and 008 could be part of a single variant ENST00000463389.1 this variant and one or more of variant fragments RP11-401M16.8-004 and 008 could be part of a single variant ENST00000518294.1 alternative 5' UTR ENST00000517430.1 alternative 5' UTR ENST00000519434.1 alternative 5' UTR ENST00000375003.2 DKFZp434I0612, DKFZp686I07120 ENST00000437575.1 alternative 5' UTR ENST00000419490.1 alternative 5' UTR ENST00000414993.1 alternative 5' UTR ENST00000443615.1 alternative 5' UTR ENST00000374830.1 alternative 5' UTR ENST00000374830.1 alternatively spliced 5' UTR shares CDS with RP11-293F5.7-003 ENST00000480720.1 non-canonical donor splice site at exon 3 and non-canonical acceptor splice site at exon 4 ENST00000317967.7 Alternatively spliced 5' UTR, shares CDS with RP11-63N8.1-001 (partial) ENST00000317967.7 alternative 5' UTR ENST00000447293.1 Alternatively spliced 5' UTR, shares CDS with RP11-63N8.1-001 (partial) ENST00000447293.1 alternative 5' UTR ENST00000484271.1 novel transcript ENST00000486901.1 novel transcript ENST00000481644.1 novel transcript ENST00000469378.1 novel transcript ENST00000471322.1 novel transcript ENST00000493940.1 novel transcript ENST00000498495.1 novel transcript ENST00000473526.1 novel transcript ENST00000452322.1 novel transcript ENST00000344548.3 isoform 1 ENST00000315554.8 isoform 2 ENST00000498236.1 novel transcript ENST00000411827.1 isoform 2 with an alternatively spliced 5'UTR ENST00000431803.1 novel transcript ENST00000487348.1 LOC343384 ENST00000375647.4 KIAA0478 ENST00000400239.2 alternative 5' UTR ENST00000166244.3 ephrin receptor EphA8 precursor ENST00000438241.1 alternative 5' UTR ENST00000402322.1 alternative 5' UTR ENST00000374640.4 alternative 5' UTR ENST00000374637.1 alternative 5' UTR ENST00000510260.1 alternative 5' UTR ENST00000432749.2 alternative 5' UTR ENST00000356634.3 KIAA0601 ENST00000400181.4 KIAA0601 ENST00000481879.1 novel transcript ENST00000471849.1 alternative 5' UTR ENST00000475164.2 alternative 5' UTR ENST00000464516.1 this variant and one or more of variant fragments RP5-1057J7.2-005, 007 and 008 could be part of a single variant ENST00000476660.1 this variant and one or more of variant fragments RP5-1057J7.2-006, 007 and 008 could be part of a single variant ENST00000476451.1 this variant and one or more of variant fragments RP5-1057J7.2-005, 006 and 007 could be part of a single variant ENST00000490652.1 this variant and one or more of variant fragments RP5-1057J7.2-005, 006 and 008 could be part of a single variant ENST00000314011.4 KIAA1710 ENST00000374609.1 FLJ35045 ENST00000374608.3 alternatively spliced 5'UTR shares CDS with RP5-1057J7.3-001 ENST00000374608.3 alternative 5' UTR ENST00000454117.1 LOC148898 ENST00000476978.1 this variant and one or more of variant fragments RP5-1057J7.5-003 through -005 ENST00000461794.1 this variant and variant fragment RP5-1057J7.5-002 could be part of a single variant ENST00000484906.1 novel transcript (FLJ20246) ENST00000437606.2 NP_001137250.1 ENST00000477916.1 novel transcript ENST00000467075.1 novel transcript ENST00000482370.1 novel transcript ENST00000447961.1 novel transcript ENST00000495365.1 novel transcript ENST00000492577.1 novel transcript ENST00000421070.1 alternative 5' UTR ENST00000481736.1 novel transcript ENST00000425913.1 alternative 5' UTR ENST00000445705.1 alternative 5' UTR ENST00000467493.1 novel transcript ENST00000470383.1 novel transcript ENST00000467070.1 novel transcript ENST00000479458.1 novel transcript ENST00000498698.1 novel transcript ENST00000471915.1 alternative 5' UTR ENST00000334351.7 FLJ20312 and FLJ21121 ENST00000374468.1 alternative 5' UTR ENST00000344989.5 FLJ10424 ENST00000344989.5 AT/AC splicing between exons two and three ENST00000484146.1 AT/AC splicing between exons two and three ENST00000341154.6 FLJ35907 ENST00000374452.5 AT/AC splicing between exons two and three ENST00000374453.3 AT/AC splicing between exons two and three ENST00000492112.1 AT/AC splicing between exons 2 and 3 ENST00000343255.4 FLJ10794 ENST00000343255.4 AT/AC splicing between exons two and three ENST00000485841.1 FLJ43846 and FLJ30749 ENST00000338909.5 FLJ35961 ENST00000475306.1 novel transcript ENST00000327535.1 isoform 1 ENST00000327575.2 isoform 3 ENST00000374421.3 isoform 2 ENST00000361548.4 NP_937816.1 ENST00000524724.1 alternative 5' UTR ENST00000374409.1 LOC90529 ENST00000497384.1 novel transcript ENST00000438866.1 novel transcript ENST00000483261.1 novel transcript ENST00000498488.1 novel transcript ENST00000483528.1 novel transcript ENST00000475760.1 novel transcript ENST00000492753.1 novel transcript ENST00000003912.3 DJ462O23.2 ENST00000488155.1 novel transcript ENST00000475663.1 novel transcript ENST00000425530.1 alternative 5' UTR ENST00000374392.2 FLJ42528 ENST00000486262.1 novel transcript ENST00000488683.1 alternative 3' UTR ENST00000488683.1 alternatively spliced 3' UTR, shares CDS with RP11-108J9.1-001 ENST00000474160.1 novel transcript ENST00000476231.1 novel transcript ENST00000498238.1 novel transcript ENST00000473314.1 novel transcript ENST00000498135.1 novel transcript ENST00000491936.1 novel transcript ENST00000480937.1 novel transcript ENST00000468704.1 novel transcript ENST00000487234.1 novel transcript ENST00000374343.4 FLJ10747 ENST00000470035.1 novel transcript ENST00000485476.1 novel transcript ENST00000488127.1 novel transcript ENST00000462394.1 novel transcript ENST00000484476.1 novel transcript ENST00000470950.1 novel transcript ENST00000361547.2 protein incorporates selenocysteine (Sec) at UGA codon rather than the usual termination signal ENST00000374315.1 protein incorporates selenocysteine (Sec) at UGA codon rather than the usual termination signal ENST00000527604.1 subject to nonsense-mediated decay ENST00000424294.1 alternative 5' UTR ENST00000529116.1 alternative 5' UTR ENST00000469815.1 novel transcript ENST00000525713.1 alternative 5' UTR ENST00000526158.1 alternative 5' UTR ENST00000374300.3 alternative 5' UTR ENST00000466284.1 alternative 5' UTR ENST00000531361.1 not organism-supported ENST00000481602.1 putative novel transcript ENST00000374298.3 MGC2603 ENST00000513116.1 FLJ32206 ENST00000357865.2 alternative 5' UTR ENST00000374291.1 alternative 5' UTR ENST00000446334.1 alternative 5' UTR ENST00000374284.1 variant 4; alternatively spliced in 5' UTR ENST00000374268.3 FLJ14050 ENST00000414762.1 putative novel transcript ENST00000444682.1 putative novel transcript ENST00000476272.1 DKFZP434L0117 ENST00000252992.4 alternative 3' UTR ENST00000480446.1 novel transcript ENST00000468163.1 novel transcript ENST00000491670.1 novel transcript ENST00000374221.3 alternative 5' UTR ENST00000349618.3 MGC33414 ENST00000451801.1 alternative 5' UTR ENST00000416125.1 alternative 5' UTR ENST00000487944.1 novel transcript ENST00000533087.1 alternative 5' UTR ENST00000531312.1 alternative 5' UTR ENST00000525165.1 alternative 5' UTR ENST00000525326.1 alternative 5' UTR ENST00000525546.1 alternative 5' UTR ENST00000436153.1 alternative 5' UTR ENST00000530781.1 alternative 5' UTR ENST00000468388.1 novel transcript ENST00000464888.1 novel transcript ENST00000463817.1 novel transcript ENST00000467700.1 novel transcript ENST00000466194.1 novel transcript ENST00000418220.1 LOC151871 ENST00000374168.2 probable paralogue of RPS6KA1 ENST00000374166.4 not organism-supported ENST00000529454.1 alternative 5' UTR ENST00000530003.1 not organism-supported ENST00000474934.1 novel transcript ENST00000488985.1 novel transcript ENST00000457599.2 confirm experimentally ENST00000457599.2 NP_624361.1 ENST00000524572.1 alternative 5' UTR ENST00000374152.2 confirm experimentally ENST00000472757.1 novel transcript ENST00000078527.4 FLJ20477 ENST00000431541.1 alternative 5' UTR ENST00000374145.1 alternative 5' UTR ENST00000455364.1 alternative 5' UTR ENST00000374135.3 FLJ10349 ENST00000477418.1 novel transcript ENST00000461282.1 novel transcript ENST00000361720.5 FLJ12455 ENST00000484772.1 novel transcript ENST00000320567.5 FLJ34633 ENST00000437956.1 DC2 pseudogene ENST00000522111.1 NMD exception ENST00000531285.1 NMD exception ENST00000490329.1 novel transcript ENST00000374084.1 alternative 5' UTR ENST00000446783.1 FLJ20420 pseudogene ENST00000361771.3 KIAA1037 ENST00000491239.1 novel transcript ENST00000472249.1 alternative 3' UTR ENST00000374076.4 DKFZP564D0478 ENST00000490170.1 novel transcript ENST00000475199.1 novel transcript ENST00000472410.1 isoform 2 ENST00000493901.1 Based on mouse mRNAs ENST00000493901.1 alternative 5' UTR ENST00000357582.2 alternative 5' UTR ENST00000476509.1 novel transcript ENST00000495230.1 novel transcript ENST00000270879.4 isoform 1 ENST00000354982.2 isoform 2 ENST00000481748.1 novel transcript ENST00000247087.4 DJ159A19.3 ENST00000482400.1 novel transcript ENST00000407475.2 alternative 5' UTR ENST00000407475.2 alternative 5' UTR; shares CDS with RP1-159A19.1-001 ENST00000487743.1 novel transcript ENST00000490295.1 novel transcript ENST00000479753.1 novel transcript ENST00000480033.1 novel transcript ENST00000469062.1 novel transcript ENST00000374004.1 alternative 5' UTR; shares CDS with RP1-159A19.2-001, RP1-159A19.2-002, RP1-159A19.2-007 ENST00000374004.1 alternative 5' UTR ENST00000374003.3 alternative 5' UTR ENST00000374003.3 alternative 5' UTR; shares CDS with RP1-159A19.2-001, RP1-159A19.2-004, RP1-159A19.2-007 ENST00000457296.1 alternative 5' UTR; shares CDS with RP1-159A19.2-001, RP1-159A19.2-004, RP1-159A19.2-004 ENST00000457296.1 alternative 5' UTR ENST00000475472.1 novel transcript ENST00000468038.1 novel transcript ENST00000361157.6 isoform a ENST00000339145.4 isoform c ENST00000362020.4 isoform b ENST00000373954.5 NP_689873.1 ENST00000419687.2 NP_001137387.1 ENST00000468761.1 novel transcript ENST00000481874.1 novel transcript ENST00000472285.1 novel transcript ENST00000311772.5 isoform alpha ENST00000236412.7 isoform gamma ENST00000373931.4 isoform beta ENST00000467258.1 novel transcript ENST00000466068.1 novel transcript ENST00000482828.1 novel transcript ENST00000492877.1 novel transcript ENST00000466793.1 novel transcript ENST00000373884.5 FLJ10307 ENST00000481387.1 novel transcript ENST00000495923.1 novel transcript ENST00000471498.1 novel transcript ENST00000468665.1 novel transcript ENST00000373857.3 alternative 5' UTR; shares CDS with RP5-1053E7.4-002 ENST00000373857.3 alternative 5' UTR ENST00000305392.3 alternative 5' UTR; shares CDS with RP5-1053E7.4-001 ENST00000305392.3 alternative 5' UTR ENST00000470967.1 this variant and one of variant fragments RP3-429K2.1-004 or 005 could be part of a single variant ENST00000482674.1 this variant and variant fragment RP3-429K2.1-003 could be part of a single variant ENST00000488868.1 this variant and variant fragment RP3-429K2.1-003 could be part of a single variant ENST00000497986.1 NP_835497.1 ENST00000335514.5 CCDS319.1 ENST00000465645.1 NP_835498.1 ENST00000479574.1 novel transcript ENST00000373842.4 FLJ20045 ENST00000475655.1 novel transcript ENST00000474683.1 novel transcript ENST00000373839.3 FLJ13171 ENST00000427469.1 alternative 5' UTR ENST00000373833.5 alternative 5' UTR ENST00000373831.3 NP_001041659.1 ENST00000430407.1 alternative 5' UTR ENST00000437681.1 FLJ35407 ENST00000373830.3 FLJ20503 ENST00000495995.1 novel transcript (FLJ13493) ENST00000411406.3 novel transcript ENST00000480930.1 novel transcript ENST00000491577.1 novel transcript ENST00000464880.1 novel transcript ENST00000497790.1 novel transcript ENST00000495215.1 novel transcript ENST00000464093.1 novel transcript ENST00000484775.1 novel transcript ENST00000464612.1 novel transcript ENST00000475441.1 novel transcript ENST00000470977.1 novel transcript ENST00000474814.1 novel transcript ENST00000481368.1 novel transcript ENST00000481220.1 novel transcript ENST00000488745.1 novel transcript ENST00000483436.1 novel transcript ENST00000464115.1 novel transcript ENST00000461832.1 novel transcript ENST00000373824.4 alternatively spliced 5' UTR shares CDS with RP4-669K10.7-001 ENST00000373824.4 alternative 5' UTR ENST00000465518.1 FLJ22356 ENST00000361872.4 alternatively spliced 5' UTR, shares CDS with RP11-318E23.1-002 ENST00000361872.4 alternative 5' UTR ENST00000474884.1 novel transcript ENST00000478283.1 novel transcript ENST00000496288.1 novel transcript ENST00000475796.1 novel transcript ENST00000468863.1 novel transcript ENST00000482464.1 this variant and one or more of variant fragments RP11-242O24.1-006, 008 and 009 could be part of a single variant. ENST00000490308.1 this variant and variant fragment RP11-242O24.1-007 could be part of a single variant. ENST00000460378.1 this variant and variant fragment RP11-242O24.1-007 could be part of a single variant. ENST00000462032.1 this variant and variant fragment RP11-242O24.1-007 could be part of a single variant. ENST00000420504.2 alternative 5' UTR ENST00000373791.3 FLJ22177 ENST00000478505.1 novel transcript ENST00000417651.1 novel transcript ENST00000454613.1 FLJ33163 ENST00000414532.1 FLJ46197 ENST00000424085.2 not organism-supported ENST00000373747.3 not organism-supported ENST00000525843.1 not organism-supported ENST00000426105.2 NP_001018494.1 ENST00000531867.1 alternative 5' UTR ENST00000263694.4 FLJ90035 ENST00000486941.1 this variant and one or more of variant fragments RP11-490K7.3-006 and 007 could be part of a single variant ENST00000486941.1 novel transcript ENST00000489853.1 novel transcript (FLJ41108) ENST00000489853.1 this variant and variant fragment RP11-490K7.3-007 could be part of a single variant ENST00000373720.3 this variant and one or more of variant fragments RP11-490K7.3-006 and 007 could be part of a single variant ENST00000491106.1 this variant and one or more of variant fragments RP11-490K7.3-006 and 007 could be part of a single variant ENST00000491106.1 novel transcript ENST00000474025.1 this variant and one or more of variant fragments RP11-490K7.3-002, 004, 005 and 007 could be part of a single variant ENST00000474025.1 novel transcript ENST00000463988.1 this variant and one or more of variant fragments RP11-490K7.3-002 through 006 could be part of a single variant ENST00000463988.1 novel transcript ENST00000344147.5 FLJ11067, FLJ12444, FLJ13987 ENST00000479629.1 novel transcript ENST00000373714.1 alternatively spliced 5' UTR, shares CDS with RP11-266K22.1-001. ENST00000373714.1 alternative 5' UTR ENST00000490049.1 novel transcript ENST00000373710.1 FLJ45757 ENST00000491976.1 FLJ36465 ENST00000412068.1 FLJ36299 ENST00000481165.1 FLJ00196 ENST00000478502.1 novel transcript ENST00000489164.1 novel transcript ENST00000492061.1 novel transcript ENST00000496805.1 novel transcript ENST00000472443.1 novel transcript ENST00000373672.3 NP_001847 ENST00000465256.1 FLJ41398 ENST00000436464.1 alternative 5' UTR ENST00000257100.3 FLJ33697 ENST00000485944.1 FLJ39908 ENST00000528791.1 alternative 5' UTR ENST00000525930.1 alternative 5' UTR ENST00000453837.1 FLJ46627 ENST00000532001.1 alternative 5' UTR ENST00000528253.1 not organism-supported ENST00000468531.1 alternative 5' UTR ENST00000534796.1 alternative 5' UTR ENST00000526960.1 not organism-supported ENST00000484270.1 contains non-canonical splice site ENST00000487305.1 novel transcript ENST00000336294.5 FLJ10315 ENST00000441402.1 novel transcript ENST00000472503.1 novel transcript ENST00000468135.1 novel transcript ENST00000466321.1 novel transcript ENST00000498613.1 novel transcript ENST00000515055.1 probably related to KPNA6 locus ENST00000373609.1 alternative 5' UTR ENST00000469003.1 novel transcript ENST00000483009.1 novel transcript ENST00000291358.6 FLJ10547 ENST00000466796.1 novel transcript ENST00000485689.1 putative novel transcript ENST00000487174.1 novel transcript ENST00000471486.1 novel transcript ENST00000474371.1 novel transcript ENST00000373582.3 MGC10820 ENST00000461712.2 alternative 5' UTR ENST00000373562.3 alternative 5' UTR ENST00000526031.1 NP_001137362.1 ENST00000419121.2 NP_001137361.1 ENST00000446293.2 NP_001137360.1 ENST00000480336.1 subject to nonsense-mediated decay ENST00000415091.2 NP_001139192.1 ENST00000492007.1 novel transcript ENST00000373506.3 novel transcript ENST00000473294.1 novel transcript ENST00000478041.1 novel transcript ENST00000498691.1 novel transcript ENST00000467652.1 novel transcript ENST00000476493.1 novel transcript ENST00000488075.1 novel transcript ENST00000465588.1 novel transcript ENST00000479075.1 novel transcript ENST00000473383.1 novel transcript ENST00000466361.1 novel transcript ENST00000414241.3 NP_001128727.1 ENST00000458695.2 NP_001128728.1 ENST00000490500.1 alternative 5' UTR ENST00000445722.2 alternative 5' UTR ENST00000482190.1 non-canonical acceptor splice site between exons 5 and 6 ENST00000417633.1 alternative 5' UTR ENST00000426909.1 alternative 5' UTR ENST00000401073.2 NP_065939.2 ENST00000468130.1 novel transcript ENST00000373480.1 KIAA1522 ENST00000490826.1 FLJ44480 ENST00000487404.1 FLJ45247 ENST00000530710.1 alternative 5' UTR ENST00000373476.1 alternative 5' UTR ENST00000529027.1 alternative 5' UTR ENST00000531123.1 NP_001017406.1 ENST00000526230.1 alternative 5' UTR ENST00000531256.1 alternative 5' UTR ENST00000482212.1 alternative 5' UTR ENST00000530552.1 alternative 5' UTR ENST00000483143.1 novel transcript ENST00000481487.1 novel transcript ENST00000373471.3 FLJ34783 ENST00000497068.1 novel transcript ENST00000496770.1 novel transcript ENST00000465346.1 novel transcript ENST00000482771.1 novel transcript ENST00000474144.1 novel transcript ENST00000475208.1 novel transcript ENST00000463914.1 novel transcript ENST00000478635.1 novel transcript ENST00000294517.6 alternatively spliced 5' UTR, shares CDS with RP1-117O3.2-001 ENST00000294517.6 alternative 5' UTR ENST00000481886.1 novel transcript (FLJ37808) ENST00000475935.1 novel transcript ENST00000462920.1 novel transcript ENST00000471119.1 novel transcript (FLJ32489) ENST00000495135.1 novel transcript ENST00000477570.1 novel transcript ENST00000483027.1 novel transcript ENST00000473089.1 novel transcript ENST00000484656.1 novel transcript ENST00000478204.1 novel transcript (FLJ16166) ENST00000497280.1 novel transcript ENST00000492521.1 novel transcript ENST00000291416.5 FLJ10759 ENST00000482586.1 alternatively spliced 3' UTR, shares CDS with RP11-131M11.1-001 ENST00000482586.1 FLJ16558 ENST00000482586.1 alternative 3' UTR ENST00000485148.1 novel transcript ENST00000486583.1 novel transcript ENST00000483388.1 novel transcript ENST00000539719.1 FLJ25476 ENST00000490959.1 novel transcript ENST00000477934.1 novel transcript ENST00000373422.3 FLJ31867 ENST00000485928.1 this variant and one or more of variant fragments RP11-415J8.4-009 through 011 could be part of a single variant. ENST00000485928.1 FLJ46105 ENST00000467894.1 this variant and one or more of variant fragments RP11-415J8.4-009 through 011 could be part of a single variant. ENST00000486897.1 this variant and one or more of variant fragments RP11-415J8.4-009 through 011 could be part of a single variant. ENST00000493483.1 this variant and one or more of variant fragments RP11-415J8.4-009 through 011 could be part of a single variant. ENST00000473158.1 this variant and one or more of variant fragments RP11-415J8.4-009 through 011 could be part of a single variant. ENST00000459964.1 this variant and one or more of variant fragments RP11-415J8.4-004 through 008 and 010, 011 could be part of a single variant. ENST00000468406.1 this variant and one or more of variant fragments RP11-415J8.4-004 through 009 could be part of a single variant. ENST00000484692.1 this variant and one or more of variant fragments RP11-415J8.4-004 through 009 could be part of a single variant. ENST00000519684.1 LOC127540: HMG2 like ENST00000522796.1 alternative 5' UTR ENST00000522796.1 not organism-supported ENST00000425631.1 FLJ20506 ENST00000488417.1 NP_001128206.1 ENST00000446026.1 alternative 5' UTR ENST00000456842.1 alternative 5' UTR ENST00000423898.1 alternative 5' UTR ENST00000417239.1 alternative 5' UTR ENST00000373366.2 alternative 5'UTR; shares CDS with RP1-34M23.3-002 ENST00000373366.2 alternative 5' UTR ENST00000373362.3 alternative 5'UTR; shares CDS with RP1-34M23.3-002 ENST00000373362.3 alternative 5' UTR ENST00000342280.4 alternative 5' UTR; shares CDS with RP1-34M23.4-002 ENST00000342280.4 alternative 5' UTR ENST00000450137.1 alternative 5' UTR; shares CDS with RP1-34M23.4-001 ENST00000450137.1 alternative 5' UTR ENST00000495979.1 novel transcript ENST00000493328.1 novel transcript ENST00000466345.1 novel transcript ENST00000472971.1 novel transcript ENST00000460607.1 novel transcript ENST00000471566.1 putative novel transcript ENST00000417119.1 alternative 5' UTR; shares CDS with RP11-248I9.1-001 and RP11-248I9.1-002 ENST00000417119.1 alternative 5' UTR ENST00000359858.4 alternative 5' UTR ENST00000359858.4 alternative 5' UTR; shares CDS with RP11-248I9.1-001 and RP11-248I9.1-004 ENST00000466390.1 novel transcript ENST00000488455.1 novel transcript ENST00000475654.1 novel transcript ENST00000373330.1 alternative 5' UTR; shares CDS with RP11-248I9.1-002 and RP11-248I9.1-004 ENST00000373330.1 FLJ23151 ENST00000373330.1 alternative 5' UTR ENST00000476269.1 novel transcript ENST00000463393.1 novel transcript ENST00000482131.1 novel transcript ENST00000470175.1 novel transcript ENST00000492456.1 novel transcript ENST00000426982.2 alternative 5' UTR ENST00000473423.1 novel transcript ENST00000474856.1 novel transcript ENST00000440579.1 alternative 5' UTR ENST00000492888.1 novel transcript ENST00000469892.1 alternative 5' UTR ENST00000494948.1 alternative 5' UTR ENST00000473465.1 novel transcript ENST00000459931.1 novel transcript ENST00000270815.4 FLJ38984 ENST00000318121.3 Q9HAW4-1 ENST00000373210.3 KIAA1567 ENST00000397799.1 alternative 5' UTR ENST00000316156.4 FLJ10350 ENST00000373150.4 FLJ10350 ENST00000530975.1 not organism-supported ENST00000373148.4 FLJ38620 ENST00000354618.5 FLJ22082 ENST00000469141.2 alternative 5' UTR ENST00000478853.1 alternative 5' UTR ENST00000505871.1 NP_078952.4 ENST00000270824.1 FLJ10647 ENST00000356637.5 not organism-supported ENST00000354267.3 NP_996668.1 ENST00000524789.1 not organism-supported ENST00000488606.1 FLJ43240 ENST00000462067.1 FLJ11564 ENST00000533491.1 alternative 5' UTR ENST00000373087.5 FLJ23231 ENST00000492829.1 novel transcript (FLJ36024) ENST00000472312.1 novel transcript ENST00000471012.1 novel transcript ENST00000296214.5 FLJ11730 ENST00000475828.1 novel transcript ENST00000487788.1 novel transcript ENST00000487792.1 novel transcript ENST00000485039.1 novel transcript ENST00000296215.5 FLJ14716, FLJ12553 ENST00000468040.1 novel transcript ENST00000493916.1 novel transcript ENST00000490312.1 this variant and variant fragment RP3-423B22.6-002 or 005 could be part of a single variant. ENST00000497858.1 this variant and variant fragment RP3-423B22.6-004 could be part of a single variant. ENST00000497858.1 FLJ45016 ENST00000467277.1 this variant and variant fragment RP3-423B22.6-004 could be part of a single variant. ENST00000490029.1 this variant and one or more of variant fragments RP3-423B22.7-004 through 008 could be part of a single variant.\n\ ENST00000490029.1 novel transcript ENST00000462812.1 this variant and one or more of variant fragments RP3-423B22.7-004 through 008 could be part of a single variant.\n\ ENST00000462812.1 novel transcript (FLJ27187) ENST00000538069.1 this variant and one or more of variant fragments RP3-423B22.7-002, 003, 006 through 008 could be part of a single variant ENST00000538069.1 novel transcript ENST00000469191.1 this variant and one or more of variant fragments RP3-423B22.7-002, 003, 006 through 008 could be part of a single variant.\n\ ENST00000469191.1 novel transcript ENST00000483577.1 this variant and one or more of variant fragments RP3-423B22.7-002 through 005 could be part of a single variant.\n\ ENST00000463351.1 this variant and one or more of variant fragments RP3-423B22.7-002 through 005 could be part of a single variant.\n\ ENST00000463351.1 novel transcript ENST00000488496.1 this variant and one or more of variant fragments RP3-423B22.7-002 through 005 could be part of a single variant.\n\ ENST00000488496.1 novel transcript ENST00000373059.1 FLJ40906 ENST00000494120.1 novel transcript (FLJ20508) ENST00000464178.1 novel transcript ENST00000464085.1 novel transcript ENST00000461359.1 novel transcript ENST00000477060.1 novel transcript ENST00000486637.1 novel transcript ENST00000491797.1 novel transcript ENST00000488137.1 novel transcript ENST00000472584.1 novel transcript ENST00000327331.2 alternatively spliced 5' UTR, shares CDS with RP4-783C10.2-001 ENST00000327331.2 FLJ10468 ENST00000327331.2 alternative 5' UTR ENST00000446149.2 novel transcript ENST00000373048.4 NP_001092909.1 ENST00000453577.1 this variant and variant fragment RP4-783C10.3-004 could be part of a single variant ENST00000373044.2 FLJ23476 ENST00000373043.1 1st intron retained ENST00000373043.1 alternative 5' UTR ENST00000419397.3 not organism-supported ENST00000468084.1 NP_001136198.1 ENST00000373042.4 NP_940848.2 ENST00000525096.1 non-canonical splice acceptor site between exons 1 and 2 ENST00000373027.1 FLJ12784 ENST00000487062.1 this variant and one or more variant fragments RP11-100H21.1-002, 004 through 008 could be part of a single variant.\n\ ENST00000460925.1 this variant and one or more variant fragments RP11-100H21.1-002, 003, 005 and 006 could be part of a single variant.\n\ ENST00000489537.1 this variant and variant fragment RP11-100H21.1-003 could be part of a single variant.\n\ ENST00000461869.1 this variant and variant fragment RP11-100H21.1-003 could be part of a single variant.\n\ ENST00000470585.1 this variant and one or more variant fragments RP11-100H21.1-003 and 004 could be part of a single variant.\n\ ENST00000488934.1 this variant and one or more variant fragments RP11-100H21.1-002, 003 and 004 could be part of a single variant.\n\ ENST00000462258.1 this variant and one or more variant fragments RP11-100H21.1-003, 004 and 006 could be part of a single variant.\n\ ENST00000483182.1 novel transcript ENST00000486563.1 novel transcript ENST00000488453.1 novel transcript (FLJ13525) ENST00000428151.1 novel transcript ENST00000424719.1 FK506 binding protein 3, 25kDa (FKBP3) pseudogene ENST00000431311.1 novel transcript ENST00000452971.1 novel transcript ENST00000442006.1 heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) (HSPA5) pseudogene ENST00000373001.3 Ras-related GTP binding C ENST00000474456.1 Ras-related GTP binding C ENST00000493015.1 Ras-related GTP binding C ENST00000496778.1 Ras-related GTP binding C ENST00000433671.1 novel transcript ENST00000456813.1 novel transcript ENST00000443161.1 novel transcript ENST00000397572.2 c-myc binding protein ENST00000494695.1 c-myc binding protein ENST00000495043.1 c-myc binding protein ENST00000489803.1 c-myc binding protein ENST00000489575.1 c-myc binding protein ENST00000465771.1 c-myc binding protein ENST00000462027.1 c-myc binding protein ENST00000360786.3 gap junction protein, alpha 10, 59kDa ENST00000529075.1 non-canonical splice acceptor site between exons 1 and 2 ENST00000446189.2 NP_001129747.1 ENST00000531822.1 not organism-supported ENST00000372967.3 alternative 5' UTR ENST00000372915.3 not organism-supported ENST00000524432.1 not organism-supported ENST00000496804.1 FLJ45612 ENST00000530262.1 not organism-supported ENST00000476350.1 KIAA1251 ENST00000372925.2 KIAA0465 ENST00000360115.4 exons 5 and 9 found using dotter ENST00000497964.1 FLJ13759 ENST00000496360.1 FLJ13223 ENST00000497807.1 DKFZp686F1899 ENST00000331856.2 FLJ36340 ENST00000492468.1 FLJ33791 ENST00000468476.1 FLJ43938 ENST00000372858.3 NP_001129125.1 ENST00000372856.3 NP_001129126.1 ENST00000530186.1 alternative 3' UTR ENST00000421687.2 not organism-supported ENST00000474378.1 non-canonical splice donor site between exons 2 and 3 ENST00000529216.1 not organism-supported ENST00000451091.2 alternative 5' UTR ENST00000531243.1 non-canonical splice acceptor site between exons 1 and 2 ENST00000531243.1 alternative 5' UTR ENST00000372844.3 DKFZp761G22 ENST00000327582.5 FLJ35770 ENST00000462797.1 non-canonical splice donor and acceptor sites between exons 2 and 3 ENST00000316891.5 FLJ20061 and FLJ23642 ENST00000316891.5 AT/AC splicing between exons two and three ENST00000372818.1 AT/AC splicing between exons two and three ENST00000492612.1 non-canonical splice donor and acceptor sites between exons 2 and 3 ENST00000486825.1 non-canonical splice donor and acceptor sites between exons 3 and 4 ENST00000489945.1 non-canonical splice donor and acceptor sites between exons 2 and 3 ENST00000469476.1 non-canonical splice donor and acceptor sites between exons 1 and 2 ENST00000462243.1 non-canonical splice donor and acceptor sites between exons 1 and 2 ENST00000372816.2 The methionine at the start of this CDS is well conserved across species. There is a methionine upstream (but no evidence to extend this transcript upstream) which is also well conserved across species ENST00000450953.3 alternative 5' UTR ENST00000372811.5 FLJ90702 and FLJ14997 ENST00000372809.5 FLJ35904 ENST00000483824.1 novel transcript DKFZp547G109 ENST00000469745.1 novel transcript ENST00000480630.1 novel transcript ENST00000491515.1 novel transcript ENST00000459917.1 novel transcript ENST00000481612.1 novel transcript ENST00000372797.3 alternative 5'UTR; shares CDS with RP11-115D7.1-002, RP11-115D7.1-003, RP11-115D7.1-007, RP11-115D7.1-008, RP11-115D7.1-010, RP11-115D7.1-011, RP11-115D7.1-012, RP11-115D7.1-016, RP11-115D7.1-017 and RP11-115D7.1-018 ENST00000372797.3 alternative 5' UTR ENST00000372802.1 alternative 5' UTR; shares CDs with RP11-115D7.1-005, RP11-115D7.1-006 and RP11-115D7.1-013 ENST00000372802.1 alternative 5' UTR ENST00000449311.1 alternative 5' UTR ENST00000449311.1 alternative 5'UTR; shares CDS with RP11-115D7.1-001, RP11-115D7.1-002, RP11-115D7.1-003, RP11-115D7.1-008, RP11-115D7.1-010, RP11-115D7.1-011, RP11-115D7.1-012, RP11-115D7.1-016, RP11-115D7.1-017 and RP11-115D7.1-018 ENST00000421589.1 alternative 5'UTR; shares CDS with RP11-115D7.1-001, RP11-115D7.1-002, RP11-115D7.1-003, RP11-115D7.1-007, RP11-115D7.1-010, RP11-115D7.1-011, RP11-115D7.1-012, RP11-115D7.1-016, RP11-115D7.1-017 and RP11-115D7.1-018 ENST00000421589.1 alternative 5' UTR ENST00000414281.1 alternative 5'UTR; shares CDS with RP11-115D7.1-001, RP11-115D7.1-002, RP11-115D7.1-003, RP11-115D7.1-007, RP11-115D7.1-008, RP11-115D7.1-010, RP11-115D7.1-012, RP11-115D7.1-016, RP11-115D7.1-017 and RP11-115D7.1-018 ENST00000414281.1 alternative 5' UTR ENST00000420216.1 alternative 5' UTR ENST00000420216.1 alternative 5'UTR; shares CDS with RP11-115D7.1-001, RP11-115D7.1-002, RP11-115D7.1-003, RP11-115D7.1-007, RP11-115D7.1-008, RP11-115D7.1-010, RP11-115D7.1-011, RP11-115D7.1-016, RP11-115D7.1-017 and RP11-115D7.1-018 ENST00000372792.2 alternative 5'UTR; shares CDS with RP11-115D7.1-001, RP11-115D7.1-002, RP11-115D7.1-007, RP11-115D7.1-008, RP11-115D7.1-010, RP11-115D7.1-011, RP11-115D7.1-012, RP11-115D7.1-016, RP11-115D7.1-017 and RP11-115D7.1-018 ENST00000372792.2 alternative 5' UTR ENST00000372798.1 alternative 5' UTR; shares CDs with RP11-115D7.1-004, RP11-115D7.1-005 and RP11-115D7.1-013 ENST00000372798.1 alternative 5' UTR ENST00000340450.3 alternative 5' UTR; shares CDs with RP11-115D7.1-004, RP11-115D7.1-006, and RP11-115D7.1-013 ENST00000340450.3 alternative 5' UTR ENST00000372805.3 alternative 5'UTR; shares CDS with RP11-115D7.1-001, RP11-115D7.1-003, RP11-115D7.1-007, RP11-115D7.1-008, RP11-115D7.1-010, RP11-115D7.1-011, RP11-115D7.1-012, RP11-115D7.1-016, RP11-115D7.1-017 and RP11-115D7.1-018 ENST00000372805.3 alternative 5' UTR ENST00000435719.1 alternative 5' UTR; shares CDs with RP11-115D7.1-004, RP11-115D7.1-005, and RP11-115D7.1-006 ENST00000435719.1 alternative 5' UTR ENST00000427843.1 alternative 5'UTR; shares CDS with RP11-115D7.1-001, RP11-115D7.1-002, RP11-115D7.1-003, RP11-115D7.1-007, RP11-115D7.1-008, RP11-115D7.1-010, RP11-115D7.1-011, RP11-115D7.1-012, RP11-115D7.1-016 and RP11-115D7.1-017 ENST00000427843.1 alternative 5' UTR ENST00000417287.1 alternative 5'UTR; shares CDS with RP11-115D7.1-001, RP11-115D7.1-002, RP11-115D7.1-003, RP11-115D7.1-007, RP11-115D7.1-008, RP11-115D7.1-011, RP11-115D7.1-012, RP11-115D7.1-016, RP11-115D7.1-017 and RP11-115D7.1-018 ENST00000417287.1 alternative 5' UTR ENST00000424977.1 alternative 5'UTR; shares CDS with RP11-115D7.1-001, RP11-115D7.1-002, RP11-115D7.1-003, RP11-115D7.1-007, RP11-115D7.1-008, RP11-115D7.1-010, RP11-115D7.1-011, RP11-115D7.1-012, RP11-115D7.1-016 and RP11-115D7.1-018 ENST00000424977.1 alternative 5' UTR ENST00000446031.1 alternative 5' UTR ENST00000446031.1 alternative 5'UTR; shares CDS with RP11-115D7.1-001, RP11-115D7.1-002, RP11-115D7.1-003, RP11-115D7.1-007, RP11-115D7.1-008, RP11-115D7.1-010, RP11-115D7.1-011, RP11-115D7.1-012, RP11-115D7.1-017 and RP11-115D7.1-018 ENST00000479759.1 novel transcript ENST00000461993.1 novel transcript ENST00000494114.1 novel transcript ENST00000449045.2 NP_001136076.1 ENST00000527107.1 non-canonical acceptor splice site between exons 1 and 2 ENST00000487606.1 novel transcript ENST00000468258.1 novel transcript ENST00000469416.1 novel transcript ENST00000484445.1 novel transcript ENST00000372706.1 alternative 5' UTR; shares CDS with RP11-656D10.2-002 ENST00000372706.1 alternative 5' UTR ENST00000372705.3 FLJ16030 ENST00000372705.3 alternative 5' UTR; shares CDS with RP11-656D10.2-001 ENST00000372705.3 alternative 5' UTR ENST00000482712.1 novel transcript ENST00000358527.2 alternative 5' UTR; shares CDS with RP11-656D10.4-001,RP11-656D10.4-002, RP11-656D10.4-004, RP11-656D10.4-005, RP11-656D10.4-006, RP11-656D10.4-007, RP11-656D10.4-008 and RP11-656D10.4-009 ENST00000358527.2 alternative 5' UTR ENST00000372703.1 alternative 5' UTR; shares CDS with RP11-656D10.4-001,RP11-656D10.4-003, RP11-656D10.4-004, RP11-656D10.4-005, RP11-656D10.4-006, RP11-656D10.4-007, RP11-656D10.4-008 and RP11-656D10.4-009 ENST00000372703.1 alternative 5' UTR ENST00000420209.1 alternative 5' UTR; shares CDS with RP11-656D10.4-001,RP11-656D10.4-002, RP11-656D10.4-003, RP11-656D10.4-005, RP11-656D10.4-006, RP11-656D10.4-007, RP11-656D10.4-008 and RP11-656D10.4-009 ENST00000420209.1 alternative 5' UTR ENST00000296380.4 FLJ21144 ENST00000296380.4 alternative 5' UTR ENST00000296380.4 alternative 5' UTR; shares CDS with RP11-656D10.4-002,RP11-656D10.4-003, RP11-656D10.4-004, RP11-656D10.4-005, RP11-656D10.4-006, RP11-656D10.4-007, RP11-656D10.4-008 and RP11-656D10.4-009 ENST00000432259.1 alternative 5' UTR; shares CDS with RP11-656D10.4-001,RP11-656D10.4-002, RP11-656D10.4-003, RP11-656D10.4-004, RP11-656D10.4-006, RP11-656D10.4-007, RP11-656D10.4-008 and RP11-656D10.4-009 ENST00000432259.1 alternative 5' UTR ENST00000418186.1 alternative 5' UTR; shares CDS with RP11-656D10.4-001,RP11-656D10.4-002, RP11-656D10.4-003, RP11-656D10.4-004, RP11-656D10.4-005, RP11-656D10.4-007, RP11-656D10.4-008 and RP11-656D10.4-009 ENST00000418186.1 alternative 5' UTR ENST00000415550.1 alternative 5' UTR; shares CDS with RP11-656D10.4-001,RP11-656D10.4-002, RP11-656D10.4-003, RP11-656D10.4-004, RP11-656D10.4-005, RP11-656D10.4-006, RP11-656D10.4-008 and RP11-656D10.4-009 ENST00000415550.1 alternative 5' UTR ENST00000443729.1 alternative 5' UTR; shares CDS with RP11-656D10.4-001,RP11-656D10.4-002, RP11-656D10.4-003, RP11-656D10.4-004, RP11-656D10.4-005, RP11-656D10.4-006, RP11-656D10.4-007 and RP11-656D10.4-009 ENST00000443729.1 alternative 5' UTR ENST00000419161.1 alternative 5' UTR; shares CDS with RP11-656D10.4-001,RP11-656D10.4-002, RP11-656D10.4-003, RP11-656D10.4-004, RP11-656D10.4-005, RP11-656D10.4-006, RP11-656D10.4-007 and RP11-656D10.4-008 ENST00000419161.1 alternative 5' UTR ENST00000471429.1 novel transcript ENST00000372699.3 FLJ36753 ENST00000465152.1 novel transcript ENST00000493756.1 novel transcript ENST00000472043.1 novel transcript ENST00000372684.3 alternative 5' UTR; shares CDS with RP4-739H11.2-002 ENST00000372684.3 alternative 5' UTR ENST00000372683.1 alternative 5' UTR; shares CDS with RP4-739H11.2-001 ENST00000372683.1 alternative 5' UTR ENST00000427410.2 NP_001136061.1 ENST00000425457.2 NP_001136060.1 ENST00000453631.1 alternative 5' UTR ENST00000456393.2 NP_001136059.1 ENST00000372654.1 alternative 5' UTR ENST00000534399.1 alternative 5' UTR ENST00000372653.1 NP_001136062.1 ENST00000372651.1 alternative 5' UTR ENST00000372651.1 not organism-supported ENST00000531464.1 alternative 5' UTR ENST00000440226.2 alternative 5' UTR ENST00000530965.1 not organism-supported ENST00000416859.2 not organism-supported ENST00000414185.1 non-canonical donor splice site between exons 4 & 5 ENST00000372616.1 FLJ27039 ENST00000372616.1 alternative 5' UTR ENST00000372616.1 alternatively spliced 5' UTR, shares CDS with RP11-348A7.3-001 ENST00000372611.1 FLJ40290 ENST00000359345.1 alternatively spliced 5' UTR, shares CDS with RP11-348A7.4-001.\n\ ENST00000359345.1 alternative 5' UTR ENST00000337495.5 FLJ13062 ENST00000460604.1 FLJ16752\n\ ENST00000372573.1 KIAA1041 ENST00000372572.1 alternative 5' UTR ENST00000431473.2 MGC47816 ENST00000475426.1 novel transcript ENST00000461083.1 novel transcript ENST00000472013.1 novel transcript ENST00000471420.1 novel transcript ENST00000466871.1 novel transcript ENST00000482168.1 novel transcript ENST00000469615.1 novel transcript ENST00000475614.1 novel transcript ENST00000468651.1 novel transcript ENST00000492422.1 novel transcript ENST00000462063.1 novel transcript ENST00000445157.1 alternative 5' UTR ENST00000471699.1 novel transcript ENST00000454425.1 DC2 pseudogene ENST00000467957.1 novel transcript ENST00000296388.5 NP_071751.3 ENST00000372525.4 MGC955 ENST00000494155.1 novel transcript ENST00000372522.1 alternative 5' UTR ENST00000372521.4 LOC374969 ENST00000497437.1 novel transcript ENST00000487556.1 novel transcript ENST00000470938.1 novel transcript ENST00000372514.3 alternative 5' UTR ENST00000372508.3 LOC51058 ENST00000372507.1 alternative 5' UTR ENST00000372506.1 alternative 5' UTR ENST00000475162.1 novel transcript ENST00000460369.1 novel transcript ENST00000416689.1 LOC149464 ENST00000463906.1 this variant and one or more of variant fragments RP5-1034F7.2-005 through 008 could be part of a single variant. ENST00000491223.1 this variant and one of variant fragments RP5-1034F7.2-007 or 008 could be part of a single variant. ENST00000472982.1 this variant and one of variant fragments RP5-1034F7.2-007 or 008 could be part of a single variant. ENST00000483082.1 this variant and one or more of variant fragments RP5-1034F7.2-002, 007 and 008 could be part of a single variant. ENST00000461557.1 this variant and variant fragment RP5-1034F7.2-002 could be part of a single variant.\n\ ENST00000466927.1 this variant and one or more of variant fragments RP5-1034F7.2-002 through 004 and 006 could be part of a single variant. ENST00000474566.1 this variant and one or more of variant fragments RP5-1034F7.2-002 through 004 and 006 could be part of a single variant. ENST00000372492.4 not organism-supported ENST00000528956.1 FLJ32000 ENST00000529956.1 alternative 5' UTR ENST00000439858.1 MGC17299 ENST00000432792.2 alternative 5' UTR ENST00000442284.1 this variant and variant fragment RP11-282K6.4-004 could be part of a single variant. ENST00000456751.1 this variant and variant fragment RP11-282K6.4-004 could be part of a single variant ENST00000456751.1 alternative 5' UTR ENST00000423420.1 alternative 5' UTR ENST00000485125.1 this variant and one or more of variant fragments RP11-282K6.6-005 through 010 could be part of a single variant ENST00000480269.1 this variant and one or more of variant fragments RP11-282K6.6-004, 006 through 010 could be part of a single variant. ENST00000488437.1 this variant and one or more of variant fragments RP11-282K6.6-004, 005 and 007 through 010 could be part of a single variant. ENST00000471187.1 this variant and one or more of variant fragments RP11-282K6.6-004 through 006 and 009, 010 could be part of a single variant ENST00000461061.1 this variant and one or more of variant fragments RP11-282K6.6-004 through 006 and 009, 010 could be part of a single variant ENST00000492599.1 this variant and one or more of variant fragments RP11-282K6.6-004 through 008 and 010 could be part of a single variant. ENST00000492874.1 this variant and one or more of variant fragments RP11-282K6.6-004 through 009 could be part of a single variant. ENST00000372462.1 alternatively spliced 5' UTR, shares CDS with RP1-92O14.2-001 ENST00000372462.1 alternative 5' UTR ENST00000478882.1 this variant and variant fragment RP1-92O14.2-004 could be part of a single variant. ENST00000482046.1 this variant and variant fragment RP1-92O14.2-003 could be part of a single variant. ENST00000290663.6 NP_443109 ENST00000483618.1 novel transcript ENST00000496043.1 this variant and one or more of variant fragments RP5-1029K14.1-005 through 008, 011 and 012 could be part of a single variant. ENST00000481019.1 this variant and one or more of variant fragments RP5-1029K14.1-005 through 008, 011 and 012 could be part of a single variant. ENST00000467464.1 this variant and one or more of variant fragments RP5-1029K14.1-005 through 010 and 012 could be part of a single variant. ENST00000412568.2 not organism-supported ENST00000414879.1 FLJ43335 ENST00000496447.1 this variant and one or more of variant fragments RP5-1029K14.1-009 through 011 could be part of a single variant. ENST00000372407.4 FLJ45062 ENST00000463041.1 this variant and one or more of variant fragments RP5-1029K14.1-007 and 009 through 011 could be part of a single variant. ENST00000477970.1 this variant and one or more of variant fragments RP5-1029K14.1-007 through 012 could be part of a single variant. ENST00000477970.1 FLJ45567 ENST00000477048.1 alternative 5' UTR ENST00000471394.2 alternative 5' UTR ENST00000491846.1 alternative 5' UTR ENST00000474592.1 alternative 5' UTR ENST00000372354.3 alternative 5' UTR ENST00000372339.3 FLJ34246 ENST00000471934.1 NMD candidate ENST00000495421.1 FLJ33984 ENST00000396758.2 NP_001034678.1 ENST00000532140.1 not organism-supported ENST00000527319.1 not organism-supported ENST00000472505.2 alternative 5' UTR ENST00000236067.4 NP_001034546.1 ENST00000498664.1 alternative 5' UTR ENST00000486064.1 novel transcript (FLJ35250) ENST00000372318.3 MGC45441 ENST00000463846.1 novel transcript ENST00000490563.1 novel transcript ENST00000490064.1 novel transcript ENST00000486504.1 novel transcript ENST00000485811.1 novel transcript ENST00000466180.1 novel transcript ENST00000479055.1 novel transcript ENST00000472562.1 novel transcript ENST00000360584.2 NP_008865.2 ENST00000528803.1 alternative 5' UTR ENST00000447959.1 novel transcript ENST00000372299.3 FLJ40160 ENST00000476802.1 novel transcript ENST00000361745.6 FLJ11543 and DKFZp564C0464 ENST00000361745.6 non-canonical splice donor site between exons 3 and 4 ENST00000315913.5 KIAA1425 ENST00000488433.1 FLJ35579, DKFZp686L09142, FLJ38933, FLJ30392 ENST00000355387.2 non-canonical splice donor site between exons 10 and 11 ENST00000355387.2 FLJ31862, FLJ22091, FLJ10597 ENST00000361799.2 alternative 5' UTR ENST00000487332.1 novel transcript ENST00000470498.1 novel transcript ENST00000496262.1 novel transcript ENST00000474064.1 novel transcript FLJ10597 ENST00000471494.1 novel transcript ENST00000488865.1 novel transcript ENST00000497469.1 novel transcript ENST00000475378.1 novel transcript ENST00000484745.1 novel transcript ENST00000474394.1 novel transcript ENST00000480686.1 novel transcript FLJ42800 ENST00000474956.1 novel transcript FLJ42648 ENST00000495630.1 novel transcript ENST00000372237.3 FLJ22353 ENST00000476724.1 novel transcript DKFZp547P2316 ENST00000468117.1 novel transcript ENST00000418644.1 alternative 5' UTR ENST00000441519.1 alternative 5' UTR ENST00000445071.1 alternative 5' UTR ENST00000453711.1 alternative 5' UTR ENST00000485668.1 FLJ31588 ENST00000372183.3 DKFZp667G0511 ENST00000372172.4 FLJ31983 ENST00000372168.3 FLJ32311 ENST00000486132.1 novel transcript FLJ34264 ENST00000486296.1 novel transcript ENST00000466423.1 novel transcript ENST00000487488.1 novel transcript ENST00000484564.1 novel transcript ENST00000494399.1 DKFZp686O11196 ENST00000359600.5 KIAA1511 ENST00000529984.1 alternative 5' UTR ENST00000456914.2 alternative 5' UTR ENST00000355498.2 alternative 5' UTR ENST00000529892.1 not organism-supported ENST00000435155.1 alternative 5' UTR ENST00000525160.1 not organism-supported ENST00000474382.1 putative novel transcript ENST00000447184.1 variant 2; alternatively spliced in 5' UTR ENST00000351829.4 variant 2; alternatively spliced in 5' UTR ENST00000437901.2 alternative 5' UTR ENST00000372052.4 not organism-supported ENST00000479235.1 novel transcript FLJ23559 ENST00000290795.3 DKFZp434H1428, FLJ21319 ENST00000487436.1 novel transcript ENST00000498128.1 novel transcript ENST00000496278.1 novel transcript ENST00000495616.1 novel transcript ENST00000488278.1 novel transcript ENST00000480941.1 novel transcript ENST00000480083.1 novel transcript ENST00000493083.1 novel transcript ENST00000460859.1 novel transcript ENST00000372025.4 FLJ21029 ENST00000496366.1 novel transcript ENST00000470809.1 novel transcript ENST00000468212.1 contains non-canonical splice sites ENST00000468212.1 novel transcript ENST00000498364.1 contains non-canonical splice sites ENST00000498364.1 novel transcript ENST00000372008.1 novel protein ENST00000372008.1 contains non canonical splice site ENST00000482881.1 novel transcript ENST00000488619.1 putative novel transcript ENST00000489579.1 contains a non-canonical splice site ENST00000489579.1 novel transcript ENST00000498443.1 novel transcript ENST00000482928.1 novel transcript ENST00000469330.1 novel transcript ENST00000475163.1 novel transcript ENST00000486237.1 novel transcript ENST00000464786.1 novel transcript ENST00000482143.1 novel transcript ENST00000472170.1 novel transcript ENST00000470318.1 novel transcript ENST00000371984.3 FLJ20277 ENST00000371992.1 FLJ31624 ENST00000475642.1 novel transcript ENST00000480972.1 novel transcript ENST00000485714.1 novel transcript (FLJ30739) ENST00000463030.1 novel transcript ENST00000497439.1 novel transcript ENST00000489985.1 novel transcript (FLJ22777) ENST00000371980.3 FLJ25163 ENST00000496156.1 novel transcript ENST00000472710.1 novel transcript (FLJ43839) ENST00000498402.1 novel transcript (FLJ12989) ENST00000469150.1 novel transcript ENST00000486951.1 this variant and variant fragment RP4-603I14.1-004 could be part of a single variant. ENST00000460947.1 this variant and variant fragment RP4-603I14.1-003 could be part of a single variant. ENST00000474844.1 MGC22960 ENST00000474062.1 novel transcript ENST00000307089.3 novel transcript ENST00000486270.1 novel transcript ENST00000469918.1 novel transcript ENST00000471871.1 novel transcript (FLJ32858) ENST00000498008.1 novel transcript (FLJ46186) ENST00000495427.1 novel transcript (FLJ40205) ENST00000475281.1 novel transcript ENST00000468718.1 this variant and one or more of variant fragments RP4-603I14.2-002, 005 and 006 could be part of a single variant. ENST00000493735.1 this variant and variant fragment RP4-603I14.4-006 could be part of a single variant. ENST00000484697.1 this variant and variant fragment RP4-603I14.4-003 could be part of a single variant. ENST00000489366.1 this variant and one or more of variant fragments RP4-603I14.2-003 and 006 could be part of a single variant. ENST00000493636.1 this variant and one or more of variant fragments RP4-603I14.2-003, 004 and 005 could be part of a single variant. ENST00000429784.1 novel transcript ENST00000294445.3 FLJ32011 ENST00000524908.1 non-canonical donor splice site between exons 1 and 2 ENST00000396314.3 NP_001091080.1 ENST00000371949.1 small direct repeats around the intron exon boundaries between exons 9 and 10 suggest that they could be spliced together differently. As it stands there are only 3bp difference and everthing is kept in frame ENST00000496619.1 alternative 5' UTR ENST00000529170.1 alternative 5' UTR ENST00000531769.1 alternative 5' UTR ENST00000371940.1 FLJ00374 ENST00000477318.1 novel transcript ENST00000534216.1 not organism-supported ENST00000371933.3 KIAA0494 ENST00000479745.1 novel transcript ENST00000481623.1 novel transcript ENST00000459797.1 novel transcript ENST00000484461.1 novel transcript ENST00000271153.4 NP_000770.2 ENST00000466294.1 novel transcript ENST00000471598.1 novel transcript ENST00000444042.2 non canonical TEC ENST00000371891.3 LOC284541 ENST00000491793.1 novel transcript ENST00000371885.1 alternative 5' UTR ENST00000294339.3 alternative 5' UTR ENST00000459729.1 novel transcript ENST00000464796.1 novel transcript ENST00000481091.1 novel transcript ENST00000465912.1 novel transcript ENST00000445551.1 MGC12982 ENST00000236495.5 LOC200010 ENST00000236495.5 NP_001128653.1 ENST00000371839.1 FLJ37507 ENST00000416121.1 FLJ14442 ENST00000497451.1 novel transcript ENST00000371833.3 FLJ11588 ENST00000463562.1 novel transcript ENST00000476096.1 novel transcript ENST00000480399.1 novel transcript ENST00000404795.3 alternative 5' UTR ENST00000371780.1 non-canonical donor splice site at exon seven ENST00000371759.2 FLJ27485 ENST00000467127.1 non canonical TEC ENST00000467127.1 novel transcript ENST00000474016.1 novel transcript ENST00000371750.5 NP_001073963.1 ENST00000525906.1 alternative 5' UTR ENST00000525906.1 not organism-supported ENST00000453295.1 NP_683704.2 ENST00000532975.1 alternative 5' UTR ENST00000527631.1 alternative 5' UTR ENST00000531828.1 NP_683704.1 ENST00000531828.1 confirm experimentally ENST00000481937.1 alternative 5' UTR ENST00000486942.1 alternative 5' UTR ENST00000469458.1 novel transcript ENST00000472624.1 novel transcript ENST00000472944.2 NP_001129969.1 ENST00000470844.1 novel transcript ENST00000371586.2 KIAA1836 ENST00000491136.1 novel transcript ENST00000460727.1 novel transcript (FLJ27364) ENST00000460261.1 novel transcript ENST00000460370.1 novel transcript ENST00000492426.1 novel transcript ENST00000485966.1 novel transcript ENST00000494789.1 novel transcript ENST00000257181.8 FLJ34719 ENST00000487160.1 novel transcript ENST00000474048.1 novel transcript ENST00000257177.4 NP_001009881.1 ENST00000469810.1 novel transcript ENST00000470626.1 alternative 5' UTR ENST00000524582.1 alternative 5' UTR ENST00000459779.1 novel transcript ENST00000440303.1 FLJ46370 ENST00000401050.3 MGC52498 ENST00000371538.3 FLJ12439 ENST00000294353.6 FLJ13456 ENST00000358358.5 FLJ10948 ENST00000476477.2 alternative 5' UTR ENST00000479593.1 novel transcript ENST00000487866.1 novel transcript ENST00000487851.1 novel transcript ENST00000488268.1 novel transcript ENST00000544365.1 alternative 5' UTR ENST00000495920.1 novel transcript ENST00000492992.1 novel transcript ENST00000493896.2 novel transcript ENST00000371513.5 NP_001007099.1 ENST00000528809.1 not organism-supported ENST00000529363.1 not organism-supported ENST00000533119.1 not organism-supported ENST00000471210.1 this variant and one of variant fragments RP11-334A14.4-003 or 004 could be part of a single variant. ENST00000471285.1 this variant variant fragment RP11-334A14.4-002 could be part of a single variant. ENST00000490650.1 this variant variant fragment RP11-334A14.4-002 could be part of a single variant. ENST00000294360.4 FLJ20580 ENST00000483739.1 novel transcript (FLJ35415) ENST00000470385.1 novel transcript ENST00000478839.1 novel transcript (FLJ37052) ENST00000489755.1 novel transcript ENST00000465675.1 FLJ39163 ENST00000480045.1 not organism-supported ENST00000347547.2 NP_150643.2 ENST00000459674.1 FLJ16536 ENST00000371370.3 Alternatively spliced 5' UTR, shares CDS with RP1-167A19.4-001. ENST00000371370.3 alternative 5' UTR ENST00000371368.1 Alternatively spliced 5' UTR, shares CDS with RP1-167A19.4-001 (partial). ENST00000371368.1 alternative 5' UTR ENST00000444987.1 Alternatively spliced 5' UTR, shares CDS with RP1-167A19.4-001 (partial). ENST00000444987.1 alternative 5' UTR ENST00000311841.7 subject to nonsense-mediated decay ENST00000534324.1 NP_001026842.2 ENST00000534324.1 not organism-supported ENST00000490670.1 novel transcript ENST00000398219.2 novel transcript ENST00000417664.2 not organism-supported ENST00000361350.4 MSTP128 ENST00000481208.1 novel transcript ENST00000498228.1 novel transcript ENST00000343744.2 isoform BFIT2 ENST00000371316.3 isoform BFIT1 ENST00000479837.1 novel transcript ENST00000492752.1 novel transcript ENST00000302250.2 MGC27169 ENST00000478097.1 novel transcript ENST00000421030.2 NP_001034553.2 ENST00000486091.1 novel transcript ENST00000371279.3 DKFZp727A071 ENST00000371276.4 not organism-supported ENST00000371274.4 FLJ20619 ENST00000358193.3 FLJ40201 ENST00000436604.1 alternative 3' UTR ENST00000371268.3 LOC199964 ENST00000493000.1 novel transcript ENST00000497991.1 novel transcript ENST00000484327.1 novel transcript ENST00000371240.3 novel transcript ENST00000441502.1 contains a non-canonical splice site ENST00000493821.1 KIAA1915 ENST00000493821.1 novel transcript ENST00000401044.3 novel transcript ENST00000481973.1 putative novel tranascript ENST00000466774.1 novel transcript ENST00000483003.1 novel transcript ENST00000489282.1 novel transcript ENST00000419531.1 contains a non-canonical splice site ENST00000427292.1 putative novel transcript ENST00000413489.1 alternative 5' UTR ENST00000474476.1 novel transcript ENST00000462744.1 novel transcript ENST00000495718.1 novel transcript ENST00000303721.7 FLJ10986 ENST00000475949.1 novel transcript ENST00000485720.1 novel transcript ENST00000493891.1 novel transcript ENST00000466791.1 novel transcript ENST00000472783.1 novel transcript ENST00000471169.1 novel transcript ENST00000480847.1 novel transcript ENST00000486478.1 novel transcript ENST00000371201.3 MGC34837 ENST00000488027.1 novel transcript ENST00000491817.1 novel transcript ENST00000482020.1 novel transcript ENST00000371180.1 non canonical donor splice site at first exon and non-canonical acceptor splice site at second exon. ENST00000371177.1 non canonical donor splice site at first exon and non-canonical acceptor splice site at second exon. ENST00000484937.1 non-canonical acceptor splice site in final 3' UTR exon. Annotated due to presence in cDNA and est sequences ENST00000452143.1 Alternaitively spliced 5' UTR, shares CDS with RP4-740B20.1-001 (partial) ENST00000452143.1 alternative 5' UTR ENST00000442679.1 Alternaitively spliced 5' UTR, shares CDS with RP4-740B20.1-001 (partial) ENST00000442679.1 alternative 5' UTR ENST00000371108.4 exon 8 has a 5' non-canonical splice site at which is conserved in the mouse gene ENST00000480886.1 novel transcript ENST00000371088.4 KIAA1799 ENST00000493605.1 novel transcript ENST00000496956.1 novel transcript ENST00000460678.1 novel transcript ENST00000461039.1 novel transcript ENST00000340052.3 alternatively spliced 5' UTR, shares CDS with RP4-534K7.3-001 ENST00000340052.3 alternative 5' UTR ENST00000424995.1 FLJ38972 ENST00000371076.3 MGC35130 ENST00000464349.1 novel transcript ENST00000290039.5 KIAA1573 ENST00000495994.1 novel transcript ENST00000470527.1 novel transcript ENST00000371072.4 KIAA1579 ENST00000327299.7 AK4 ENST00000463018.1 this variant and one or more of variant fragments RP4-630A11.1-006 and 007 could be part of a single variant ENST00000483402.1 this variant and one or more of variant fragments RP4-630A11.1-006 and 007 could be part of a single variant ENST00000472787.1 this variant and one or more of variant fragments RP4-630A11.1-004, 005 and 007 could be part of a single variant ENST00000498720.1 this variant and one or more of variant fragments RP4-630A11.1-004 through 006 could be part of a single variant ENST00000475108.1 novel transcript ENST00000497874.1 novel transcript ENST00000488747.1 novel transcript ENST00000484243.1 novel transcript ENST00000341517.4 alternative 5' UTR ENST00000371045.5 NP_001032416.1 ENST00000493564.1 novel transcript ENST00000468286.1 novel transcript ENST00000497055.1 novel transcript ENST00000371037.3 DKFZp761D221 ENST00000484988.1 novel transcript ENST00000480548.1 novel transcript ENST00000487507.1 novel transcript ENST00000320161.10 novel transcript ENST00000468570.1 novel transcript ENST00000282670.2 FLJ40873 ENST00000371023.3 NP_996897.1 ENST00000357692.2 The cDNAs EM:AY124192.1, Em:AY124189.1 and Em:AF515448.1 contain an extra t at position 72 and an extra c at position 312 compared to the genomic sequence. The translation is therefore different to that published in these cDNA entries ENST00000401041.1 This cDNA (Em:AY124190.1) contains an extra t at position 72 compared to the genomic sequence. The translation is therefore different to that published in Em:AY124190.1 as it has an N-terminal extension of 54 amino acids ENST00000371016.1 This cDNA sequence (Em:AY124186.1) contains an extra t at base 72 and an extra c at base 312 compared to the genomic sequence. The translation is therefore different to that published in Em:AY124186.1 ENST00000371014.1 This cDNA (EM:AY124187.1) contains an extra t at position 72 compared to the genomic sequence. The translation is therefore different to that published in Em:AY124187.1 as it has an N-terminal extension of 54 amino acids ENST00000425614.1 novel protein ENST00000473881.1 novel transcript ENST00000493607.1 novel transcript ENST00000462814.1 novel transcript ENST00000484880.1 novel transcript ENST00000490406.1 novel transcript ENST00000413628.1 FLJ38762 ENST00000420587.1 FLJ42034 ENST00000491811.1 novel transcript ENST00000497187.1 novel transcript ENST00000370973.2 alternative 5' UTR ENST00000456315.2 FLJ20354 ENST00000525124.1 FLJ20483 ENST00000310961.4 KIAA1365 ENST00000370958.1 KIAA1365 ENST00000035383.5 KIAA1365 ENST00000370952.3 FLJ20331 ENST00000370944.4 DKFZP566D1346 ENST00000262346.6 DKFZP566D1346 ENST00000490846.1 novel transcript ENST00000498735.1 novel transcript ENST00000361764.4 NP_001031723.1 ENST00000359875.5 NP_001031722.1 ENST00000370940.5 NP_001026863.1 ENST00000531950.1 alternative 3' UTR ENST00000464926.1 this variant and variant fragment RP11-42O15.1-004 could be part of a single variant. ENST00000482383.1 this variant and variant fragment RP11-42O15.1-003 could be part of a single variant. ENST00000370920.3 Additional nucleotide causes a frame-shift in comparison to Sw:O95218 ENST00000254821.6 Additional nucleotide causes a frame-shift in comparison to Sw:O95218 ENST00000557284.1 NP_001106279.1 ENST00000370870.1 Alternatively spliced 5' UTR, shares CDS with RP11-17E13.1-001 (partial) ENST00000370870.1 alternative 5' UTR ENST00000441120.1 Alternatively spliced 5' UTR, shares CDS with RP11-17E13.1-001 (partial) ENST00000441120.1 alternative 5' UTR ENST00000532509.1 not organism-supported ENST00000530953.1 not organism-supported ENST00000318803.6 FLJ38439 ENST00000478407.1 alternative 5' UTR ENST00000524536.1 alternative 5' UTR ENST00000530709.1 alternative 5' UTR ENST00000524778.1 alternative 5' UTR ENST00000370791.3 FLJ35093 ENST00000476203.1 contains a non-canonical splice site ENST00000421331.1 FLJ90637 ENST00000489495.1 DKFZp779L1713 ENST00000426517.1 alternative 5' UTR ENST00000476882.1 novel transcript ENST00000370759.3 FLJ20075 ENST00000436742.1 FLJ34438 ENST00000370758.1 alternative 5' UTR ENST00000452835.1 alternative 5' UTR ENST00000370751.4 NP_006811 ENST00000476876.1 novel transcript ENST00000486882.1 DKFZp451O2417 ENST00000462041.1 novel transcript ENST00000370742.3 FLJ26255 ENST00000370728.1 KIAA0786 ENST00000469377.1 FLJ41428 ENST00000452901.1 contains a non-canonical splice site ENST00000457273.1 FLJ40403 ENST00000260505.8 FLJ44842 and FLJ23033 ENST00000477524.1 novel transcript ENST00000488014.1 novel transcript ENST00000472688.1 novel transcript FLJ46763 ENST00000480533.1 nove transcript ENST00000472937.1 novel transcript ENST00000485638.1 FLJ36855 ENST00000464289.1 novel transcript ENST00000482783.1 novel transcript ENST00000467670.1 novel transcript ENST00000370685.3 DKFZp686K18247 ENST00000370680.1 DKFZp686G17199 ENST00000394839.2 FLJ34101 ENST00000394834.3 alternative 5' UTR ENST00000370669.1 alternative 5' UTR ENST00000370668.3 orthologue to mouse OTTMUSP00000045746 ENST00000370670.2 alternative 5' UTR ENST00000476905.1 Non-canonical donor splice site at exon 13. ENST00000422026.1 Alternatively spliced 5' UTR, shares CDS with RP11-484D4.2-001 (partial) ENST00000422026.1 alternative 5' UTR ENST00000370596.1 alternative 5' UTR ENST00000464801.1 not organism-supported ENST00000341460.5 NP_115560.1 ENST00000271015.3 Non-canonical donor splice site at 1st exon and non-canonical acceptor splice site at 2nd exon (in 5' UTR) ENST00000474200.1 contains non-canonical splice site ENST00000370574.3 FLJ20729 ENST00000370571.2 NP_690850 ENST00000496682.2 alternative 5' UTR ENST00000496682.2 not organism-supported ENST00000459999.1 not organism-supported ENST00000359242.3 KIAA1229 ENST00000460698.2 not organism-supported ENST00000294678.2 KIAA1229 ENST00000476054.1 novel transcript ENST00000473792.2 novel transcript ENST00000472144.1 novel transcript ENST00000463933.1 novel transcript ENST00000496592.1 novel transcript ENST00000488879.2 novel transcript ENST00000479890.1 novel transcript ENST00000486557.1 novel transcript ENST00000472368.1 novel transcript ENST00000480440.1 novel transcript ENST00000394733.2 alternative 5' UTR ENST00000465959.1 alternative 5' UTR ENST00000465959.1 novel transcript ENST00000478286.2 alternative 5' UTR ENST00000490884.1 this variant and variant fragment RP11-444C12.2-003 could be part of a single variant ENST00000498802.1 this variant and variant fragment RP11-444C12.2-002 could be part of a single variant ENST00000495894.1 FLJ39738 ENST00000284054.3 non-organism supported ENST00000370558.3 KIAA0491 ENST00000370548.1 FLJ11317 ENST00000461990.1 LOC339524 ENST00000484933.1 LOC339524 ENST00000467438.1 FLJ41676 ENST00000370542.1 alternatively spliced 5' UTR, shares CDS with RP4-544H6.1-001 ENST00000370542.1 alternative 5' UTR ENST00000458097.1 FLJ41840 ENST00000370491.3 NP_001008662.1 ENST00000446900.2 DKFZp686J0664 ENST00000370482.1 DKFZp564C2478 ENST00000370482.1 non-canonical splicing donor between exons 5 and 6 ENST00000489444.1 FLJ10961 ENST00000464839.1 DKFZp451C2311 ENST00000370466.3 alternative 5' UTR ENST00000463660.1 FLJ16497 ENST00000294671.2 FLJ38822 ENST00000355754.6 DKFZp451D0616 and FLJ00316 ENST00000481145.1 novel transcript ENST00000471171.1 novel transcript ENST00000490568.1 novel transcript ENST00000443807.1 alternative 5' UTR ENST00000370456.4 DKFZp686G0786 ENST00000464005.1 novel transcript ENST00000420280.1 novel transcript ENST00000525774.1 alternative 5' UTR ENST00000394593.3 alternative 5' UTR ENST00000532201.1 alternative 5' UTR ENST00000414841.1 alternative 5' UTR ENST00000527156.1 alternative 5' UTR ENST00000441269.2 alternative 5' UTR ENST00000361911.5 NP_892020 ENST00000462405.1 FLJ36760 ENST00000430465.1 DKFZp686L0198 ENST00000481900.1 FLJ39011 ENST00000455133.1 alternative 5' UTR ENST00000426137.1 Alternatively spliced 5' UTR, shares CDS with RP11-47K11.1-001 (partial) ENST00000426137.1 alternative 5' UTR ENST00000361447.2 novel pseudogene ENST00000525962.1 NP_003234.2 ENST00000417833.2 alternative 5' UTR ENST00000423434.1 alternative 5' UTR ENST00000440509.1 alternative 5' UTR ENST00000449584.1 alternative 5' UTR ENST00000427104.1 alternative 5' UTR ENST00000355011.3 alternative 5' UTR ENST00000448194.1 alternative 5' UTR ENST00000426141.1 alternative 5' UTR ENST00000450792.1 alternative 5' UTR ENST00000548992.1 alternative 5' UTR ENST00000552654.1 alternative 5' UTR ENST00000457265.1 alternative 5' UTR ENST00000402388.1 alternative 5' UTR ENST00000294702.5 Alternatively spliced 5' UTR, shares CDS with RP5-1014C4.1-001 ENST00000294702.5 alternative 5' UTR ENST00000401026.3 upstream ATG ENST00000370276.1 not organism-supported ENST00000479653.1 novel transcript ENST00000481180.1 novel transcript ENST00000421014.2 alternative 5' UTR ENST00000370267.1 alternative 5' UTR; shares CDS with RP4-713B5.1-001 ENST00000370267.1 alternative 5' UTR ENST00000370256.3 FLJ20275 ENST00000370244.1 alternatively spliced 5' UTR, shares CDS with RP5-1033H22.1-001 ENST00000370244.1 alternative 5' UTR ENST00000370243.1 FLJ30880 ENST00000370243.1 alternatively spliced 5' UTR, shares CDS with RP5-1033H22.1-001 ENST00000370243.1 alternative 5' UTR ENST00000462746.1 novel transcript ENST00000496535.2 novel transcript ENST00000546444.1 non-submitted evidence ENST00000482481.1 novel transcript ENST00000464165.1 FLJ44476 ENST00000413541.1 FLJ37203 ENST00000435559.1 FLJ20387 ENST00000271227.6 NP_001107578.1 ENST00000467909.1 NP_689582.2 ENST00000422520.2 alternative 5' UTR ENST00000475883.1 novel transcript ENST00000452846.1 contains a non-canonical splice site ENST00000370205.4 MGC19780 ENST00000495856.1 novel transcript ENST00000507727.1 novel transcript ENST00000370203.4 FLJ31842 ENST00000463375.1 novel transcript ENST00000435311.1 FLJ31487 ENST00000529992.1 NP_689424.2 ENST00000306121.3 NP_057060.2 ENST00000306121.3 isoform a ENST00000454199.1 alternative 5' UTR ENST00000425113.1 FLJ38225 ENST00000370185.3 DKFZp761A0623 ENST00000370184.1 KIAA0455 ENST00000263174.4 FLJ20271 ENST00000496843.1 DKFZp686P04226 ENST00000370165.3 alternative 5' UTR ENST00000370163.3 alternative 5' UTR ENST00000294724.4 alternative 5' UTR ENST00000427993.2 alternative 5' UTR ENST00000532693.1 alternative 5' UTR ENST00000422078.1 alternative 5' UTR ENST00000370156.3 FLJ21336 ENST00000287482.5 DKFZp761A078 ENST00000370141.2 FLJ10287 ENST00000493651.1 novel transcript ENST00000483474.1 novel transcript ENST00000455467.1 alternative start ENST00000361544.6 isoform 2 ENST00000370124.3 isoform 3 ENST00000336454.3 isoform 1 ENST00000469387.1 novel transcript ENST00000347652.2 isoform 2 ENST00000294728.2 isoform 1 ENST00000370113.3 alternative 5' UTR ENST00000494907.1 novel transcript ENST00000480774.1 novel transcript ENST00000357650.4 alternative 3' UTR ENST00000370105.3 novel transcript (FLJ43496) ENST00000492067.1 novel transcript ENST00000488789.1 novel transcript ENST00000481871.1 novel transcript ENST00000464270.1 novel transcript ENST00000466807.1 novel transcript ENST00000477293.1 novel transcript ENST00000498372.1 novel transcript ENST00000479661.1 novel transcript ENST00000488176.1 alternatively spliced 5' UTR, shares CDS with RP11-421L21.1-001 ENST00000488176.1 alternative 5' UTR ENST00000490732.1 novel transcript ENST00000476507.1 novel transcript ENST00000451213.1 FLJ11489 ENST00000440278.1 possibly a expressed pseudogene based on cDNA: Em:AF395440 ENST00000531883.1 alternative 5' UTR ENST00000531127.1 alternative 3' UTR ENST00000435302.1 alternative 5' UTR ENST00000453959.1 alternative 5' UTR ENST00000462971.1 novel transcript ENST00000481821.1 novel transcript ENST00000461518.1 novel transcript ENST00000494409.1 novel transcript ENST00000498295.1 novel transcript ENST00000464691.1 novel transcript ENST00000429608.1 putative novel transcript ENST00000469325.1 FLJ40431 ENST00000264128.8 DKFZp586G0123 ENST00000487594.1 contains a non-canonical splice site ENST00000357046.4 Part of the neuroblastoma breakpoint family ENST00000483371.1 DKFZp686N01110 ENST00000370017.3 NP_001138409.1 ENST00000370017.3 not organism-supported ENST00000406462.1 NP_037428 ENST00000435987.1 alternative 5' UTR ENST00000435475.1 alternative 5' UTR ENST00000446797.1 alternative 5' UTR ENST00000400794.3 NP_001136022.1 ENST00000530772.1 alternative 5' UTR ENST00000528747.1 alternative 5' UTR ENST00000533147.1 alternative 5' UTR ENST00000531664.1 alternative 5' UTR ENST00000534476.1 alternative 5' UTR ENST00000526264.1 alternative 5' UTR ENST00000491918.1 Non-canonical acceptor splice site at 3rd exon. ENST00000409267.1 alternative 5' UTR ENST00000369903.2 alternative 5' UTR ENST00000429031.1 alternative 5' UTR ENST00000418914.1 alternative 5' UTR ENST00000475497.1 novel transcript ENST00000463678.1 novel transcript ENST00000369870.3 MGC46534 ENST00000497545.1 novel transcript (FLJ00381) ENST00000369869.1 MGC46534 ENST00000459635.1 novel transcript ENST00000496961.1 novel transcript (FLJ44753) ENST00000463113.1 non-canonical splice sites between exons 2 and 3 ENST00000420578.2 FLJ39035 ENST00000528785.1 not organism-supported ENST00000430195.2 FLJ45666 ENST00000369864.4 amphoterin-induced gene (KIAA1161) (AMIGO) ENST00000369862.1 alternatively spliced 5' UTR, shares CDS with RP5-831G13.4-001 ENST00000369862.1 alternative 5' UTR ENST00000404129.2 not organism-supported ENST00000527748.1 not organism-supported ENST00000531734.1 alternative 5' UTR ENST00000469039.2 alternative 5' UTR ENST00000528667.1 alternative 5' UTR ENST00000369840.2 not organism-supported ENST00000464733.1 this variant and one of variant fragments AC000031.2-011 or 012 could be part of a single variant. ENST00000461767.1 this variant and one of variant fragments AC000031.2-011 or 012 could be part of a single variant. ENST00000369833.1 FLJ45317 ENST00000493171.1 this variant and one of variant fragments AC000031.2-005 or 006 could be part of a single variant. ENST00000493395.1 this variant and one of variant fragments AC000031.2-005 or 006 could be part of a single variant. ENST00000241337.3 NP_001135840.1 ENST00000490021.1 this variant and one or more of variant fragments AC000032.1-011 and 013 could be part of a single variant. ENST00000483399.1 this variant and one or more of variant fragments AC000032.1-011 and 013 could be part of a single variant. ENST00000489913.1 this variant and one or more of variant fragments AC000032.1-011 and 013 could be part of a single variant. ENST00000476065.1 this variant and variant fragment AC000032.1-011 could be part of a single variant. ENST00000490171.1 this variant and one or more of variant fragments AC000032.1-011 and 013 could be part of a single variant. ENST00000490983.1 this variant and variant fragment AC000032.1-011 could be part of a single variant. ENST00000495404.1 this variant and one or more of variant fragments AC000032.1-005 through 007 and 012 could be part of a single variant. ENST00000466619.1 this variant and one or more of variant fragments AC000032.1-005 through 007, 009, 010, 012 and 013 could be part of a single variant. ENST00000369813.1 FLJ43832 ENST00000492718.1 FLJ43832 ENST00000361852.4 FLJ21522 ENST00000498743.1 this variant and one or more of variant fragments RP4-735C1.3-006 through 010 could be part of a single variant. ENST00000489465.1 this variant and one or more of variant fragments RP4-735C1.3-008 through 010 could be part of a single variant. ENST00000475725.1 this variant and one or more of variant fragments RP4-735C1.3-004 and 007 through 010 could be part of a single variant. ENST00000482453.1 this variant and one or more of variant fragments RP4-735C1.3-004, 006, 008, 009 and 010 could be part of a single variant. ENST00000494151.1 this variant and one or more of variant fragments RP4-735C1.3-005 through 007 and 010 could be part of a single variant. ENST00000472325.1 this variant and one or more of variant fragments RP4-735C1.3-004 through 007 could be part of a single variant. ENST00000477568.1 this variant and one or more of variant fragments RP4-735C1.3-004 through 008 could be part of a single variant. ENST00000357302.4 alternative 5' UTR ENST00000369802.3 alternatively spliced 3' UTR, shares CDS with RP11-195M16.1-001 ENST00000369802.3 alternative 3' UTR ENST00000475081.1 this variant and variant fragment RP11-180N18.1-004 could be part of a single variant. ENST00000481423.1 this variant and variant fragment RP11-180N18.1-004 could be part of a single variant. ENST00000369796.1 FLJ14743 ENST00000369795.3 KIAA1761 ENST00000489059.1 novel transcript ENST00000485775.1 novel transcript ENST00000540970.1 novel transcript ENST00000535003.1 novel transcript ENST00000539541.1 novel transcript ENST00000461054.1 novel transcript ENST00000473429.1 novel transcript (FLJ43064, FLJ40704) ENST00000331565.3 LOC284462 ENST00000465159.1 novel transcript ENST00000413138.3 not organism-supported ENST00000438661.2 Q03721-3 ENST00000459877.1 DKFZp686F1444 ENST00000369779.4 FLJ26475 ENST00000474861.2 alternative 5' UTR ENST00000256644.4 NP_006393.2 ENST00000485317.1 not organism-supported ENST00000486033.1 unitary_pseudogene ENST00000440689.1 FLJ42178 ENST00000494675.1 alternative 5' UTR ENST00000286692.4 DKFZp313E1815 ENST00000484310.1 novel transcript ENST00000496430.1 novel transcript ENST00000477769.1 novel transcript ENST00000462092.1 novel transcript ENST00000490780.1 novel transcript ENST00000463682.1 novel transcript ENST00000467362.1 DKFZp313C168 ENST00000369752.5 FLJ22457 ENST00000473682.1 novel transcript ENST00000463713.1 novel transcript ENST00000477586.1 novel transcript ENST00000473822.1 novel transcript ENST00000488786.1 novel transcript ENST00000528451.1 alternative 5' UTR ENST00000528451.1 not organism-supported ENST00000486561.2 alternative 5' UTR ENST00000486561.2 not organism-supported ENST00000369744.2 NP_001020368.1 ENST00000466741.1 NP_001020370.1 ENST00000477185.2 alternative 5' UTR ENST00000497587.2 alternative 5' UTR ENST00000524472.1 alternative 3' UTR ENST00000533831.1 not organism-supported ENST00000477918.2 novel transcript ENST00000353665.6 alternative 5' UTR ENST00000489524.1 alternative 5' UTR ENST00000484512.1 novel transcript ENST00000468395.1 novel transcript ENST00000497278.1 novel transcript ENST00000459665.1 novel transcript ENST00000343534.5 MGC24133 ENST00000464591.1 novel transcript ENST00000414219.1 novel protein ENST00000443498.1 novel protein ENST00000472933.1 novel transcript ENST00000442484.1 novel protein ENST00000463993.1 novel transcript ENST00000496194.1 novel transcript ENST00000508462.1 novel transcript ENST00000369686.4 isoform WNT-2B1 ENST00000369684.4 isoform WNT-2B2 ENST00000478360.1 novel transcript ENST00000358039.4 isoform 1 ENST00000360743.4 isoform 3 ENST00000490715.1 isoform 5 ENST00000361846.3 isoform 5 ENST00000480988.1 novel transcript ENST00000495109.1 novel transcript ENST00000498197.1 novel transcript ENST00000477682.1 novel transcript ENST00000490067.1 isoform 2 ENST00000343210.7 isoform 4 ENST00000497457.1 novel transcript ENST00000463235.1 novel transcript ENST00000497235.1 novel transcript ENST00000466360.1 novel transcript ENST00000459630.1 novel transcript ENST00000470519.1 novel transcript ENST00000477332.1 novel transcript ENST00000473206.1 novel transcript ENST00000498383.1 novel transcript ENST00000470683.1 novel transcript ENST00000485753.1 novel transcript ENST00000467335.1 novel transcript ENST00000492274.1 novel transcript ENST00000476936.1 novel transcript ENST00000498626.1 novel transcript ENST00000466066.1 novel transcript ENST00000476820.1 novel transcript ENST00000486416.1 novel transcript ENST00000369645.1 alternative 5' UTR; shares CDS with RP11-426L16.2-001 and RP11-426L16.2-005 ENST00000369645.1 alternative 5' UTR ENST00000461226.1 novel transcript ENST00000496577.1 novel transcript ENST00000475429.1 novel transcript ENST00000468624.1 novel transcript ENST00000465579.1 novel transcript ENST00000357443.2 alternative 5' UTR; shares CDS with RP11-426L16.2-001 and RP11-426L16.2-006 ENST00000357443.2 alternative 5' UTR ENST00000479858.1 novel transcript ENST00000488160.1 novel transcript ENST00000482545.1 novel transcript ENST00000471160.1 novel transcript ENST00000481711.1 novel transcript ENST00000490413.1 novel transcript ENST00000495374.1 novel transcript ENST00000494319.1 novel transcript ENST00000369642.3 alternative 5' UTR ENST00000285735.2 alternative 5' UTR ENST00000369638.2 alternative 5' UTR ENST00000369637.1 alternative 5' UTR ENST00000369632.2 alternative 5' UTR ENST00000425265.2 alternative 5' UTR ENST00000534717.1 alternative 5' UTR ENST00000436685.2 alternative 5' UTR ENST00000414971.1 alternative 5' UTR ENST00000471038.2 novel transcript ENST00000309276.6 MGC19531 ENST00000464951.1 novel transcript ENST00000482367.1 novel transcript ENST00000486709.1 novel transcript ENST00000369626.3 alternative 5' UTR; shares CDS with RP4-580L15.1-002, RP4-580L15.1-003 and RP4-580L15.1-005 ENST00000369626.3 alternative 5' UTR ENST00000458229.1 alternative 5' UTR; shares CDS with RP4-580L15.1-001, RP4-580L15.1-003 and RP4-580L15.1-005 ENST00000458229.1 alternative 5' UTR ENST00000443580.1 alternative 5' UTR; shares CDS with RP4-580L15.1-001, RP4-580L15.1-002 and RP4-580L15.1-003 ENST00000443580.1 alternative 5' UTR ENST00000429288.1 alternative 5' UTR; shares CDS with RP4-580L15.1-001, RP4-580L15.1-002 and RP4-580L15.1-005 ENST00000429288.1 alternative 5' UTR ENST00000481750.1 novel transcript ENST00000478835.1 novel transcript ENST00000466069.1 novel transcript ENST00000470000.1 novel transcript ENST00000492207.1 novel transcript ENST00000466161.1 novel transcript ENST00000369617.4 NP_066016 ENST00000307546.9 FLJ22764 ENST00000369615.1 alternative 3' UTR ENST00000369615.1 NP_690864 ENST00000369615.1 KIAA1634 ENST00000369611.4 NP_690864 ENST00000474926.1 FLJ44821 ENST00000446739.1 alternative 5' UTR ENST00000419536.1 FLJ41205 ENST00000369567.1 FLJ36421 ENST00000369569.1 alternative 5' UTR ENST00000479285.1 FLJ10183 ENST00000462591.1 FLJ33005 ENST00000369571.2 alternative 5' UTR ENST00000369563.3 FLJ13998 and FLJ12810 ENST00000514621.1 alternative 5' UTR ENST00000503968.1 alternative 5' UTR ENST00000369547.1 alternatively spliced 5' UTR, shares CDS with RP5-1037B23.1-001 ENST00000369547.1 NMD exception ENST00000369547.1 alternative 5' UTR ENST00000483203.1 FLJ39425 ENST00000369546.1 FLJ31886 ENST00000369546.1 NMD exception ENST00000369545.2 non-organism supported ENST00000425037.1 alternative 5' UTR ENST00000447981.1 alternative 5' UTR ENST00000448034.1 FLJ13372 ENST00000393276.3 FLJ37099 ENST00000495031.1 novel transcript (FLJ42293) ENST00000481894.1 novel transcript ENST00000493549.1 novel transcript ENST00000520113.2 NP_000027.2 ENST00000369538.3 FLJ39758 ENST00000261443.5 alternative 5' UTR ENST00000483407.1 novel transcript ENST00000534699.1 alternative 5' UTR ENST00000529046.1 alternative 5' UTR ENST00000525132.1 alternative 5' UTR ENST00000534389.1 alternative 5' UTR ENST00000525878.1 alternative 5' UTR ENST00000525970.1 alternative 5' UTR ENST00000475335.1 novel transcript ENST00000466657.1 novel transcript ENST00000474562.1 novel transcript ENST00000369518.1 alternatively spliced 5' UTR, shares CDS with RP11-109G4.1-001 ENST00000369518.1 alternative 5' UTR ENST00000477215.1 this variant and one or more of variant fragments RP11-109G4.1-006 through 008 could be part of a single variant. ENST00000468191.1 this variant and one or more of variant fragments RP11-109G4.1-006 through 008 could be part of a single variant. ENST00000482717.1 this variant and one or more of variant fragments RP11-109G4.1-004, 005 and 008 could be part of a single variant. ENST00000493377.1 this variant and one or more of variant fragments RP11-109G4.1-004, 005 and 008 could be part of a single variant. ENST00000477590.1 this variant and one or more of variant fragments RP11-109G4.1-004 through 007 could be part of a single variant. ENST00000310260.3 alternative 5' UTR ENST00000478369.1 novel transcript ENST00000474344.1 novel transcript ENST00000460136.1 novel transcript ENST00000488931.1 novel transcript ENST00000369506.1 alternative 5' UTR ENST00000429731.1 alternative 5' UTR ENST00000481127.1 novel transcript ENST00000369500.3 FLJ38716 ENST00000464946.1 novel transcript ENST00000463382.1 novel transcript ENST00000491156.1 novel transcript ENST00000479960.1 novel transcript ENST00000495965.1 novel transcript ENST00000493908.1 novel transcript ENST00000369491.1 MGC16179 ENST00000430316.1 novel transcript ENST00000434879.1 novel transcript ENST00000457047.2 SW:P19256-3.1 ENST00000481589.1 novel transcript ENST00000393203.2 KIAA1436 ENST00000445523.1 FLJ42338 ENST00000464062.1 non-canonical splicing between exons 10 and 11 ENST00000427271.1 alternative 3' UTR ENST00000256649.4 FLJ13181 ENST00000497970.1 alternative 5' UTR ENST00000369458.3 FLJ22418 ENST00000359008.4 DKFZp779B1717 ENST00000356554.3 FLJ40810 and FLJ33521 ENST00000449370.1 FLJ11108 ENST00000369448.3 FLJ20202, FLJ24008 ENST00000466857.1 novel transcript ENST00000478697.1 novel transcript ENST00000336338.5 FLJ34497 ENST00000469128.1 novel transcript ENST00000492438.1 novel transcript ENST00000483383.1 novel transcript ENST00000470550.1 novel transcript ENST00000486589.1 novel transcript ENST00000477444.1 novel transcript ENST00000473472.1 novel transcript ENST00000463628.1 novel transcript ENST00000465053.1 novel transcript ENST00000457043.1 putative novel transcript ENST00000445565.1 putative novel transcript ENST00000531340.1 alternative 5' UTR ENST00000528909.1 alternative 5' UTR ENST00000496756.1 this variant and variant fragment RP4-683H9.1-003 could be part of a single variant. ENST00000462324.1 this variant and variant fragment RP4-683H9.1-003 could be part of a single variant. ENST00000369407.3 FLJ35987 ENST00000482968.1 FLJ26251 ENST00000482968.1 this variant and one of variant fragments RP4-683H9.1-004 or 005 could be part of a single variant. ENST00000354219.1 alternative 5' UTR ENST00000530654.1 not organism-supported ENST00000471903.1 novel transcript ENST00000480765.1 putative novel transcript ENST00000369390.3 MGC57827 ENST00000468129.1 novel transcript ENST00000458200.1 expressed pseudogene ENST00000446205.1 putative novel transcript ENST00000413650.1 putative novel transcript ENST00000426408.1 putative novel transcript ENST00000412092.1 putative novel transcript ENST00000400755.2 putative novel transcript ENST00000369381.2 FLJ00310 ENST00000369365.3 This structure is not based on a single mRNA but rather represents all the duplicated exons at this locus ENST00000313342.7 Due to the incompletness of the current assembly in this region it is possible that this is a fragment of a functional gene. ENST00000313382.9 KIAA0454 ENST00000530740.1 not organism-supported ENST00000369359.4 not organism-supported ENST00000479369.2 FLJ21253 ENST00000529945.1 not organism-supported ENST00000530078.1 not organism-supported ENST00000344859.3 FLJ90584 ENST00000479995.1 novel protein ENST00000468030.1 subject to nonsense-mediated decay ENST00000369339.1 because a two-exon unit in the latter half of the gene is repeated approximatedly 37 times on the genomic sequence and three or six times in the various mRNAs, there are numerous other genomic structures possible, all giving rise to virtually the same translation ENST00000464433.1 KIAA1245 ENST00000490598.1 KIAA1245 ENST00000465839.1 previous exons might be the same as in dJ646P11.1.1 ENST00000465839.1 KIAA1245 ENST00000421822.2 alternative 5' UTR ENST00000475797.1 alternative 5' UTR ENST00000369314.1 FLJ32422 ENST00000446572.2 FLJ34890 ENST00000323397.4 FLJ36963, FLJ46170 ENST00000369308.3 FLJ46901, FLJ41681 ENST00000355594.4 FL33801 ENST00000393046.2 novel protein ENST00000463514.1 novel transcript ENST00000484423.1 novel transcript ENST00000475261.1 FLJ43168 ENST00000444015.1 non-canonical splice donor site between exons 1 and 2 and donor and acceptor between exons 4 and 5 ENST00000467151.1 non-canonical splice sites between exons 1 and 2 ENST00000467151.1 FLJ34433 ENST00000498192.1 novel transcript ENST00000477878.1 novel transcript ENST00000460879.1 novel transcript ENST00000489436.1 novel transcript ENST00000479819.1 putative novel transcript ENST00000369290.1 FLJ46513 ENST00000493684.1 FLJ10492 ENST00000462900.2 alternative 5' UTR ENST00000478703.1 novel transcript ENST00000422044.2 non-canonical splice acceptor site between exons 3 and 4 ENST00000401011.2 FLJ44765 ENST00000479926.1 not best-in-genome evidence ENST00000496508.1 FLJ34369 ENST00000441068.2 NP_001138301.1 ENST00000369272.3 NP_001138302.1 ENST00000533174.1 alternative 5' UTR ENST00000533848.1 alternative 5' UTR ENST00000369258.4 FLJ22530 ENST00000416141.1 unitary_pseudogene ENST00000488165.1 FLJ11696 ENST00000478307.1 novel transcript ENST00000491975.1 novel transcript ENST00000461786.1 novel transcript ENST00000488603.1 FLJ10492 ENST00000488603.1 novel transcript ENST00000490955.1 novel transcript ENST00000401008.2 Possible transcribed PDZ domain containing 1 (PDZK1) pseudogene ENST00000425209.1 Transcribed pseudogene Em:AK126719.1 ENST00000381475.3 FLJ39739 ENST00000369202.1 Final six exons form part of a repeating six exon unit represented numerous times in the genomic sequence ENST00000369202.1 variant not based on a single mRNA but rather represents all possible exons at this locus ENST00000457216.1 putative novel transcript ENST00000439719.1 putative novel transcript ENST00000431573.1 contains a non-canonical splice site ENST00000492131.1 novel transcript ENST00000455295.1 putative novel transcript ENST00000453293.1 putative novel transcript ENST00000419105.1 putative novel transcript ENST00000439906.1 putative novel transcript ENST00000469483.1 potentialy coding ENST00000369135.3 There is a frame shift caused by an extra base (a) number 166 in sequence Em:AJ293573.1 which is missing in the genomic sequence. This results in a truncated N-terminal of the translated protein. ENST00000417191.1 No stop codon found. ENST00000369119.3 NP_001129951.1 ENST00000436748.2 NP_001129950.1 ENST00000369102.1 RP4-790G17.4-001 ENST00000447007.1 alternative 5' UTR ENST00000417398.1 alternative 5' UTR ENST00000290363.5 alternative 5' UTR ENST00000369084.5 alternative 5' UTR ENST00000369038.2 non-organism supported ENST00000361532.5 SW:O43768-5.1 ENST00000361631.5 SW:O43768-7.1 ENST00000339643.5 NP_996925.1 ENST00000339643.5 SW:O43768-3.1 ENST00000356527.5 SW:O43768-4.1 ENST00000513281.1 CCDS964.1 ENST00000513281.1 SW:O43768-6.1 ENST00000503345.1 alternative 3' UTR ENST00000503241.1 NP_996926.1 ENST00000362052.7 SW:O43768-8.1 ENST00000525956.1 alternative 5' UTR ENST00000448029.1 alternative 5' UTR ENST00000498193.1 alternative 5' UTR ENST00000361419.5 alternative 5' UTR ENST00000421609.1 alternative 5' UTR ENST00000457392.1 alternative 5' UTR ENST00000392802.2 alternative 5' UTR ENST00000392802.2 Alternatively spliced 5' UTR, shares CDS with RP11-316M1.7-001 (partial) ENST00000341697.3 alternatively spliced 5' UTR, shares CDS with RP11-68I18.3-001 ENST00000341697.3 KIAA1869 ENST00000341697.3 alternative 5' UTR ENST00000368910.3 FLJ23467 ENST00000440902.2 NP_001130015.1 ENST00000461862.1 this variant and variant fragment RP11-68I18.6-005 could be part of a single variant. ENST00000471039.1 this variant and one of variant fragments RP11-68I18.6-005 and 006 could be part of a single variant. ENST00000497147.1 this variant and variant fragment RP11-68I18.6-003 could be part of a single variant. ENST00000459799.1 this variant and variant fragment RP11-68I18.6-002 could be part of a single variant ENST00000441902.2 NP_001129108.1 ENST00000336715.5 KIAA1441 ENST00000324048.5 variant 2; alternatively spliced in 5' UTR ENST00000426871.1 FLJ13043 ENST00000368875.2 NP_002642.1 ENST00000368872.1 alternative 5' UTR ENST00000489223.2 alternative 5' UTR ENST00000438243.2 alternative 5' UTR ENST00000452671.2 alternative 5' UTR ENST00000452671.2 alternatively spliced 5' UTR, shared CDS with RP11-126K1.5-001 ENST00000474352.1 FLJ13813 ENST00000485040.1 FLJ20192 ENST00000533461.1 alternative 5' UTR ENST00000533351.1 alternative 5' UTR ENST00000416743.1 GENCODE experimental pipeline ENST00000326413.3 FLJ36032 ENST00000467306.1 FLJ22710 ENST00000418982.1 This transcript and RP11-98D18.13-003 are part of one coding transcript. Translation occurs through shifting of a reading frame that is induced with polyamines producing a functional trans-frame product. OAZ3 seems to be specifically expressed in haploid germ cells. See PMID: 10792465 ENST00000479764.1 FLJ43888 ENST00000400999.1 This transcript and RP11-98D18.13-003 are part of one coding transcript. Translation occurs through shifting of a reading frame that is induced with polyamines producing a functional trans-frame product. OAZ3 seems to be specifically expressed in haploid germ cells. See PMID: 10792465 ENST00000453029.1 This transcript and RP11-98D18.13-002 (or RP11-98D18.13-004 as an alternative variant) are part of one coding transcript. Translation occurs through shifting of a reading frame that is induced with polyamines producing a functional trans-frame product ENST00000453029.1 OAZ3 seems to be specifically expressed in haploid germ cells. See PMID: 10792465 ENST00000368825.3 NP_001077433 ENST00000368823.1 FLJ31840 ENST00000368823.1 RP11-98D18.8-001 ENST00000368822.1 RP11-98D18.8-001 ENST00000368822.1 not organism-supported ENST00000368822.1 alternative 5' UTR ENST00000458431.2 alternative 5' UTR ENST00000484421.1 not organism-supported ENST00000526378.1 alternative 5' UTR ENST00000368817.4 FLJ37964 ENST00000471464.1 novel transcript ENST00000477437.1 novel transcript ENST00000368809.1 RP11-139D23.5-001 ENST00000444515.1 LOC388699 ENST00000368771.1 alternative 5' UTR ENST00000443178.1 alternative 5' UTR ENST00000443178.1 alternative 5' UTR; shares CDS with RP1-20N18.3-001 ENST00000368758.3 RP1-20N18.9-003 ENST00000368757.1 RP1-20N18.9-004 ENST00000368756.1 RP1-20N18.9-004 ENST00000490266.1 novel transcript ENST00000368732.1 alternative 5' UTR ENST00000368728.1 alternative 5' UTR ENST00000329256.2 alternative 5' UTR ENST00000368724.1 alternative 5' UTR ENST00000368722.1 alternative 5' UTR ENST00000368720.1 Alternative 5' end ENST00000462776.1 novel transcript ENST00000462951.1 putative transcript ENST00000368717.2 alternative 5' UTR ENST00000368715.1 alternative 5' UTR ENST00000354332.4 alternative 5' UTR ENST00000468373.1 Novel transcript ENST00000368712.1 alternative 5' UTR ENST00000368709.1 alternative 5' UTR ENST00000368707.3 Novel protein ENST00000368704.1 alternative 5' UTR ENST00000368705.1 alternative 5' UTR ENST00000368706.3 alternative 5' UTR ENST00000368703.1 alternative 5' UTR ENST00000474991.1 Novel transcript ENST00000435409.2 alternative 5' UTR ENST00000303569.6 not organism-supported ENST00000368633.1 Non-canonical donor splice site at 3rd exon and non-canonical acceptor splice site at 4th exon ENST00000487235.1 Non-canonical donor splice site at 2nd exon ENST00000476883.1 Non-canonical donor splice site at 3rd exon and non-canonical acceptor splice site at 4th exon ENST00000492073.1 Non-canonical donor splice site at 3rd exon and non-canonical acceptor splice site at 4th exon ENST00000368623.3 Alternatively spliced 5' UTR, shares CDS with RP11-422P24.7-001 ENST00000368623.3 alternative 5' UTR ENST00000368621.1 Alternatively spliced 5' UTR, shares CDS with RP11-422P24.7-001 ENST00000368621.1 alternative 5' UTR ENST00000310483.6 Alternatively spliced 5' UTR, shares CDS with RP11-422P24.7-001 ENST00000310483.6 alternative 5' UTR ENST00000429040.1 Alternatively spliced 5' UTR, shares CDS with RP11-422P24.7-001 (partial) ENST00000429040.1 alternative 5' UTR ENST00000413622.1 Alternatively spliced 5' UTR, shares CDS with RP11-422P24.7-001 (partial) ENST00000413622.1 alternative 5' UTR ENST00000417348.1 Alternatively spliced 5' UTR, shares CDS with RP11-422P24.7-001 (partial) ENST00000417348.1 alternative 5' UTR ENST00000449724.1 Alternatively spliced 5' UTR, shares CDS with RP11-422P24.8-004 (partial) ENST00000449724.1 alternative 5' UTR ENST00000368607.3 alternative 5' UTR ENST00000368607.3 Alternatively spliced 5' UTR, shares CDS with RP11-422P24.8-001 ENST00000368603.1 alternative 5' UTR ENST00000368603.1 Alternatively spliced 5' UTR, shares CDS with RP11-422P24.8-001 ENST00000431292.1 Alternatively spliced 5' UTR, shares CDS with RP11-422P24.8-001 (partial) ENST00000431292.1 alternative 5' UTR ENST00000330188.9 NP_001036816.1 ENST00000368531.2 NP_001036817.1 ENST00000515609.1 alternative 5' UTR ENST00000368487.3 NP_001005855.1 ENST00000368489.3 NP_065185.1 ENST00000304760.2 5' end considerably extended by using match with mouse cDNA Em:AK034662.1 ENST00000368482.4 NP_872305.3 ENST00000368480.3 NP_001091945.1 ENST00000368471.3 NP_001020278.1 ENST00000351146.6 Non-canonical donor splice site 10th exon. ENST00000392487.1 Paper PMID: 10655141 have showed expression of protein in rat and discuss conservation in human and mouse ENST00000485982.1 FLJ32934 ENST00000368423.1 FLJ40674 ENST00000368424.3 FLJ40149 ENST00000525273.1 non-canonical acceptor splice site between exon 13 and exon 14 ENST00000423025.2 NP_001137159.1 ENST00000356955.2 NP_997080.1 ENST00000449910.2 NP_997079.1 ENST00000359280.4 NP_997078.1 ENST00000360674.4 NP_997074.1 ENST00000355956.2 NP_997077.1 ENST00000490770.1 novel transcript ENST00000475824.1 novel transcript ENST00000465546.1 novel transcript ENST00000490276.1 novel transcript ENST00000368404.4 LOC55974 ENST00000368405.3 novel transcript ENST00000488609.1 novel transcript ENST00000484027.1 novel transcript ENST00000479579.1 novel transcript ENST00000506037.1 novel transcript ENST00000341298.3 alternatively spliced 5' UTR, shares CDS with RP11-540D14.7-001 ENST00000341298.3 alternative 5' UTR ENST00000490672.1 FLJ14105 ENST00000327247.5 alternative 5' UTR ENST00000327247.5 alternatively spliced 5' UTR, shares CDS with RP11-263K19.7-001 ENST00000361361.2 CCDS1103.1 ENST00000496230.1 FLJ31278 ENST00000368356.4 alternatively spliced 5' UTR, shares CDS with RP11-21N7.1-001 ENST00000368356.4 alternative 5' UTR ENST00000487002.1 FLJ12779, FLJ11766 ENST00000446880.1 FLJ35976 ENST00000446880.1 No translation as would be subject to NMD ENST00000368354.3 FLJ43388 ENST00000462780.1 FLJ36458 ENST00000471876.1 FLJ90004 ENST00000548830.1 not organism-supported ENST00000413175.1 may be transcribed ENST00000413175.1 contains perfect Pfam domain ENST00000488901.1 novel transcript ENST00000460199.1 novel transcript ENST00000490743.1 novel transcript ENST00000245564.2 FLJ10504 ENST00000494995.1 novel transcript (FLJ31566) ENST00000482284.1 novel transcript ENST00000490642.1 novel transcript ENST00000491308.1 novel transcript ENST00000483832.1 novel transcript ENST00000465137.1 novel transcript ENST00000473327.1 novel transcript ENST00000483734.1 novel transcript ENST00000478756.1 novel transcript ENST00000475253.1 novel transcript ENST00000466815.1 novel transcript ENST00000462250.1 novel transcript ENST00000314835.5 expressed pseudogene (AF111708) ENST00000359205.5 alternative 5' UTR ENST00000355499.4 alternative 5' UTR ENST00000347088.5 alternative 5' UTR ENST00000368330.2 alternative 5' UTR ENST00000443231.1 alternative 5' UTR ENST00000454523.1 alternative 5' UTR ENST00000343043.3 RP11-243J18.5-001 ENST00000437809.1 alternative 5' UTR ENST00000473267.1 novel transcript ENST00000460075.1 novel transcript ENST00000483032.1 novel transcript ENST00000361040.5 FLJ20203 ENST00000471341.1 novel transcript ENST00000497369.1 novel transcript ENST00000476028.1 novel transcript ENST00000471442.1 novel transcript ENST00000477831.1 novel transcript ENST00000495937.1 novel transcript ENST00000490801.1 novel transcript ENST00000465587.1 novel transcript ENST00000494225.1 novel transcript ENST00000496021.1 novel transcript ENST00000496135.1 novel transcript ENST00000482386.1 novel transcript ENST00000466224.1 novel transcript ENST00000467009.1 FLJ23040 ENST00000468867.1 novel transcript ENST00000488251.1 novel transcript ENST00000368321.3 KIAA0907 ENST00000368320.3 KIAA0907 ENST00000478002.1 novel transcript ENST00000466520.1 novel transcript ENST00000465953.1 novel transcript ENST00000483237.1 novel transcript ENST00000482337.1 novel transcript ENST00000491599.1 novel transcript ENST00000295702.4 alternative 5' UTR ENST00000480567.1 alternative 5' UTR ENST00000531917.1 alternative 5' UTR ENST00000526212.1 alternative 5' UTR ENST00000489664.1 novel transcript ENST00000487106.1 novel transcript ENST00000463371.1 novel transcript ENST00000485575.1 novel transcript ENST00000368285.3 FLJ12287 ENST00000368283.1 contains a non-canonical splice site ENST00000470306.1 novel transcript ENST00000487358.1 novel transcript ENST00000466698.1 novel transcript ENST00000469065.1 novel transcript ENST00000462892.1 novel transcript ENST00000484155.1 putative novel transcript ENST00000359511.4 KIAA0446 ENST00000468973.1 novel transcript ENST00000469537.1 novel transcript ENST00000482737.1 putative novel transcript ENST00000292291.5 isoform 2 ENST00000492619.1 novel transcript ENST00000335852.1 isoform 1 ENST00000340183.5 novel protein ENST00000491107.1 novel transcript ENST00000468632.1 novel transcript ENST00000480773.1 novel transcript ENST00000470198.1 novel transcript ENST00000475507.1 novel transcript ENST00000420555.1 novel protein ENST00000420555.1 variant 6; alternatively spliced in 3' UTR ENST00000368267.4 novel protein ENST00000462362.1 novel transcript ENST00000476954.1 putative novel transcript ENST00000473643.1 putative novel transcript ENST00000468993.1 putative novel transcript ENST00000463670.1 novel transcript ENST00000295694.5 MGC13102 ENST00000495881.1 novel transcript ENST00000456810.1 variant 5; alternatively spliced in 5' UTR ENST00000485135.1 novel transcript ENST00000491392.1 novel transcript ENST00000461597.1 novel transcript ENST00000497831.1 novel transcript ENST00000472870.1 novel transcript ENST00000480968.1 putative novel transcript ENST00000362007.1 MGC31963 ENST00000476177.1 novel transcript ENST00000497955.1 putative novel transcript ENST00000479084.1 novel transcript ENST00000484214.1 novel transcript ENST00000368259.2 NP_001008800.1 ENST00000470342.1 novel transcript ENST00000481479.1 novel transcript ENST00000466306.1 novel transcript ENST00000368249.1 suspected genomic sequence error affecting CDS in exon 9 ENST00000471156.1 novel transcript ENST00000497824.1 novel transcript ENST00000465270.1 novel transcript ENST00000488498.1 contains a non-canonical splice site ENST00000488498.1 novel transcript ENST00000462458.1 novel transcript ENST00000486517.1 novel transcript ENST00000465570.1 novel transcript ENST00000498346.1 novel transcript ENST00000497822.1 novel transcript ENST00000492750.1 novel transcript ENST00000464238.1 novel transcript ENST00000482932.1 novel transcript ENST00000489918.1 novel transcript ENST00000484428.1 novel transcript ENST00000489877.1 novel transcript ENST00000476966.1 novel transcript ENST00000463309.1 novel transcript ENST00000464203.1 novel transcript ENST00000469813.1 novel transcript ENST00000495000.1 putative novel transcript ENST00000475587.1 contains a non-canonical splice site ENST00000495690.1 novel transcript ENST00000478081.1 novel transcript ENST00000462049.1 putative novel transcript ENST00000368232.4 NP_872620.1 ENST00000438976.2 NP_056405.2 ENST00000487988.1 novel transcript ENST00000456112.1 variant 4; alternatively spliced in 5' UTR ENST00000477201.1 novel transcript ENST00000482204.1 novel transcript ENST00000494218.1 novel transcript ENST00000313146.6 FLJ12671 ENST00000472824.1 novel transcript ENST00000496538.1 novel transcript ENST00000470713.1 novel transcript ENST00000469074.1 novel transcript ENST00000368218.4 NP_001136032.1 ENST00000476229.1 novel transcript ENST00000462397.1 putative novel transcript ENST00000497515.1 putative novel transcript ENST00000392302.2 NP_001007793.1 ENST00000455314.1 alternative 5' UTR ENST00000490146.1 FLJ32884 ENST00000490146.1 novel transcript ENST00000476550.1 novel transcript ENST00000472465.1 putative novel transcript ENST00000461387.1 novel transcript (FLJ00397) ENST00000497286.1 novel transcript (FLJ00333) ENST00000448509.2 novel transcript ENST00000479869.1 novel transcript ENST00000480682.1 novel transcript ENST00000494724.1 novel transcript ENST00000368184.3 alternatively spliced 3' UTR, shares CDS with RP11-367J7.1-001 ENST00000368184.3 FLJ43634 ENST00000368184.3 alternative 3' UTR ENST00000292392.5 FLJ40803 ENST00000473231.1 novel transcript ENST00000468507.1 novel transcript ENST00000463001.1 novel transcript ENST00000489998.1 novel transcript ENST00000368175.3 novel transcript ENST00000495126.1 novel transcript ENST00000480310.1 novel transcript ENST00000452528.1 FLJ32876 ENST00000491210.1 putative novel transcript ENST00000368140.1 alpha 1 isoform ENST00000368138.3 alpha 2 isoform ENST00000392254.2 beta 1 isoform ENST00000392252.3 beta 2 isoform ENST00000503933.1 unitary_pseudogene ENST00000368109.1 FLJ20442 ENST00000368108.3 alternative 5' UTR ENST00000368107.1 alternative 5' UTR ENST00000289707.5 FLJ90188 ENST00000368102.1 FLJ39187 ENST00000491974.1 novel transcript ENST00000536764.1 subject to nonsense-mediated decay ENST00000536779.1 subject to nonsense-mediated decay ENST00000544342.1 subject to nonsense-mediated decay ENST00000476696.1 novel transcript ENST00000475911.1 novel transcript ENST00000479940.1 novel transcript ENST00000368097.4 KIAA0120 ENST00000320307.4 alternative 5' UTR ENST00000397334.2 alternative 5' UTR ENST00000368094.1 KIAA1355 ENST00000493195.1 FLJ32088 ENST00000472488.1 FLJ34298 ENST00000447527.1 FLJ44610 ENST00000418602.1 FLJ35980 ENST00000368076.1 FLJ38560 ENST00000326837.2 alternative 5' UTR ENST00000368074.1 alternative 5' UTR ENST00000477163.1 novel transcript ENST00000473382.1 novel transcript ENST00000476033.1 novel transcript ENST00000461888.1 novel transcript ENST00000490368.1 novel transcript ENST00000497354.1 novel transcript ENST00000481831.1 novel transcript FLJ35857 ENST00000466253.1 novel transcript ENST00000475733.1 novel transcript ENST00000495887.1 novel transcript ENST00000440682.1 alternative 5' UTR ENST00000407642.2 alternative 5' UTR ENST00000419626.1 alternative 5' UTR ENST00000368069.3 FLJ26320 ENST00000294785.5 KIAA0253 ENST00000368061.2 KIAA1215, DKFZp434L1020 ENST00000368036.1 non canonical TEC ENST00000368036.1 non-canonical donor splice site at exon 7 ENST00000335772.2 alternatively spliced 5' UTR, shares CDS with RP11-544M22.2-001 ENST00000335772.2 alternative 5' UTR ENST00000289779.3 alternatively spliced 5' UTR, shares CDS with RP11-544M22.2-001 ENST00000289779.3 alternative 5' UTR ENST00000368020.1 alternative 5' UTR ENST00000368019.1 not organism-supported ENST00000531842.1 not organism-supported ENST00000467540.1 novel transcript ENST00000482672.1 novel transcript ENST00000473766.1 novel transcript ENST00000487163.1 non-canonical donor splice site in exon 6 ENST00000367999.4 alternatively spliced 5' UTR, shares CDS with RP11-297K8.4-001 ENST00000367999.4 alternative 5' UTR ENST00000495483.1 FLJ37536 ENST00000367998.1 alternatively spliced 5' UTR, shares CDS with RP11-297K8.5-001 ENST00000367998.1 alternative 5' UTR ENST00000367988.3 FLJ12770 ENST00000474486.1 novel transcript ENST00000470426.1 novel transcript ENST00000465512.1 novel transcript ENST00000492482.1 novel transcript ENST00000367987.1 FLJ12770 ENST00000367987.1 alternative 5' UTR ENST00000468803.1 novel transcript ENST00000475793.1 novel transcript ENST00000512372.1 NP_001070943.1 ENST00000437437.2 NP_001070945.1 ENST00000442691.2 NP_001070946.1 ENST00000412844.2 NP_001070941.1 ENST00000428574.2 NP_001070937.1 ENST00000505005.1 NP_001070942.1 ENST00000508740.1 NP_001070944.1 ENST00000511676.1 NP_001070947.1 ENST00000367981.3 NP_001070940.1 ENST00000511748.1 alternative 3' UTR ENST00000367984.4 NP_001070939.1 ENST00000367985.3 NP_001070949.1 ENST00000367979.2 NP_001070950.1 ENST00000342751.4 NP_001030588.1 ENST00000432287.2 NP_001030589.1 ENST00000392169.2 NP_001030590.1 ENST00000392169.2 CCDS41432.1 ENST00000426740.1 Splice acceptor of exon 3 differs to that of variant 1 by 3bp ENST00000442336.1 alternative 5' UTR ENST00000466542.2 The FCGR2C gene is a pseudogene in the current assembly, this gene exhibits nucleotide polymorphism in the population and may be a functional gene in some individuals ENST00000466542.2 While this locus is a pseudogene in some individuals it is likely there is still some transcription. The FCGR2C gene here thus represents a transcribed pseudogene ENST00000465403.1 novel transcript ENST00000470841.1 novel transcript ENST00000495397.1 FLJ31052 ENST00000476437.1 novel transcript ENST00000458136.1 Em:BC018064.1 is a best in genome match to this pseudogene, therefore classify it as expressed ENST00000294794.3 DKFZP586L151 ENST00000530878.1 NP_001158229 ENST00000493151.1 NP_001119532 ENST00000420220.1 alternative 5' UTR ENST00000426197.2 NP_001128712.1 ENST00000458626.2 NP_001078844.1 ENST00000367935.4 LOC284680 ENST00000493255.1 novel transcript ENST00000493550.1 novel transcript ENST00000282169.8 novel transcript ENST00000476240.1 novel transcript ENST00000474728.1 novel transcript ENST00000486089.1 novel transcript ENST00000485405.1 novel transcript ENST00000463037.1 novel transcript ENST00000484251.1 novel transcript ENST00000527809.1 alternative 5' UTR ENST00000491263.1 novel transcript ENST00000528938.1 alternative 5' UTR ENST00000428971.2 non-canonical splicing between exons 2 and 3 ENST00000528019.1 non-canonical splicing between exons 2 and 3 ENST00000528689.1 non-canonical splicing between exons 2 and 3 ENST00000439699.1 non-canonical splicing between exons 2 and 3 ENST00000415437.1 FLJ34821 ENST00000534289.1 alternative 5' UTR ENST00000450453.2 alternative 5' UTR ENST00000442820.1 alternative 5' UTR ENST00000367900.3 alternative 5' UTR ENST00000271452.3 FLJ36029 ENST00000340699.3 alternative 5' UTR ENST00000294816.2 alternative 5' UTR ENST00000367893.4 alternative 5' UTR ENST00000421273.1 FLJ35813 ENST00000294818.1 FLJ25811 ENST00000367884.1 alternative 5' UTR ENST00000461759.1 FLJ20066 (LOC400795) ENST00000464650.1 novel transcript ENST00000476143.1 novel transcript ENST00000481278.1 novel transcript ENST00000465705.1 novel transcript ENST00000423121.1 FLJ42974 ENST00000435676.1 alternative 3' UTR ENST00000456900.1 alternative 3' UTR ENST00000441649.1 alternative 3' UTR ENST00000488458.1 non-canonical splice acceptor site between exons 6 and 7 and non-canonical splice donor site between exons 7 and 8 ENST00000449930.1 alternative 5' UTR ENST00000367876.4 KIAA1513, FLJ23426 ENST00000367875.1 alternative 5' UTR ENST00000525740.1 not organism-supported ENST00000529387.1 not organism-supported ENST00000469934.2 not organism-supported ENST00000529071.1 not organism-supported ENST00000526687.1 not organism-supported ENST00000528703.1 not organism-supported ENST00000367872.4 FLJ14904, FLJ29032, DKFZp434L0217 ENST00000491055.1 novel transcript ENST00000487826.1 putative novel transcript ENST00000527955.1 not organism-supported ENST00000361200.2 FLJ37495 ENST00000485151.1 novel transcript ENST00000559038.1 alternative 5' UTR ENST00000557909.1 alternative 5' UTR ENST00000442313.1 alternative 5' UTR ENST00000492850.1 alternative 5' UTR ENST00000541643.2 alternative 5' UTR ENST00000483825.1 FLJ46519 ENST00000451992.1 FLJ41990 ENST00000367854.3 FLJ21772, DKFZp667N096 ENST00000475127.1 novel transcript ENST00000472038.1 novel transcript FLJ27288 ENST00000461790.1 novel transcript ENST00000403379.3 non-organism_supported ENST00000476818.1 novel transcript ENST00000367846.4 DKFZP564B167 ENST00000271373.4 alternative 5' UTR ENST00000458574.1 alternative 5' UTR ENST00000491067.1 novel transcript ENST00000460432.1 novel transcript ENST00000367835.1 alternative 5' UTR ENST00000485232.1 novel transcript ENST00000367833.2 MGC3794 ENST00000471981.1 novel transcript ENST00000271375.3 LOC375035 ENST00000358576.4 MGC12538 ENST00000465440.1 novel transcript ENST00000422548.1 novel transcript ENST00000367817.3 DKFZp586D2322 ENST00000367816.1 alternative 5' UTR ENST00000472647.1 NP_932076.1 ENST00000472647.1 FLJ37194 ENST00000329281.2 alternative 3' UTR ENST00000420531.1 alternative 5' UTR ENST00000426663.1 alternative 5' UTR ENST00000367806.3 FLJ25846 ENST00000491570.1 novel transcript ENST00000456107.1 alternative 5' UTR ENST00000498289.1 FLJ45155 ENST00000472795.1 novel transcript ENST00000496973.1 novel transcript ENST00000481744.1 novel transcript ENST00000359326.4 FLJ39174 ENST00000459772.1 FLJ10706 ENST00000466580.1 novel transcript ENST00000310392.4 MGC9084 ENST00000470238.1 novel transcript ENST00000367764.3 not organism-supported ENST00000416416.1 putative novel transcript ENST00000446102.1 putative novel transcript ENST00000367763.3 FLJ11752 ENST00000464798.1 contains a non-canonical splice site ENST00000367758.3 FLJ23550 ENST00000479749.1 contains a non-canonical splice site ENST00000236166.2 confirm experimentally ENST00000236166.2 not organism-supported ENST00000404238.2 expressed pseudogene (M55632.1) ENST00000367742.3 FLJ12430 ENST00000467601.1 novel transcript ENST00000495585.1 DKFZp434M1616 ENST00000485629.1 novel transcript ENST00000361735.3 KIAA0859 ENST00000361735.3 FLJ26050, FLJ10310, FLJ14646, FLJ14980 ENST00000367731.1 DKFZp566K013, KIAA0820 ENST00000489002.1 novel transcript ENST00000465374.1 novel transcript ENST00000475059.1 novel transcript ENST00000484368.1 novel transcript ENST00000488806.1 novel transcript ENST00000367728.1 alternative 5' UTR ENST00000367727.4 LOC92346 ENST00000367723.3 isoform 2 ENST00000263688.3 isoform 1 ENST00000486569.1 novel transcript ENST00000404377.3 NP_005083 ENST00000488053.1 novel transcript ENST00000367714.3 MGC43026 ENST00000466087.1 novel transcript ENST00000497689.1 novel transcript ENST00000479367.1 novel transcript ENST00000476568.1 novel transcript ENST00000333279.2 FLJ45235 ENST00000496683.1 novel transcript (FLJ31044) ENST00000460816.1 novel transcript ENST00000484920.1 novel transcript ENST00000479159.1 novel transcript ENST00000493233.1 novel transcript ENST00000495275.1 novel transcript ENST00000361951.4 FLJ10514 ENST00000471476.1 novel transcript ENST00000460076.1 novel transcript ENST00000367704.1 FLJ32748 ENST00000490000.1 MGC2629 ENST00000367696.2 KIAA2025 ENST00000367694.2 FLJ16661 ENST00000367686.3 novel transcript ENST00000486220.1 alternative 5' UTR ENST00000485114.1 novel transcript ENST00000461613.1 novel transcript ENST00000426793.1 alternative 5' UTR ENST00000405362.1 aqlternative_5'_UTR ENST00000444639.1 KIAA0040 ENST00000461830.2 non canonical TEC ENST00000367666.1 FLJ10416 ENST00000361833.2 Sw:O14525.3 ENST00000424564.2 NP_996991.1 ENST00000361539.4 LOC57795 ENST00000361539.4 KIAA1747 ENST00000495165.1 FLJ23871 ENST00000354921.2 DKFZp686C2486 ENST00000481349.1 novel transcript ENST00000419458.1 novel transcript ENST00000452867.1 novel transcript ENST00000367649.3 NP_733793.2 ENST00000465723.1 novel transcript ENST00000462775.1 isoform 1 ENST00000319416.2 DKFZp564J047 ENST00000521244.1 LOC400798 ENST00000472001.1 novel transcript ENST00000392043.3 NP_001129473.1 ENST00000509175.1 alternative 5' UTR ENST00000507383.1 alternative 5' UTR ENST00000508229.1 alternative 5' UTR ENST00000508285.1 alternative 5' UTR ENST00000461179.1 FLJ32940 ENST00000484883.1 FLJ25438 ENST00000489080.1 FLJ36141 ENST00000446865.1 FLJ44088 ENST00000367614.1 FLJ44941 ENST00000294848.8 FLJ45446 ENST00000483123.1 FLJ33061 ENST00000271583.3 not organism-supported ENST00000367607.3 KIAA0480 ENST00000429851.1 KIAA0480 ENST00000417046.1 FLJ12751 ENST00000442621.1 LOC148756 ENST00000496210.1 novel transcript ENST00000367588.4 KIAA1614 ENST00000367587.1 FLJ33349 ENST00000483705.1 novel transcript ENST00000461346.1 novel transcript ENST00000358073.2 FLJ32095 ENST00000415647.1 FLJ22706 ENST00000435023.1 LOC284646 ENST00000524607.1 not organism-supported ENST00000524607.1 alternative 5' UTR ENST00000360108.3 not organism-supported ENST00000436031.1 FLJ46275 ENST00000367561.5 DKFZp434E169 ENST00000508450.1 alternative 5' UTR ENST00000483095.2 alternative 5' UTR ENST00000367557.4 alternative 5' UTR ENST00000485081.1 FLJ39263 ENST00000493293.1 Sw:Q13753.2 ENST00000507691.2 alternative 5' UTR ENST00000419169.1 alternative 5' UTR ENST00000502375.1 alternative 5' UTR ENST00000308641.4 MGC26594 ENST00000481562.1 novel transcript ENST00000318130.7 NP_079467 ENST00000367509.4 FLJ34255 ENST00000475046.1 FLJ35593 ENST00000493413.1 novel transcript ENST00000475585.1 novel transcript ENST00000287859.5 non-consensu splice donor site between exons 11 and 12 ENST00000287859.5 FLJ20164, FLJ20505, FLJ22433 ENST00000478571.1 novel transcript ENST00000461662.1 novel transcript ENST00000497198.1 NP_072098.1 ENST00000429725.1 LOC339476 ENST00000403060.1 zinc finger protein pseudogene ENST00000367462.3 FLJ41028 ENST00000484105.1 novel transcript FLJ41463 ENST00000484105.1 non-canonical splicing between exons 2 and 3 ENST00000463404.1 novel transcript ENST00000445957.1 alternative 5' UTR ENST00000367454.1 FLJ21098 ENST00000400968.2 alternative 5' UTR ENST00000506303.1 alternative 5' UTR ENST00000367444.3 NP_001035828.1 ENST00000367441.1 alternative 5' UTR ENST00000367435.3 FLJ23316 ENST00000367433.5 DKFZp313E1116 ENST00000367409.4 FLJ10517, FLJ10549 ENST00000442588.1 alternative 5' UTR ENST00000538004.1 alternative 5' UTR ENST00000544035.1 alternative 5' UTR ENST00000417895.1 alternative 5' UTR ENST00000391974.3 alternative 5' UTR ENST00000367379.1 alternative 5' UTR ENST00000529828.1 non-stop decay ENST00000418674.1 alternative 5' UTR ENST00000367355.1 LOC388723 ENST00000447706.2 DKFZp564B1023 ENST00000433235.1 alternative 5' UTR ENST00000436897.1 alternative 5' UTR ENST00000475326.1 novel transcript ENST00000532631.1 alternative 5' UTR ENST00000451872.2 alternative 5' UTR ENST00000465162.1 novel transcript ENST00000473483.1 novel transcript DKFZp434B1231 ENST00000367322.1 NP_001001431.1 ENST00000491504.1 FLJ43246 ENST00000509001.1 alternative 5' UTR ENST00000494095.1 DKFZp313E1935 ENST00000367313.3 DKFZp686M21196 ENST00000361379.4 DKFZp451L122, DKFZp451C073 ENST00000336092.4 alternative 5' UTR ENST00000336092.4 FLJ41971 ENST00000367312.1 alternative 3' UTR ENST00000556362.1 alternative 5' UTR ENST00000367311.3 NMD exception ENST00000367311.3 FLJ90698 ENST00000367309.1 NMD exception ENST00000367309.1 alternative 5' UTR ENST00000532460.1 alternative 5' UTR ENST00000533432.1 alternative 5' UTR ENST00000441932.1 FLJ31028 ENST00000367296.4 FLJ12560, FLJ34248 ENST00000490213.1 FLJ31596 ENST00000367295.1 DKFZp781D0314, KIAA1151, FLJ14203 ENST00000430015.1 FLJ12569 ENST00000469130.1 KIAA1213 ENST00000429443.1 FLJ31486 ENST00000361565.4 AT-AC splicing between exons 8 and 9 ENST00000361565.4 FLJ90259, FLJ14626, FLJ10402, DKFZp761M1547, KIAA1192 ENST00000464117.1 novel transcript ENST00000481699.1 novel transcript ENST00000482943.1 FLJ13001 ENST00000295640.4 DKFZp547H084, FLJ22991 ENST00000471105.1 DKFZp547H084 ENST00000359651.3 DKFZp686F2495 ENST00000359651.3 alternative 5' UTR ENST00000367283.3 alternative 5' UTR ENST00000272217.2 FLJ45195 ENST00000309017.3 NP_002823.3 ENST00000470573.1 non-canonical splice donor between exon 1 and 2 ENST00000549576.1 not organism-supported ENST00000456105.1 FLJ31247 ENST00000468449.1 NMD candidate ENST00000484834.1 FLJ00314 ENST00000493296.1 novel transcript ENST00000461936.1 novel transcript ENST00000466407.1 novel transcript ENST00000466470.1 novel transcript ENST00000461980.1 novel transcript ENST00000492823.1 novel transcript ENST00000367210.1 KIAA0663 ENST00000480354.1 novel transcript ENST00000488411.1 novel transcript ENST00000550078.1 not organism-supported ENST00000475035.1 novel transcript ENST00000470492.1 novel transcript ENST00000367207.3 FLJ40343 ENST00000525442.1 alternative 5' UTR ENST00000528591.1 alternative 5' UTR ENST00000367201.3 FLJ10761 ENST00000367202.4 NP_060678.2 ENST00000477125.1 novel transcript ENST00000308302.3 FLJ42654 ENST00000475517.1 novel transcript ENST00000485632.1 novel transcript ENST00000462752.1 novel transcript ENST00000479079.1 novel transcript ENST00000496872.1 novel transcript ENST00000415899.1 alternative 5' UTR ENST00000429009.1 alternative 5' UTR ENST00000463049.1 DKFZp686B01123 ENST00000367176.3 FLJ10384 ENST00000367177.3 alternative 5' UTR ENST00000367175.1 DKFZp686N2444 ENST00000367175.1 alternative 5' UTR ENST00000444037.1 FLJ39865 ENST00000446412.1 alternative 5' UTR ENST00000403080.1 FLJ33320 ENST00000401399.1 FLJ45516 ENST00000505079.1 alternative 5' UTR ENST00000367173.3 KIAA0756 ENST00000425360.1 FLJ14647 ENST00000495396.1 FLJ46866 ENST00000492085.1 DKFZp686J0597, DKFZp686J0497, DKFZp686P0597, FLJ45272 ENST00000447819.1 DKFZp686E03196 ENST00000331830.4 FLJ37193 ENST00000481872.2 FLJ42746 ENST00000367162.3 KIAA0472 ENST00000495538.1 novel transcript KIAA0481 ENST00000468846.1 novel transcript ENST00000481950.1 novel transcript ENST00000367157.3 FLJ90349 and DKFZp434J037 ENST00000367155.3 FLJ10748 ENST00000367156.3 FLJ39271 ENST00000367156.3 alternative 5' UTR ENST00000460687.1 novel transcript ENST00000491471.1 novel transcript ENST00000447832.1 FLJ33178 ENST00000476884.1 novel transcript ENST00000367154.1 FLJ22975 ENST00000495594.1 novel transcript ENST00000442318.1 FLJ38314 ENST00000429964.2 alternative 5' UTR ENST00000419301.1 alternative 5' UTR ENST00000489617.1 DKFZp761L1515 ENST00000475956.1 novel transcript ENST00000367147.4 DKFZp761N1114, FLJ34577, FLJ25004 ENST00000489709.1 novel transcript ENST00000465651.1 novel transcript ENST00000471425.1 novel transcript ENST00000478555.1 novel transcript FLJ45392 ENST00000460934.1 novel transcript DKFZp666D0110 ENST00000464938.1 putative novel transcript ENST00000235932.4 alternative 5' UTR ENST00000414729.1 alternative 5' UTR ENST00000460624.1 novel transcript ENST00000460624.1 FLJ32569 ENST00000469861.1 putative novel transcript ENST00000461807.1 novel transcript ENST00000470041.1 novel transcript ENST00000468509.1 novel transcript ENST00000481737.1 novel transcript ENST00000431655.2 novel transcript ENST00000341209.5 MGC57827 ENST00000469540.1 novel transcript ENST00000485683.1 putative novel transcript ENST00000484045.1 novel transcript ENST00000462698.1 contains a non-canonical splice site ENST00000477884.1 contains a non-canonical splice site ENST00000476449.1 contains a non-canonical splice site ENST00000355294.4 isofrom A ENST00000367117.3 isoform B ENST00000338603.2 isoform D ENST00000338603.2 contains a non-canonical splice site ENST00000304534.8 isoform C ENST00000340758.2 NP_715639.1 ENST00000525793.1 alternative 5' UTR ENST00000529560.1 alternative 5' UTR ENST00000487149.1 novel transcript ENST00000488345.1 novel transcript ENST00000315927.4 DKFZp451J1719 ENST00000367078.3 alternative 5' UTR ENST00000452902.1 alternative 5' UTR ENST00000421786.1 alternative 5' UTR ENST00000367051.1 NP_000564.2 ENST00000367049.4 NP_000642.3 ENST00000529814.1 not organism-supported ENST00000487977.1 FLJ35650 ENST00000440276.1 novel transcript ENST00000361322.2 alternative 5' UTR ENST00000494990.1 novel transcript ENST00000441672.1 novel transcript ENST00000479796.1 alternative 5' UTR ENST00000367024.1 alternative 5' UTR ENST00000487271.1 alternative 5' UTR ENST00000480569.1 novel transcript ENST00000488702.1 novel transcript ENST00000467830.1 novel transcript ENST00000456314.1 alternative 5' UTR ENST00000491415.1 MGC29875 ENST00000469604.1 contains a non-canonical splice site ENST00000261458.3 FLJ10724 ENST00000534478.1 alternative 5' UTR ENST00000533469.1 alternative 5' UTR ENST00000472734.1 novel transcript ENST00000367005.4 FLJ10876 ENST00000529763.1 not organism-supported ENST00000423222.1 MGC14801 ENST00000366996.1 variant 2; alternatively spliced in 5' UTR ENST00000469606.1 novel transcript ENST00000366994.3 DKFZP434B168 ENST00000475798.1 novel transcript ENST00000461212.1 novel transcript ENST00000462910.1 novel transcript ENST00000460867.1 novel transcript ENST00000261455.4 FLJ10874 ENST00000427949.1 FLJ40118 ENST00000478275.1 FLJ36352 ENST00000366977.3 DKFZP566O1646 ENST00000473995.1 novel transcript ENST00000487995.1 novel transcript ENST00000366973.4 DKFZp686O2377 ENST00000356684.2 FLJ35568 ENST00000366966.2 alternative 5' UTR ENST00000366968.4 FLJ12505 ENST00000490792.1 alternative 5' UTR ENST00000366965.2 FLJ12505 ENST00000366967.2 FLJ39286 ENST00000366967.2 NP_001129947.1 ENST00000366962.3 FLJ12793 ENST00000473303.1 FLJ36628 ENST00000471129.1 alternative 5' UTR ENST00000498508.2 alternative 5' UTR ENST00000495537.1 novel transcript ENST00000465650.1 novel transcript ENST00000430890.1 novel transcript ENST00000445619.1 novel transcript ENST00000366940.2 alternative 5' UTR ENST00000359162.2 alternative 5' UTR ENST00000361395.2 alternative 5' UTR ENST00000360012.3 alternative 5' UTR ENST00000493603.1 alternative 5' UTR ENST00000487276.1 alternative 5' UTR ENST00000493748.1 alternative 5' UTR ENST00000475275.1 alternative 5' UTR ENST00000469486.1 alternative 5' UTR ENST00000459955.1 alternative 5' UTR ENST00000481543.1 alternative 5' UTR ENST00000366935.3 FLJ10252 ENST00000366933.4 FLJ25725 ENST00000366930.4 isoform A ENST00000366929.4 isoform B ENST00000424737.1 KIAA1238 ENST00000367211.3 LOC388739 ENST00000498237.2 alternative 5' UTR ENST00000366922.1 FLJ10326 ENST00000457142.1 chromosome 20 open reading frame 45 (C20orf45) pseudogene ENST00000472121.1 novel transcript ENST00000294889.5 FLJ14146 ENST00000366913.3 FLJ20605 ENST00000496078.1 novel transcript ENST00000472447.1 novel transcript ENST00000366910.5 FLJ22390 ENST00000492847.1 novel transcript ENST00000496110.1 novel transcript ENST00000472269.1 novel transcript ENST00000448432.1 chromosome 6 open reading frame 119 (C6orf119) pseudogene ENST00000366890.1 isoform 2 ENST00000352967.4 isoform 1 ENST00000434700.1 alternative 5' UTR ENST00000391880.2 FLJ43505 ENST00000456298.1 alternative 5' UTR ENST00000407096.2 alternative 5' UTR; shares CDS with RP11-239E10.1-001 ENST00000407096.2 alternative 5' UTR ENST00000430824.2 gene fragments RP11-105I12.2-001 and WI2-2998D17.1-001 are part of the same gene; an assembly gap between them contains one or more exons ENST00000419193.2 gene fragments RP11-105I12.2-001 and WI2-2998D17.1-001 are part of the same gene; an assembly gap between them contains one or more exons ENST00000366873.2 not organism-supported ENST00000474026.1 FLJ42761 ENST00000487223.1 FLJ39928 ENST00000498027.1 FLJ13789 ENST00000463997.1 FLJ32276 ENST00000366862.5 KIAA0483, FLJ10766 ENST00000424254.2 NP_001129587.1 ENST00000366857.5 DKFZp779B0350 ENST00000366860.5 novel transcript ENST00000468318.1 novel transcript ENST00000477413.1 novel transcript ENST00000469200.1 novel transcript ENST00000414423.2 NP-079436.4 ENST00000480676.2 alternative 3' UTR ENST00000471578.1 novel transcript ENST00000483512.1 novel transcript ENST00000498126.1 novel transcript ENST00000496372.1 novel transcript ENST00000470602.1 novel transcript ENST00000498382.1 novel transcript ENST00000478120.1 novel transcript ENST00000481095.1 novel transcript ENST00000470788.1 novel transcript ENST00000489556.1 novel transcript ENST00000496277.1 novel transcript ENST00000492470.1 novel transcript ENST00000479227.1 novel transcript ENST00000272133.3 FLJ38993 ENST00000413949.2 alternative 5' UTR ENST00000498360.1 novel transcript ENST00000486657.1 novel transcript ENST00000434499.1 LEFTY family pseudogene ENST00000436966.1 Alternatively spliced 5' UTR, shares CDS with RP4-559A3.1 (partial) ENST00000436966.1 alternative 5' UTR ENST00000272091.7 Translation differs to that in TR:BAC87130 with 12 amino acids inserted between positions 54 and 55. ENST00000366817.1 Non-canonical donor splice site at 3rd exon. ENST00000366816.1 Alternatively spliced 5' UTR, shares CDS with RP11-396C23.1-001 ENST00000366816.1 alternative 5' UTR ENST00000359525.2 Alternatively spliced 5' UTR, shares CDS with RP11-449N9.1-002 (partial) ENST00000359525.2 alternative 5' UTR ENST00000524196.1 alternative 5' UTR ENST00000495488.1 alternative 5' UTR ENST00000422240.2 NP_036618.2 ENST00000366779.1 alternatively spliced 5' UTR, shares CDS with RP5-1087E8.1-001 ENST00000366779.1 alternative 5' UTR ENST00000343776.4 MGC42493 ENST00000480897.1 FLJ30704 ENST00000366758.3 FLJ12517 ENST00000284523.1 FLJ31716 ENST00000272102.5 FLJ20613 ENST00000366733.1 Alternatively spliced 5' UTR; shares CDS with RP5-881P19.5-001 ENST00000366733.1 alternative 5' UTR ENST00000366734.1 Alternatively spliced 5' UTR; shares CDS with RP5-881P19.5-001 ENST00000366734.1 alternative 5' UTR ENST00000366735.1 Alternatively spliced 5' UTR; shares CDS with RP5-881P19.5-001 ENST00000366735.1 alternative 5' UTR ENST00000366736.1 Alternatively spliced 5' UTR; shares CDS with RP5-881P19.5-001 ENST00000366736.1 alternative 5' UTR ENST00000366741.1 Alternatively spliced 5' UTR; shares CDS with RP5-881P19.5-001 ENST00000366741.1 alternative 5' UTR ENST00000366740.1 Alternatively spliced 5' UTR; shares CDS with RP5-881P19.5-001 ENST00000366740.1 alternative 5' UTR ENST00000366739.1 Alternatively spliced 5' UTR; shares CDS with RP5-881P19.5-001 ENST00000366739.1 alternative 5' UTR ENST00000366742.1 Alternatively spliced 5' UTR; shares CDS with RP5-881P19.5-001 ENST00000366742.1 alternative 5' UTR ENST00000366744.1 Alternatively spliced 5' UTR; shares CDS with RP5-881P19.5-001 ENST00000366744.1 alternative 5' UTR ENST00000366746.3 Alternatively spliced 5' UTR; shares CDS with RP5-881P19.5-001 ENST00000366746.3 alternative 5' UTR ENST00000295008.4 Alternatively spliced 5' UTR; shares CDS with RP5-881P19.5-001 ENST00000295008.4 alternative 5' UTR ENST00000336520.3 Alternatively spliced 5' UTR; shares CDS with RP5-881P19.5-001 ENST00000336520.3 alternative 5' UTR ENST00000336300.5 Alternatively spliced 5' UTR; shares CDS with RP5-881P19.5-001 ENST00000336300.5 alternative 5' UTR ENST00000457264.1 Alternatively spliced 5' UTR; shares CDS with partial RP5-881P19.5-001 ENST00000457264.1 alternative 5' UTR ENST00000366730.1 alternative 5' UTR ENST00000366730.1 Alternatively spliced 5' UTR, shares CDS with RP11-520H14.2-001. ENST00000366726.1 alternative 5' UTR ENST00000366726.1 Alternatively spliced 5' UTR, shares CDS with RP11-520H14.2-001. ENST00000366718.1 Alternatively spliced 5' UTR, shares CDS with RP11-520H14.2-001 ENST00000366718.1 alternative 5' UTR ENST00000470040.1 DKFZp666D023 ENST00000366716.1 alternative 5' UTR ENST00000366716.1 Alternatively spliced 5' UTR, shares CDS with RP11-520H14.2-001. ENST00000366711.3 LOC200205 ENST00000484749.1 FLJ12734 ENST00000295012.5 confirm experimentally ENST00000284548.11 KIAA1556 ENST00000284548.11 DKFZp451F056 ENST00000493813.1 DKFZp686I0855 ENST00000366704.1 FLJ40170 ENST00000474237.1 DKFZp666E245 ENST00000284551.6 FLJ40506 ENST00000366699.3 FLJ90385 ENST00000366697.2 Alternatively spliced 5' UTR, shares CDS with RP5-915N17.1-001 ENST00000366697.2 FLJ30864 ENST00000366697.2 alternative 5' UTR ENST00000295033.3 Alternatively spliced 5' UTR, shares CDS with RP5-915N17.1-001 ENST00000295033.3 alternative 5' UTR ENST00000456946.2 NP_001128327.1 ENST00000355586.4 alternative 5' UTR ENST00000457345.2 alternative 5' UTR ENST00000520264.1 alternative 5' UTR ENST00000450202.1 DKFZp547I014 ENST00000450202.1 FLJ45055 ENST00000450202.1 FLJ27455\n\ ENST00000305943.7 LOC149603 ENST00000366690.4 Protein translation is extended by five amino acids at the N-terminal, which are additional to the translation found in Sw:P20338 ENST00000308794.4 Non-canonical donor splice site at exon 3 (may be due to missing base) ENST00000366682.3 Non-canonical donor splice site at exon 3 and non-canonical acceptor splice site at exon 4. ENST00000366679.1 Non-canonical donor splice sites at exons 18 and 25. ENST00000366663.5 FLJ14525 ENST00000470540.1 NP_001129966.1 ENST00000470540.1 CCDS44330.1 ENST00000523410.1 NP_001129967.1 ENST00000523410.1 CCDS44331.1 ENST00000366661.4 DKFZp667K0918, FLJ23785, FLJ22584 ENST00000366661.4 CCDS1588.1 ENST00000366662.4 DKFZp547A206 ENST00000310256.2 DKFZp434E0517 ENST00000494111.1 novel transcript ENST00000466258.1 novel transcript ENST00000444294.3 not organism-supported ENST00000366653.5 BC156316.1 ENST00000366653.5 confirm experimentally ENST00000366653.5 NP_001004342.3 ENST00000366653.5 BC157055.1 ENST00000318906.2 DKFZp547B1713 ENST00000462669.1 novel transcript ENST00000486384.1 novel transcript ENST00000495795.1 novel transcript ENST00000471936.1 novel transcript FLJ30562 ENST00000366645.1 FLJ39141 ENST00000295050.7 DKFZp547N043, FLJ14707 ENST00000008440.9 FLJ14411 ENST00000492437.1 novel transcript ENST00000469904.1 novel transcript ENST00000366641.3 DKFZp761F179 ENST00000475168.1 DKFZp686G1650 ENST00000457698.1 FLJ35881 ENST00000366628.4 MGC13186 ENST00000344698.2 KIAA0435 ENST00000258229.8 NP_055616.3 ENST00000366615.4 LOC388753 ENST00000441360.1 LOC148638 ENST00000442382.1 FLJ45859 ENST00000418557.1 LOC284527 ENST00000549744.1 non-submitted evidence ENST00000418304.1 alternative 5' UTR ENST00000488594.1 alternative 5' UTR ENST00000471812.1 alternative 5' UTR ENST00000476121.1 alternative 5' UTR ENST00000497327.1 alternative 5' UTR ENST00000472011.1 FLJ36078 ENST00000366600.3 DKFZp434K1617 ENST00000478199.1 FLJ34178 ENST00000494378.1 FLJ26787 ENST00000366597.1 Alternatively spliced 5' UTR; shares CDS with RP11-293G6__B.1-001.\n\ ENST00000366597.1 alternative 5' UTR ENST00000389794.3 DKFZp781B0767 ENST00000334232.4 Isoform A ENST00000359362.4 Isoform B ENST00000481485.1 alternative 5' UTR ENST00000454943.2 alternative 5' UTR ENST00000527974.1 alternative 5' UTR ENST00000527974.1 not organism-supported ENST00000352231.2 alternative 5' UTR ENST00000406509.3 alternative 5' UTR ENST00000529489.1 alternative 5' UTR ENST00000341872.6 alternative 5' UTR ENST00000238181.7 alternative 5' UTR ENST00000323938.6 not organism-supported ENST00000526634.1 alternative 5' UTR ENST00000366576.3 Non-canonical donor splice site at 2nd exon. ENST00000450451.1 LOC401987 ENST00000442726.1 FLJ33910 ENST00000468573.1 FLJ31787 ENST00000427859.1 DKFZp667K2218 ENST00000319653.9 NP_064450 ENST00000318160.4 FLJ21195 ENST00000366553.1 FLJ10071, FLJ13361 ENST00000468967.1 FLJ16613 ENST00000461971.1 novel transcript ENST00000478331.1 novel transcript ENST00000519225.1 alternative 5' UTR ENST00000366548.3 DKFZp434L013 ENST00000423131.1 alternative 5' UTR ENST00000523590.1 alternative 5' UTR ENST00000450748.1 alternative 5' UTR ENST00000493702.1 exon 4 5'-canonical splice site ENST00000521202.1 not organism-supported ENST00000314833.6 FLJ40773 ENST00000366545.4 FLJ40773 ENST00000467561.1 not organism-supported ENST00000481987.1 not organism-supported ENST00000336415.4 not organism-supported ENST00000492145.1 not organism-supported ENST00000518289.1 noncanonical splice donor site between exons 1 and 2 ENST00000522191.1 alternative 5' UTR ENST00000523424.1 alternative 5' UTR ENST00000522995.1 alternative 5' UTR ENST00000336199.5 alternative 3' UTR ENST00000366540.1 alternative 3' UTR ENST00000552631.1 alternative 5' UTR ENST00000440494.1 LOC339529 ENST00000486803.1 novel transcript ENST00000470211.1 novel transcript ENST00000366535.3 FLJ21861 ENST00000473875.1 novel transcript FLJ23552 ENST00000460986.1 novel transcript ENST00000478554.1 novel transcript ENST00000428042.1 DKFZp686A0738 ENST00000464170.1 novel transcript ENST00000485888.1 novel transcript ENST00000487449.1 novel transcript ENST00000302550.11 FLJ21998, DKFZp586C1019 ENST00000484738.1 novel transcript ENST00000411948.2 FLJ43269 ENST00000498262.1 FLJ26988 ENST00000464757.1 DKFZp434I0835 ENST00000366527.3 FLJ37978, FLJ30202 ENST00000391837.3 not organism-supported ENST00000366522.2 FLJ33608 ENST00000473686.1 novel transcript ENST00000487845.1 novel transcript FLJ10531 ENST00000479260.1 novel transcript ENST00000479923.1 novel transcript ENST00000407071.2 CCDS44342.1 ENST00000366514.4 FLJ23182 ENST00000483271.1 novel transcript ENST00000366513.4 FLJ32001, DKFZp451A152, DKFZp451B077, FLJ00215 ENST00000366510.3 FLJ90697 ENST00000421003.1 FLJ12783 ENST00000426089.1 FLJ43187 ENST00000470300.1 DKFZp686P072 ENST00000366508.1 DKFZp686I2429, FLJ16456, FLJ38079, DKFZp434N093 ENST00000326225.3 FLJ32832 ENST00000483900.1 FLJ34191 ENST00000366503.2 MGC12466 ENST00000476312.1 FLJ27507 ENST00000340684.5 FLJ30085 ENST00000472952.1 This gene does not display a complete open-reading frame within the current genomic sequence, a single nuceotide difference causes an in-frame stop codon ENST00000462139.1 DKFZp686I07110 ENST00000465126.1 FLJ40711 ENST00000391828.3 alternative 5' UTR ENST00000336119.3 NP_001073289.1 ENST00000348069.2 NP_899632.1 ENST00000527084.1 alternative 5' UTR ENST00000527541.1 alternative 5' UTR ENST00000366491.2 alternative 5' UTR ENST00000463359.1 not organism-supported ENST00000529512.1 alternative 5' UTR ENST00000366488.4 LOC148823 ENST00000420469.1 LOC148824 ENST00000446393.1 unitary_pseudogene ENST00000366480.3 NP_001004491.1 ENST00000366475.1 NP_001004696.1 ENST00000366475.1 BK004464 ENST00000366474.1 BK004463 ENST00000366474.1 NP_112166.1 ENST00000366472.5 KIAA1720 ENST00000306562.3 FLJ22301 ENST00000505503.1 alternative 5' UTR ENST00000428515.1 alternative 5' UTR ENST00000423362.1 alternative 5' UTR ENST00000463519.1 FLJ20531 ENST00000306601.4 FLJ20531 ENST00000366471.3 FLJ20531 ENST00000451251.1 non-canonical splice donor site between exons 6 and 7 ENST00000451251.1 NP_001129508.1 ENST00000470787.2 non-canonical donor splice site exon 5 ENST00000496231.1 alternative 5' UTR ENST00000463865.1 FLJ22933 ENST00000403657.1 FLJ41835 ENST00000403657.1 alternative 5' UTR ENST00000405430.1 not organism-supported ENST00000403658.1 FLJ78625 ENST00000479739.2 FLJ39121 ENST00000471948.1 FLJ31239 ENST00000444079.1 not organism-supported ENST00000477202.1 FLJ43019 ENST00000308624.5 NP_061841 ENST00000423320.1 alternative 5' UTR ENST00000366424.2 FLJ26070 ENST00000479156.1 alternative 5' UTR ENST00000476547.1 alternative 5' UTR ENST00000426976.1 DKFZp686N1215 ENST00000437610.1 GENCODE experimental pipeline ENST00000457478.1 GENCODE experimental pipeline ENST00000398659.4 non_organism_supported ENST00000454977.1 GENCODE experimental pipeline ENST00000324266.5 alternative 5' UTR ENST00000450917.1 GENCODE experimental pipeline ENST00000438485.1 non canonical TEC ENST00000436842.1 FLJ39594 ENST00000438436.1 FLJ12956 ENST00000403564.1 alternative 5' UTR ENST00000406376.1 alternative 5' UTR ENST00000456450.1 GENCODE experimental pipeline ENST00000423741.1 GENCODE experimental pipeline ENST00000537457.1 not organism-supported ENST00000425949.1 GENCODE experimental pipeline ENST00000442831.1 GENCODE experimental pipeline ENST00000412134.1 GENCODE experimental pipeline ENST00000458264.1 GENCODE experimental pipeline ENST00000453678.1 GENCODE experimental pipeline ENST00000455579.1 GENCODE experimental pipeline ENST00000431188.1 GENCODE experimental pipeline ENST00000444416.1 FLJ41046 ENST00000425125.1 GENCODE experimental pipeline ENST00000436082.1 GENCODE experimental pipeline ENST00000455317.1 GENCODE experimental pipeline ENST00000450467.1 GENCODE experimental pipeline ENST00000382045.3 FLJ42418 ENST00000366140.2 GENCODE experimental pipeline ENST00000442639.1 end not found ENST00000439208.1 GENCODE experimental pipeline ENST00000424351.1 FLJ32573 ENST00000416587.1 alternative 5' UTR ENST00000433456.1 alternative 5' UTR ENST00000415520.1 GENCODE experimental pipeline ENST00000435062.1 GENCODE experimental pipeline ENST00000414654.1 GENCODE experimental pipeline ENST00000417930.1 GENCODE experimental pipeline ENST00000416534.1 GENCODE experimental pipeline ENST00000426969.1 GENCODE experimental pipeline ENST00000442956.1 FLJ45673 ENST00000412712.1 GENCODE experimental pipeline ENST00000433592.1 not organism-supported ENST00000418957.1 not organism-supported ENST00000473731.1 not organism-supported ENST00000495580.1 GENCODE experimental pipeline ENST00000474561.1 GENCODE experimental pipeline ENST00000360635.3 alternative 5' UTR ENST00000359712.3 FLJ35860 ENST00000492079.1 alternative 5' UTR ENST00000494563.1 alternative 5' UTR ENST00000467606.1 alternative 5' UTR ENST00000484735.1 alternative 5' UTR ENST00000460001.1 alternative 5' UTR ENST00000497105.1 alternative 5' UTR ENST00000470914.1 alternative 5' UTR ENST00000481367.1 alternative 5' UTR ENST00000495797.1 alternative 5' UTR ENST00000381844.4 alternative 5' UTR ENST00000446619.1 alternative 5' UTR ENST00000478468.1 GENCODE experimental pipeline ENST00000483023.1 GENCODE experimental pipeline ENST00000474667.1 GENCODE experimental pipeline ENST00000425235.1 GENCODE experimental pipeline ENST00000360566.2 PMID:11978970 also provides evidence for an upstream promoter ENST00000304567.4 There is evidence for a downstream promoter from PMIDs 10631117 and 11978970 ENST00000381786.3 FLJ25102 ENST00000446285.1 probable_NMD_if_extended ENST00000553181.1 non-submitted evidence ENST00000414538.1 GENCODE experimental pipeline ENST00000452909.1 GENCODE experimental pipeline ENST00000418835.1 GENCODE experimental pipeline ENST00000544306.1 FLJ33534 ENST00000381585.3 FLJ25143 ENST00000430897.1 GENCODE experimental pipeline ENST00000454489.1 GENCODE experimental pipeline ENST00000417473.2 GENCODE experimental pipeline ENST00000381486.2 NP_055483 ENST00000263834.5 NP_683701.2 ENST00000389825.3 GREB1 ENST00000381483.2 NP_149081.1 ENST00000470980.1 GREB1 ENST00000432985.1 GREB1 ENST00000396123.1 GREB1 ENST00000396099.1 non_organism_supported ENST00000441684.1 alternative 5' UTR ENST00000423495.1 alternative 5' UTR ENST00000435175.1 GENCODE experimental pipeline ENST00000431500.2 GENCODE experimental pipeline ENST00000412606.1 GENCODE experimental pipeline ENST00000425974.1 GENCODE experimental pipeline ENST00000434509.1 GENCODE experimental pipeline ENST00000450715.1 GENCODE experimental pipeline ENST00000416173.1 GENCODE experimental pipeline ENST00000438178.1 GENCODE experimental pipeline ENST00000431117.1 GENCODE experimental pipeline ENST00000492352.1 GENCODE experimental pipeline ENST00000448379.1 GENCODE experimental pipeline ENST00000422415.1 GENCODE experimental pipeline ENST00000426539.1 GENCODE experimental pipeline ENST00000412381.1 GENCODE experimental pipeline ENST00000444804.1 non canonical other ENST00000420404.1 GENCODE experimental pipeline ENST00000439745.1 GENCODE experimental pipeline ENST00000420130.1 GENCODE experimental pipeline ENST00000427950.1 GENCODE experimental pipeline ENST00000446357.1 GENCODE experimental pipeline ENST00000443066.1 non canonical other ENST00000448650.1 GENCODE experimental pipeline ENST00000421181.1 GENCODE experimental pipeline ENST00000406397.1 not organism-supported ENST00000524465.1 alternative 5' UTR ENST00000532257.1 alternative 5' UTR ENST00000281047.3 non-organism_supported ENST00000406971.2 non canonical other ENST00000431697.1 GENCODE experimental pipeline ENST00000449124.1 GENCODE experimental pipeline ENST00000443897.1 GENCODE experimental pipeline ENST00000450628.1 GENCODE experimental pipeline ENST00000432822.1 GENCODE experimental pipeline ENST00000449086.1 GENCODE experimental pipeline ENST00000402414.1 not organism-supported ENST00000416575.1 GENCODE experimental pipeline ENST00000430429.1 GENCODE experimental pipeline ENST00000482879.1 non canonical conserved ENST00000420234.1 probable_NMD_if_extended ENST00000424028.1 NP_001033749 ENST00000448241.1 GENCODE experimental pipeline ENST00000441870.1 GENCODE experimental pipeline ENST00000447260.1 GENCODE experimental pipeline ENST00000457901.1 GENCODE experimental pipeline ENST00000417609.1 GENCODE experimental pipeline ENST00000412424.1 GENCODE experimental pipeline ENST00000450551.1 GENCODE experimental pipeline ENST00000430520.1 GENCODE experimental pipeline ENST00000433429.1 GENCODE experimental pipeline ENST00000440785.1 GENCODE experimental pipeline ENST00000423706.1 GENCODE experimental pipeline ENST00000423706.1 non canonical conserved ENST00000415245.1 GENCODE experimental pipeline ENST00000430051.1 GENCODE experimental pipeline ENST00000430988.1 GENCODE experimental pipeline ENST00000406420.3 LOC388931 ENST00000478050.1 GENCODE experimental pipeline ENST00000460686.1 not organism-supported ENST00000417886.1 Probable_NMD_if_extended ENST00000295150.3 NP_001035800.1 ENST00000432434.1 not organism-supported ENST00000429717.1 GENCODE experimental pipeline ENST00000413989.1 GENCODE experimental pipeline ENST00000496333.1 alternative 5' UTR ENST00000406961.1 NP_003734.3 ENST00000469850.1 alternative 5' UTR ENST00000328379.4 NP_001013685 ENST00000438445.1 alternative 5' UTR ENST00000264711.2 NP_057628 ENST00000421904.1 GENCODE experimental pipeline ENST00000264708.3 alternative 5' UTR ENST00000395826.2 alternative 5' UTR ENST00000449220.1 NP_001030333.1 ENST00000449220.1 alternative 5' UTR ENST00000380746.4 NP_715640.2 ENST00000321117.5 NP_072046.2 ENST00000321117.5 alternative 5' UTR ENST00000406659.3 NP_783329.1 ENST00000431557.1 GENCODE experimental pipeline ENST00000406818.3 NP_068707 ENST00000404103.3 NP_149159 ENST00000407661.3 NP_899204 ENST00000407038.3 NP_149160 ENST00000405222.1 NP_899205 ENST00000303659.4 alternative 5' UTR ENST00000349996.6 alternative 5' UTR ENST00000352271.6 GENCODE experimental pipeline ENST00000435504.3 NP_060733.4 ENST00000405914.1 alternative 5' UTR ENST00000405914.1 not organism-supported ENST00000401533.1 KIAA2038 ENST00000407684.1 FLJ00375 ENST00000448743.1 alternative 5' UTR ENST00000425035.1 alternative 5' UTR ENST00000412805.1 alternative 5' UTR ENST00000494615.1 FLJ37959 ENST00000421869.1 FLJ97042 ENST00000329615.3 non-organism_supported ENST00000329615.3 not organism-supported ENST00000420852.1 GENCODE experimental pipeline ENST00000429494.1 DKFZp686J0896 ENST00000414029.1 DKFZp686N0996 ENST00000450961.1 alternative 5' UTR ENST00000401478.1 alternative 5' UTR ENST00000431402.1 alternative 5' UTR ENST00000434719.1 alternative 5' UTR ENST00000484882.1 FLJ45383 ENST00000458529.1 alternative 5' UTR ENST00000402218.1 alternative 5' UTR ENST00000380387.3 FLJ43781 ENST00000380387.3 GENCODE experimental pipeline ENST00000321326.7 FLJ20254 ENST00000238788.9 DKFZp666E065, FLJ90500 ENST00000460665.1 FLJ39682 ENST00000421915.1 alternative 5' UTR ENST00000453161.1 FLJ21839 ENST00000453161.1 alternative 5' UTR ENST00000451003.1 alternative 5' UTR ENST00000477136.1 FLJ13336 ENST00000323064.8 FLJ21839 ENST00000437006.1 alternative 5' UTR ENST00000411862.1 GENCODE experimental pipeline ENST00000456793.1 GENCODE experimental pipeline ENST00000456793.1 DKFZp586A0722 ENST00000490823.1 not organism-supported ENST00000402394.1 owing to a polymorphic repeat in the last exon, this translation is longer than the published one ENST00000405600.1 alternative 5' UTR ENST00000312734.4 alternative 5' UTR ENST00000404694.3 FLJ99188 ENST00000416802.1 Probable_NMD_if_extended ENST00000461757.1 DKFZp434F152 ENST00000488743.1 FLJ14949 ENST00000408041.1 FLJ95369 ENST00000408041.1 alternative 5' UTR ENST00000412471.1 alternative 5' UTR ENST00000401463.1 alternative 5' UTR ENST00000432106.1 alternative 5' UTR ENST00000426119.1 alternative 5' UTR ENST00000414408.1 alternative 5' UTR ENST00000428518.1 alternative 5' UTR ENST00000442731.1 alternative 5' UTR ENST00000405489.3 FLJ75748 ENST00000497341.1 FLJ45367 ENST00000482990.1 FLJ45153 ENST00000402462.1 alternative 5' UTR ENST00000404433.1 not organism-supported ENST00000406962.1 not organism-supported ENST00000357186.6 FLJ35986 ENST00000454704.1 FLJ97604 ENST00000457748.1 alternative 5' UTR ENST00000423998.1 alternative 5' UTR ENST00000416453.1 GENCODE experimental pipeline ENST00000416453.1 FLJ25849 ENST00000447070.1 GENCODE experimental pipeline ENST00000491924.1 not organism-supported ENST00000379852.3 alternative 5' UTR ENST00000419281.2 alternative 5' UTR ENST00000356442.4 alternative 5' UTR ENST00000453171.1 NAGNAG splice site ENST00000407293.1 NAGNAG splice site ENST00000260570.3 DKFZp434A163 ENST00000447166.1 GENCODE experimental pipeline ENST00000394775.3 NP_001136155 ENST00000464789.2 not organism-supported ENST00000379677.2 GENCODE experimental pipeline ENST00000418963.1 GENCODE experimental pipeline ENST00000445878.1 non canonical polymorphism ENST00000439700.1 GENCODE experimental pipeline ENST00000431376.1 GENCODE experimental pipeline ENST00000452212.1 GENCODE experimental pipeline ENST00000462832.1 FLJ35928 ENST00000449210.1 alternative 5' UTR ENST00000306108.5 FLJ20628 ENST00000306108.5 DKFZp564I2178 ENST00000379558.3 LOC165186 similar to RIKEN cDNA 4632412N22 gene ENST00000465300.1 FLJ43249 ENST00000331664.4 FLJ34931 similar to cDNA sequence BC027072 ENST00000446073.1 GENCODE experimental pipeline ENST00000426642.1 not organism-supported ENST00000401617.2 not organism-supported ENST00000421411.1 GENCODE experimental pipeline ENST00000359823.2 GENCODE experimental pipeline ENST00000379520.3 alternative 5' UTR ENST00000379519.3 alternative 5' UTR ENST00000402003.3 alternative 5' UTR ENST00000402708.1 alternative 5' UTR ENST00000497423.1 alternative 5' UTR ENST00000349752.5 FLJ33994 ENST00000349752.5 FLJ23814 ENST00000324589.5 FLJ12691 ENST00000406653.1 FLJ16272 ENST00000430167.1 FLJ13977 ENST00000449780.1 GENCODE experimental pipeline ENST00000435713.1 GENCODE experimental pipeline ENST00000416279.1 GENCODE experimental pipeline ENST00000295066.3 alternative 5' UTR ENST00000404530.1 alternative 5' UTR ENST00000437854.1 alternative 5' UTR ENST00000360906.5 alternative 5' UTR ENST00000402280.1 alternative 5' UTR ENST00000404025.2 non canonical other ENST00000421745.2 NP_057336 ENST00000414054.1 GENCODE experimental pipeline ENST00000440786.1 GENCODE experimental pipeline ENST00000402934.1 not organism-supported ENST00000468091.2 non_canonical splice donor at exon 4 ENST00000437184.1 alternative 5' UTR ENST00000403687.3 alternative 5' UTR ENST00000425210.1 alternative 5' UTR ENST00000444784.1 alternative 5' UTR ENST00000423159.1 alternative 5' UTR ENST00000407811.1 alternative 5' UTR ENST00000437680.1 GENCODE experimental pipeline ENST00000403368.1 non-organism_supported ENST00000492649.1 non-organism_supported ENST00000366209.2 non canonical other ENST00000442026.1 GENCODE experimental pipeline ENST00000422558.1 GENCODE experimental pipeline ENST00000423663.1 GENCODE experimental pipeline ENST00000453451.1 GENCODE experimental pipeline ENST00000414796.1 GENCODE experimental pipeline ENST00000404084.1 not organism-supported ENST00000411537.1 alternative 5' UTR ENST00000390013.3 alternative 5' UTR ENST00000433192.1 alternative 5' UTR ENST00000416345.1 alternative 5' UTR ENST00000420611.1 alternative 5' UTR ENST00000406711.1 alternative 5' UTR ENST00000397226.2 alternative 5' UTR ENST00000438935.2 GENCODE experimental pipeline ENST00000416653.1 alternative 5' UTR ENST00000432075.1 alternative 5' UTR ENST00000432075.1 not organism-supported ENST00000419278.2 not organism-supported ENST00000433893.1 GENCODE experimental pipeline ENST00000453555.1 alternative 5' UTR ENST00000431712.1 GENCODE experimental pipeline ENST00000414644.1 alternative 5' UTR ENST00000414644.1 not organism-supported ENST00000406384.1 alternative 5' UTR ENST00000407257.1 non-organism_supported ENST00000402091.3 non-organism_supported ENST00000496735.1 non-organism_supported ENST00000414365.1 GENCODE experimental pipeline ENST00000494864.1 not organism-supported ENST00000407341.1 alternative 5' UTR ENST00000407341.1 not organism-supported ENST00000427168.2 non canonical polymorphism ENST00000417213.1 GENCODE experimental pipeline ENST00000450854.1 GENCODE experimental pipeline ENST00000419554.2 NP_071769.1 ENST00000417039.1 GENCODE experimental pipeline ENST00000457385.1 GENCODE experimental pipeline ENST00000272249.3 non canonical U12 ENST00000410076.1 non canonical U12 ENST00000488099.1 non canonical U12 ENST00000446277.1 GENCODE experimental pipeline ENST00000425941.2 not organism-supported ENST00000487773.1 not organism-supported ENST00000417233.1 alternative 5' UTR ENST00000442829.1 GENCODE experimental pipeline ENST00000410014.1 alternative 5' UTR ENST00000410014.1 not organism-supported ENST00000409665.1 alternative 5' UTR ENST00000409077.2 not organism-supported ENST00000409131.2 alternative 5' UTR ENST00000409978.1 GENCODE experimental pipeline ENST00000486958.1 not organism-supported ENST00000411874.1 not organism-supported ENST00000430382.1 not organism-supported ENST00000426016.1 non canonical conserved ENST00000472480.1 not organism-supported ENST00000420644.1 GENCODE experimental pipeline ENST00000419111.1 not organism-supported ENST00000437545.1 not organism-supported ENST00000449569.1 FLJ37859 ENST00000438649.1 FLJ33477 ENST00000403537.3 FLJ97702 ENST00000439606.1 GENCODE experimental pipeline ENST00000406785.1 alternative 5' UTR ENST00000407929.2 not organism-supported ENST00000405269.1 alternative 5' UTR ENST00000405269.1 not organism-supported ENST00000455476.1 alternative 5' UTR ENST00000448531.1 alternative 5' UTR ENST00000417271.1 alternative 5' UTR ENST00000431359.1 GENCODE experimental pipeline ENST00000418836.2 GENCODE experimental pipeline ENST00000398796.2 GENCODE experimental pipeline ENST00000427054.1 GENCODE experimental pipeline ENST00000378711.2 GENCODE experimental pipeline ENST00000451514.1 GENCODE experimental pipeline ENST00000294964.5 NP_612379.2 ENST00000401498.2 non-organism_supported ENST00000475241.1 non-organism_supported ENST00000490302.1 non-organism_supported ENST00000422013.2 GENCODE experimental pipeline ENST00000401738.3 not organism-supported ENST00000423797.2 GENCODE experimental pipeline ENST00000405592.1 FLJ45312 ENST00000406652.1 KIAA126 ENST00000409019.1 non-organism_supported ENST00000482875.1 FLJ16152 ENST00000453565.1 non-organism_supported ENST00000457457.2 GENCODE experimental pipeline ENST00000422351.1 GENCODE experimental pipeline ENST00000438736.1 GENCODE experimental pipeline ENST00000434020.1 GENCODE experimental pipeline ENST00000474159.2 not organism-supported ENST00000423354.1 GENCODE experimental pipeline ENST00000409659.1 non-organism_supported ENST00000419807.1 non-organism_supported ENST00000419807.1 alternative 5' UTR ENST00000409473.2 not organism-supported ENST00000409411.1 non-organism_supported ENST00000409411.1 alternative 5' UTR ENST00000409957.1 non-organism_supported ENST00000409272.1 alternative 5' UTR ENST00000410081.1 non-organism_supported ENST00000540817.1 NMD candidate ENST00000438314.1 alternative 5' UTR ENST00000425325.2 GENCODE experimental pipeline ENST00000423433.1 GENCODE experimental pipeline ENST00000378479.1 GENCODE experimental pipeline ENST00000442821.1 GENCODE experimental pipeline ENST00000449347.1 alternative 5' UTR ENST00000418415.1 GENCODE experimental pipeline ENST00000434431.1 cDNA Em:BC110240.1 ignored due to repetitive nature of sequence ENST00000522587.1 alternative 5' UTR ENST00000474980.1 alternative 5' UTR ENST00000486447.1 not organism-supported ENST00000394861.2 alternative 5' UTR ENST00000490950.1 possible open reading frame in this gene object ENST00000453936.1 GENCODE experimental pipeline ENST00000429761.1 GENCODE experimental pipeline ENST00000409105.1 non-organism_supported ENST00000409105.1 alternative 5' UTR ENST00000409105.1 not organism-supported ENST00000409800.1 alternative 5' UTR ENST00000409207.1 alternative 5' UTR ENST00000409973.1 alternative 5' UTR ENST00000409218.1 alternative 5' UTR ENST00000412438.1 alternative 5' UTR ENST00000417180.1 alternative 5' UTR ENST00000461601.1 chimeric cDNA. Left as transcript ENST00000422201.1 GENCODE experimental pipeline ENST00000421759.1 GENCODE experimental pipeline ENST00000448713.1 GENCODE experimental pipeline ENST00000426892.1 GENCODE experimental pipeline ENST00000418539.1 Evidence not in zmap, see Entrez Gene AF020057 for sequence ENST00000449451.2 dotter required to determine structure ENST00000449451.2 GENCODE experimental pipeline ENST00000435331.3 GENCODE experimental pipeline ENST00000454137.1 GENCODE experimental pipeline ENST00000432064.1 GENCODE experimental pipeline ENST00000447571.1 GENCODE experimental pipeline ENST00000404752.1 alternative 5' UTR ENST00000405008.1 confirmed by NM_172311.1 ENST00000394754.1 alternative 5' UTR ENST00000403751.3 Confirmed by NM_006872.2 NM_172311.1 and NM_172196.1 ENST00000304421.4 NP_852111.2 ENST00000401710.1 Supported by Tr:Q6ZQ56.1 which is mouse evidence for NRXN3 not NRXN1 ENST00000405472.3 not organism-supported ENST00000496792.1 Possibly ENST00000416262.1 GENCODE experimental pipeline ENST00000421074.1 no protein supporting evidence - annotated as it was identified by Yale and UCSC groups as part of the ENCODE project ENST00000418451.1 GENCODE experimental pipeline ENST00000406053.1 not organism-supported ENST00000263634.2 NP_057199.1 ENST00000406687.1 NP_665862.1 ENST00000406687.1 alternative 5' UTR ENST00000394717.2 NP_665862.1 ENST00000482134.1 not organism-supported ENST00000295304.4 NP_001008708.1 ENST00000394705.2 NP_006785.1 ENST00000398634.2 NP_001093866.1 ENST00000356805.4 NP_003119.2 ENST00000389980.3 alternative 5' UTR ENST00000333896.5 NP_842565.2 ENST00000433475.1 GENCODE experimental pipeline ENST00000456363.1 GENCODE experimental pipeline ENST00000481376.2 missing bases ENST00000394609.2 NP_008939.1 ENST00000405240.1 NP_997404.1 ENST00000405240.1 alternative 5' UTR ENST00000357376.3 NP_997404.1 ENST00000357376.3 alternative 5' UTR ENST00000337526.6 NP_997404.1 ENST00000317610.7 NP_722550.1 ENST00000357732.4 NP_997403.1 ENST00000394611.2 NP_997404.1 ENST00000394611.2 alternative 5' UTR ENST00000404909.1 NP_997404.1 ENST00000427710.1 alternative 5' UTR ENST00000407122.1 alternative 5' UTR ENST00000407122.1 not organism-supported ENST00000401408.1 NP_001129070.1 ENST00000451916.1 alternative 5' UTR ENST00000403506.1 alternative 5' UTR ENST00000425841.1 alternative 5' UTR ENST00000402285.3 alternative 5' UTR ENST00000272317.6 NP_002945.1 ENST00000449323.1 alternative 5' UTR ENST00000404735.1 alternative 5' UTR ENST00000403721.1 alternative 5' UTR ENST00000446660.1 Probable_NMD_if_extended ENST00000446660.1 alternative 5' UTR ENST00000366137.2 alternative 5' UTR ENST00000441307.1 alternative 5' UTR ENST00000404297.1 alternative 5' UTR ENST00000420637.1 alternative 5' UTR ENST00000417363.1 alternative 5' UTR ENST00000412530.1 alternative 5' UTR ENST00000295112.8 not organism-supported ENST00000263630.8 NM_018084.3 ENST00000412148.1 alternative 5' UTR ENST00000366287.3 GENCODE experimental pipeline ENST00000349456.4 NP_542398 ENST00000407816.3 not organism-supported ENST00000272313.5 NP_065196.1 ENST00000415374.1 not organism-supported ENST00000355426.3 alternative 5' UTR ENST00000438672.1 alternative 5' UTR ENST00000439193.1 alternative 5' UTR ENST00000440439.1 alternative 5' UTR ENST00000429909.1 alternative 5' UTR ENST00000452337.1 alternative 5' UTR ENST00000424207.1 alternative 5' UTR ENST00000446139.1 GENCODE experimental pipeline ENST00000451034.1 GENCODE experimental pipeline ENST00000432793.1 GENCODE experimental pipeline ENST00000454367.1 GENCODE experimental pipeline ENST00000409590.1 GENCODE experimental pipeline ENST00000415159.1 GENCODE experimental pipeline ENST00000457668.1 GENCODE experimental pipeline ENST00000453476.1 GENCODE experimental pipeline ENST00000356842.4 NP_060484.2 ENST00000359629.5 NP_612569.1 ENST00000489516.2 not organism-supported ENST00000335712.6 NP_075044.2 ENST00000238714.3 NP_075045.2 ENST00000452343.1 GENCODE experimental pipeline ENST00000407787.1 alternative 5' UTR ENST00000430495.1 NMD ENST00000482513.1 EM:BI255503.1 suggests possible poly-A tail however sequence too weak to call. Further evidence may sugest this object is coding ENST00000453186.1 NMD ENST00000402291.1 Cross-species evidence for coding region comes from EM:BC072622.1 ENST00000488469.2 not organism-supported ENST00000420918.1 GENCODE experimental pipeline ENST00000357022.2 alternative 5' UTR ENST00000489653.1 not organism-supported ENST00000493628.2 made as transcript. Sw:Q719I0.2 AA position 121 throws the reading frame out of alignment. Ensembl removes 5bp to get sequence to code ENST00000484217.1 not organism-supported ENST00000453133.1 not organism-supported ENST00000404992.2 alternative 5' UTR ENST00000406957.1 alternative 5' UTR ENST00000451765.1 alternative 5' UTR ENST00000443240.1 alternative 5' UTR ENST00000457483.1 alternative 5' UTR ENST00000449444.1 alternative 5' UTR ENST00000436018.1 alternative 5' UTR ENST00000405894.3 NP_115556.2 ENST00000425779.1 GENCODE experimental pipeline ENST00000425966.2 GENCODE experimental pipeline ENST00000405767.1 alternative 5' UTR ENST00000416845.1 GENCODE experimental pipeline ENST00000416111.1 GENCODE experimental pipeline ENST00000405482.1 alternative 5' UTR ENST00000427809.1 alternative 5' UTR ENST00000431489.1 alternative 5' UTR ENST00000452397.1 GENCODE experimental pipeline ENST00000366671.3 alternative 5' UTR ENST00000272321.7 NP_056994 ENST00000409120.1 alternative 5' UTR ENST00000484142.1 alternative 5' UTR ENST00000482668.1 alternative 5' UTR ENST00000467648.2 alternative 5' UTR ENST00000480679.1 alternative 5' UTR ENST00000488245.2 alternative 5' UTR ENST00000475462.1 alternative 5' UTR ENST00000491621.1 alternative 5' UTR ENST00000472047.1 alternative 5' UTR ENST00000423539.1 GENCODE experimental pipeline ENST00000438115.1 GENCODE experimental pipeline ENST00000448204.1 GENCODE experimental pipeline ENST00000424119.1 GENCODE experimental pipeline ENST00000441630.1 GENCODE experimental pipeline ENST00000436433.1 GENCODE experimental pipeline ENST00000445738.1 GENCODE experimental pipeline ENST00000439964.1 GENCODE experimental pipeline ENST00000445865.1 GENCODE experimental pipeline ENST00000449259.1 GENCODE experimental pipeline ENST00000430134.1 GENCODE experimental pipeline ENST00000440972.1 alternative 5' UTR ENST00000420724.1 GENCODE experimental pipeline ENST00000411785.1 GENCODE experimental pipeline ENST00000428647.1 GENCODE experimental pipeline ENST00000454167.1 GENCODE experimental pipeline ENST00000496248.1 alternative 5' UTR ENST00000560281.1 not organism-supported ENST00000542964.1 not organism-supported ENST00000439433.1 GENCODE experimental pipeline ENST00000412944.1 GENCODE experimental pipeline ENST00000451698.1 GENCODE experimental pipeline ENST00000411701.1 GENCODE experimental pipeline ENST00000444266.1 GENCODE experimental pipeline ENST00000452716.1 GENCODE experimental pipeline ENST00000433133.1 GENCODE experimental pipeline ENST00000445514.1 GENCODE experimental pipeline ENST00000433065.1 GENCODE experimental pipeline ENST00000419809.1 GENCODE experimental pipeline ENST00000457448.1 GENCODE experimental pipeline ENST00000407324.1 GENCODE experimental pipeline ENST00000410067.3 alternative 5' UTR ENST00000409302.1 alternative 5' UTR ENST00000295121.6 FLJ31741 ENST00000366218.2 GENCODE experimental pipeline ENST00000445692.1 not organism-supported ENST00000479844.1 not organism-supported ENST00000415138.1 GENCODE experimental pipeline ENST00000415448.1 GENCODE experimental pipeline ENST00000328895.4 NP_872342.2 ENST00000377938.2 NP_062563.3 ENST00000303714.4 NP_115584.1 ENST00000409829.3 NP_060623.2 ENST00000409349.3 NP_444262.1 ENST00000462320.1 alternative 5' UTR ENST00000484177.1 alternative 5' UTR ENST00000409085.3 NP_055726.3 ENST00000415342.1 GENCODE experimental pipeline ENST00000282570.3 NP_848526.1 ENST00000435880.2 FLJ25084 ENST00000432604.1 non canonical TEC ENST00000424748.1 GENCODE experimental pipeline ENST00000414141.1 GENCODE experimental pipeline ENST00000264434.2 FLJ20558 ENST00000445587.1 not organism-supported ENST00000264441.5 not organism-supported ENST00000037869.3 FLJ14668 ENST00000441238.1 GENCODE experimental pipeline ENST00000407644.2 alternative 5' UTR ENST00000456320.2 not organism-supported ENST00000413157.2 alternative 5' UTR ENST00000430656.1 alternative 5' UTR ENST00000415348.1 alternative 5' UTR ENST00000425976.1 alternative 5' UTR ENST00000447731.1 alternative 5' UTR ENST00000457851.1 GENCODE experimental pipeline ENST00000272367.2 protein evidence is not full length ENST00000410009.3 non canonical conserved ENST00000449073.2 GENCODE experimental pipeline ENST00000422761.1 GENCODE experimental pipeline ENST00000272421.6 FLJ12056 ENST00000416229.1 GENCODE experimental pipeline ENST00000434990.1 GENCODE experimental pipeline ENST00000418807.3 not organism-supported ENST00000443938.2 not organism-supported ENST00000428360.2 not organism-supported ENST00000264447.4 NP_001014972.1 and NP_055312.2 ENST00000409544.1 alternative 5' UTR ENST00000455226.1 alternative 5' UTR ENST00000454278.1 alternative 5' UTR ENST00000437658.1 alternative 5' UTR ENST00000417778.1 alternative 5' UTR ENST00000454122.1 alternative 5' UTR ENST00000434786.1 GENCODE experimental pipeline ENST00000429174.2 NP_001124450 ENST00000001146.2 NP_063938.1 ENST00000272427.6 NP_056004.1 ENST00000410112.2 not organism-supported ENST00000480093.1 not organism-supported ENST00000441587.1 GENCODE experimental pipeline ENST00000272444.3 NP_003575.2 ENST00000409561.1 GENCODE experimental pipeline ENST00000409707.1 alternative 5' UTR ENST00000452725.1 alternative 5' UTR ENST00000432295.2 alternative 5' UTR ENST00000424659.1 alternative 5' UTR ENST00000438902.2 not organism-supported ENST00000345517.3 Protein evidence has an amino acid insertion at position 3 and an amino acid change from E to D at position 6 ENST00000409624.1 alternative 5' UTR ENST00000439192.1 GENCODE experimental pipeline ENST00000305799.7 not organism-supported ENST00000409262.2 NP_659430.1 ENST00000409262.2 not organism-supported ENST00000295326.4 NP_001030582.1 ENST00000469676.1 not organism-supported ENST00000423477.2 GENCODE experimental pipeline ENST00000394053.2 protein evidence starts at an internal methionine ENST00000409804.1 not organism-supported ENST00000394019.2 NP_597812 ENST00000377634.4 NP_067019 ENST00000444570.1 alternative 5' UTR ENST00000436454.1 alternative 5' UTR ENST00000426715.1 GENCODE experimental pipeline ENST00000412957.1 not organism-supported ENST00000482605.1 non-organism_supported ENST00000460968.1 non-organism_supported ENST00000233331.7 Protein evidence starts at an internal methionine ENST00000409493.2 non-organism_supported ENST00000469849.1 non-organism_supported ENST00000455562.1 non-organism_supported ENST00000466835.1 non-organism_supported ENST00000428943.1 non-organism_supported ENST00000290418.4 FLJ14397 ENST00000471713.1 non-organism_supported ENST00000474681.1 non-organism_supported ENST00000233630.6 FLJ43754 ENST00000393951.2 a/gc-cag\ splicing between exons 1 and 2 ENST00000393951.2 alternative 5' UTR ENST00000393951.2 FLJ23757 ENST00000404568.3 NP_598376 ENST00000473508.1 FLJ35101 ENST00000425118.1 Unlikely to code as probably would undergo NMD ENST00000377526.3 NP_853553.1 ENST00000377526.3 corf ENST00000409249.1 non-organism_supported ENST00000409549.1 alternative 5' UTR ENST00000413469.1 alternative 5' UTR ENST00000484369.1 non-organism_supported ENST00000496966.1 not organism-supported ENST00000290536.5 D6Mm5e ENST00000290536.5 FLJ44410 ENST00000409585.1 GENCODE experimental pipeline ENST00000421985.1 alternative 5' UTR ENST00000453951.1 GENCODE experimental pipeline ENST00000424400.1 non-organism_supported ENST00000393913.3 FLJ13391 ENST00000410113.1 alternative 5' UTR ENST00000410010.1 non-organism_supported ENST00000410071.1 alternative 5' UTR ENST00000432649.1 alternative 5' UTR ENST00000452003.1 alternative 5' UTR ENST00000444852.1 GENCODE experimental pipeline ENST00000451622.1 GENCODE experimental pipeline ENST00000445178.1 GENCODE experimental pipeline ENST00000437233.1 GENCODE experimental pipeline ENST00000438443.1 GENCODE experimental pipeline ENST00000447303.1 ribosomal protein L38 (PRL38) pseudogene ENST00000415201.1 GENCODE experimental pipeline ENST00000466387.1 alternative 5' UTR ENST00000451966.1 alternative 5' UTR ENST00000409971.2 alternative 5' UTR ENST00000443301.1 GENCODE experimental pipeline ENST00000508970.1 GENCODE experimental pipeline ENST00000418621.1 GENCODE experimental pipeline ENST00000409148.1 alternative 5' UTR ENST00000416268.1 alternative 5' UTR ENST00000452811.1 not organism-supported ENST00000452811.1 alternative 5' UTR ENST00000415098.1 alternative 5' UTR ENST00000430876.1 GENCODE experimental pipeline ENST00000450290.1 GENCODE experimental pipeline ENST00000446580.1 GENCODE experimental pipeline ENST00000426710.1 non-organism supported ENST00000455845.1 GENCODE experimental pipeline ENST00000437290.2 GENCODE experimental pipeline ENST00000441039.1 non-organism_supported ENST00000428871.1 non-organism_supported ENST00000419540.1 non-organism_supported ENST00000440495.1 GENCODE experimental pipeline ENST00000393868.2 protein evidence starts at internal methionine ENST00000393868.2 NP_003840.2 ENST00000430989.1 Probable_NMD_if_extended ENST00000237449.6 Q9C0G6-1 ENST00000494025.1 alternative 5' UTR ENST00000335459.5 NP_001074293.1 ENST00000409785.3 non-canonical splice sites between exons 4 and 5 ENST00000428691.1 alternative 5' UTR ENST00000453448.1 non-canonical splice sites between exons 4 and 5 ENST00000433581.1 GENCODE experimental pipeline ENST00000377386.3 NP_006455.2 ENST00000295802.4 FLJ90780 ENST00000295802.4 NP_060220.2 ENST00000475624.2 non-canonical splice sites between exons 2 and 3 ENST00000409331.2 alternative 5' UTR ENST00000490508.1 not organism-supported ENST00000423095.3 not organism-supported ENST00000409344.3 alternative 5' UTR ENST00000393852.4 alternative 5' UTR ENST00000418268.1 alternative 5' UTR ENST00000409724.1 alternative 5' UTR ENST00000439385.1 alternative 5' UTR ENST00000449030.1 alternative 5' UTR ENST00000447219.2 alternative 5' UTR ENST00000409275.1 alternative 5' UTR ENST00000415012.1 robable_NMD_if_extended ENST00000340326.2 NP_940884.1 ENST00000306368.4 NP_057578.1 ENST00000306353.3 NP_699173.1 ENST00000334462.5 FLJ90024 ENST00000334462.5 NP_001026908.1 ENST00000409668.1 alternative 5' UTR ENST00000425160.1 alternative 5' UTR ENST00000467885.2 not organism-supported ENST00000306336.5 NP_001013671.2 ENST00000519937.1 alternative 3' UTR ENST00000409383.1 NP_942140.2 ENST00000263863.4 NP_006424.2 ENST00000409696.3 NP_036615.2 ENST00000306279.3 NP_116216.1 ENST00000366278.2 GENCODE experimental pipeline ENST00000393808.3 NP_001035902.1 ENST00000377332.3 NP_003887.3 ENST00000455892.1 alternative 5' UTR ENST00000409681.1 not organism-supported ENST00000254630.7 NP_060422.4 ENST00000410111.3 NP_006830.2 ENST00000254644.7 NP_663619.1 isoform b ENST00000337109.4 NP_057706.2 isoform a ENST00000452034.1 alternative 5' UTR ENST00000409064.1 alternative 5' UTR ENST00000427678.1 alternative 5' UTR ENST00000263856.4 NP_057163.1 isoform 1 ENST00000409225.2 NP_001005753.1 ENST00000426549.1 GENCODE experimental pipeline ENST00000424788.1 not organism-supported ENST00000283635.3 There is an upstream methonine but there is published evidence to show that this gene starts at an internal methionine ENST00000409511.2 alternative 5' UTR ENST00000409781.1 not organism-supported ENST00000393759.2 NP_742099.1 ENST00000349455.3 NP_742100.1 ENST00000331469.2 NP_757362.1 ENST00000390655.6 NP_004922.1 ENST00000559485.1 NP_001019628.2 ENST00000355705.3 NP_001027564 ENST00000426110.1 NP_073153.1 ENST00000427434.1 ANAPC1: NP_073153.1 ENST00000419759.1 alternative 5' UTR ENST00000324166.5 FLJ10916 ENST00000324166.5 NP_060741.3 ENST00000303254.3 FLJ25369 ENST00000413234.1 GENCODE experimental pipeline ENST00000453008.2 GENCODE experimental pipeline ENST00000283646.3 protein evidence starts at an internal methionine ENST00000452230.1 GENCODE experimental pipeline ENST00000390243.2 IGKV4-1*01 allele ENST00000390244.2 IGKV5-2*01 allele ENST00000496168.1 IGLV1-5*01 allele ENST00000464162.1 IGLKV1-6*01 allele ENST00000390247.2 This gene is an ORF due to the mutation in the acceptor splice (nggnn instead of nagnn) ENST00000495489.1 IGKV1-8*01 allele ENST00000495489.1 This gene is one of the five ORF genes of the IGKV1 subgroup in the IGK locus. ORF due to a 21nt deletion starting at nucleotide 4 of the DECAMER in the promoter ENST00000493819.1 IGKV1-9*01 allele ENST00000521705.1 This gene is a pseudogene due to the conserved TRP being replaced by a STOP codon at position 41 in FR2-IMGT ENST00000390256.2 This gene is an ORF due to a non-canonical V-heptamer sequence: cactgtg instead of cacagtg ENST00000465170.1 This gene is an ORF due to the 2nd CYS (position 104 in the FR3-IMGT) being replaced by a Glycine (ggt) ENST00000498574.1 IGKV1-39*01 allele ENST00000498574.1 This gene is one of the 15-16 functional genes in the IGKV1 subgroup ENST00000429992.2 F ENST00000429992.2 IGKV2D-40*01 ENST00000448155.2 F ENST00000448155.2 IGKV1D-39*01 ENST00000509129.1 IGKV1D-37*01 ENST00000509129.1 ORF ENST00000390265.2 IGKV1D-33*01 allele ENST00000453166.2 IGKV2D-28*01 allele ENST00000462693.1 IGKV2D-24*01 allele ENST00000436451.2 IGKV6D-21*01 allele ENST00000436451.2 This gene is an ORF due to a non-canonical V-heptamer: cactgtg instead of cacagtg ENST00000390270.2 IGKV3D-20*01 allele ENST00000390271.2 IGKV6D-41*01 allele ENST00000390271.2 This gene is an ORF due to a non-canonical V-heptamer: cactgtg instead of cacagtg ENST00000483379.1 IGKV1D-17*01 allele ENST00000492446.1 This is one of the 15-16 functional genes of the IGKV1 subgroup and it is located in the distal cluster of the IGK locus ENST00000417279.2 This IGKV3D-15*01 allele is a functional member of te IGKV3 subgroup ENST00000390275.2 This gene is an ORF due to an non-canonical V-heptamer (catagtg instead of cacagtg) ENST00000390276.2 The IGKV1D-12 is one of the 15-16 functional genes of the IGKV1 subgroup. IGKV1D-12 is in the distal cluster ENST00000390277.2 This is one of the 6-7 functional genes of the IGK3 subgroup. The IGKV3D-11*01 allele is in the distal cluster of the IGK locus ENST00000390278.2 The IGKV1D-42*01 is one of five ORF genes of the IGKV1 subgroup. It is an ORF due to a nucleotide mutation in the core sequence of the decamer, and to an altered V-heptamer (cacaggg instead of cacagtg) ENST00000468879.1 This is one of the 15-16 functional genes of the IGKV1 subgroup. This IGLKV1D-43*01 allele is in the distal cluster of the IGK locus ENST00000471857.1 This is one of the 15-16 functional genes of the IGKV1 subgroup. The IGKV1D-8*01 allele is in the distal cluster of the IGK locus ENST00000423080.2 One of 6 or 7 functional genes of the IGKV3 subgroup. This gene is part of the distal cluster ENST00000423080.2 IGKV3D-7*01 allele ENST00000448734.1 GENCODE experimental pipeline ENST00000349807.3 NP_071885.1 ENST00000442200.1 GENCODE experimental pipeline ENST00000411425.1 alternative 5' UTR ENST00000398107.2 NP_001017396.1 ENST00000425953.1 GENCODE experimental pipeline ENST00000403131.2 alternative 3' UTR ENST00000377181.2 not organism-supported ENST00000468529.1 NP_001030086.1 ENST00000445649.1 alternative 5' UTR ENST00000447036.1 alternative 5' UTR ENST00000418606.1 alternative 5' UTR ENST00000425887.1 GENCODE experimental pipeline ENST00000412393.1 GENCODE experimental pipeline ENST00000359548.4 alternative 5' UTR ENST00000471757.1 GENCODE experimental pipeline ENST00000439254.1 alternative 5' UTR ENST00000449242.1 GENCODE experimental pipeline ENST00000337288.5 NP_064536.2 ENST00000446816.1 GENCODE experimental pipeline ENST00000258439.2 FLJ20507 ENST00000432959.1 alternative 5' UTR ENST00000421534.1 GENCODE experimental pipeline ENST00000425578.1 GENCODE experimental pipeline ENST00000354204.6 NP_060461.3 ENST00000425656.1 GENCODE experimental pipeline ENST00000452268.1 alternative 5' UTR ENST00000418735.1 alternative 5' UTR ENST00000424961.2 non canonical TEC ENST00000424961.2 non canonical conserved ENST00000377060.3 NP_951060.1 ENST00000305510.3 NP_060093.3 ENST00000418232.1 alternative 3' UTR ENST00000442264.1 alternative 5' UTR ENST00000449330.1 alternative 5' UTR ENST00000414820.1 alternative 5' UTR ENST00000463096.1 not best-in-genome evidence ENST00000468548.1 not best-in-genome evidence ENST00000421946.2 GENCODE experimental pipeline ENST00000422600.1 GENCODE experimental pipeline ENST00000492960.1 GENCODE experimental pipeline ENST00000359901.4 FLJ21281 ENST00000464949.1 non-organism_supported ENST00000451384.2 GENCODE experimental pipeline ENST00000409490.1 GENCODE experimental pipeline ENST00000454230.1 alternative 5' UTR ENST00000413274.1 GENCODE experimental pipeline ENST00000409347.1 alternative 5' UTR ENST00000409391.1 non-organism_supported ENST00000409391.1 alternative 5' UTR ENST00000484936.1 non-organism_supported ENST00000460768.1 non-organism_supported ENST00000419865.1 GENCODE experimental pipeline ENST00000448595.1 GENCODE experimental pipeline ENST00000410001.1 alternative 5' UTR ENST00000355053.4 alternative 5' UTR ENST00000409564.2 non-organism_supported ENST00000478090.1 non-organism_supported ENST00000409684.1 alternative 5' UTR ENST00000449211.1 alternative 5' UTR ENST00000434566.1 alternative 5' UTR ENST00000415142.1 alternative 5' UTR ENST00000436234.1 alternative 5' UTR ENST00000422537.2 non-organism_supported ENST00000423306.1 non-organism_supported ENST00000423306.1 alternative 5' UTR ENST00000409448.1 alternative 5' UTR ENST00000422767.2 non-organism_supported ENST00000409705.1 alternative 5' UTR ENST00000423966.1 alternative 5' UTR ENST00000441400.1 alternative 5' UTR ENST00000424600.1 alternative 5' UTR ENST00000416492.1 alternative 5' UTR ENST00000427118.1 alternative 5' UTR ENST00000483600.1 alternative 5' UTR ENST00000452354.1 GENCODE experimental pipeline ENST00000409701.1 alternative 5' UTR ENST00000409046.1 alternative 5' UTR ENST00000420858.1 alternative 5' UTR ENST00000421474.1 alternative 5' UTR ENST00000418201.1 alternative 5' UTR ENST00000435960.1 alternative 5' UTR ENST00000485085.1 alternative 5' UTR ENST00000466583.1 alternative 5' UTR ENST00000414647.1 GENCODE experimental pipeline ENST00000414965.1 GENCODE experimental pipeline ENST00000443030.1 GENCODE experimental pipeline ENST00000430586.1 GENCODE experimental pipeline ENST00000446644.1 GENCODE experimental pipeline ENST00000452364.1 GENCODE experimental pipeline ENST00000409733.1 alternative 5' UTR ENST00000456292.1 alternative 5' UTR ENST00000427042.1 GENCODE experimental pipeline ENST00000427603.1 alternative 5' UTR ENST00000393414.2 alternative 5' UTR ENST00000457817.1 alternative 5' UTR ENST00000452403.1 alternative 5' UTR ENST00000409929.1 alternative 5' UTR ENST00000409589.1 not organism-supported ENST00000450319.1 alternative 5' UTR ENST00000428279.1 alternative 5' UTR ENST00000428279.1 not organism-supported ENST00000442590.1 alternative 5' UTR ENST00000428188.1 GENCODE experimental pipeline ENST00000421464.1 alternative 5' UTR ENST00000447231.1 alternative 5' UTR ENST00000311734.2 NP_003847.2 ENST00000410040.1 alternative 5' UTR ENST00000450855.1 alternative 5' UTR ENST00000436582.1 GENCODE experimental pipeline ENST00000450893.1 GENCODE experimental pipeline ENST00000437075.2 not organism-supported ENST00000454536.1 alternative 5' UTR ENST00000431897.1 GENCODE experimental pipeline ENST00000435291.1 GENCODE experimental pipeline ENST00000422683.1 GENCODE experimental pipeline ENST00000455716.1 GENCODE experimental pipeline ENST00000447761.1 GENCODE experimental pipeline ENST00000458182.1 GENCODE experimental pipeline ENST00000416008.1 GENCODE experimental pipeline ENST00000449772.1 GENCODE experimental pipeline ENST00000451400.1 GENCODE experimental pipeline ENST00000430551.2 GENCODE experimental pipeline ENST00000424257.1 GENCODE experimental pipeline ENST00000438566.1 GENCODE experimental pipeline ENST00000453322.1 GENCODE experimental pipeline ENST00000361360.2 not organism-supported ENST00000432211.1 GENCODE experimental pipeline ENST00000393359.2 NP_004248 ENST00000433219.1 GENCODE experimental pipeline ENST00000258457.2 FLJ45759 ENST00000409177.1 alternative 5' UTR ENST00000393353.3 alternative 5' UTR ENST00000393352.3 alternative 5' UTR ENST00000322142.8 alternative 5' UTR ENST00000408995.1 alternative 5' UTR ENST00000447958.1 alternative 5' UTR ENST00000415627.1 GENCODE experimental pipeline ENST00000457290.1 GENCODE experimental pipeline ENST00000393348.2 alternative 5' UTR ENST00000425756.1 alternative 5' UTR ENST00000393349.2 alternative 5' UTR ENST00000427050.1 GENCODE experimental pipeline ENST00000413151.1 GENCODE experimental pipeline ENST00000416298.1 alternative 5' UTR ENST00000444193.1 alternative 5' UTR ENST00000436241.1 alternative 5' UTR ENST00000419904.1 GENCODE experimental pipeline ENST00000431411.1 GENCODE experimental pipeline ENST00000451464.1 GENCODE experimental pipeline ENST00000409382.3 alternative 5' UTR ENST00000419159.2 alternative 5' UTR ENST00000446058.1 GENCODE experimental pipeline ENST00000443123.1 GENCODE experimental pipeline ENST00000422203.2 GENCODE experimental pipeline ENST00000422203.2 non-organism_supported ENST00000422203.2 not organism-supported ENST00000414300.1 bp 295 to 298 of EST DA176337.1 do not appear to match to genome ENST00000414300.1 GENCODE experimental pipeline ENST00000439893.1 GENCODE experimental pipeline ENST00000441383.1 GENCODE experimental pipeline ENST00000457647.1 GENCODE experimental pipeline ENST00000409059.1 contains a NAG/NAG splice junction at exon two ENST00000424355.1 GENCODE experimental pipeline ENST00000424355.1 non-organism_supported ENST00000424355.1 not organism-supported ENST00000409067.2 not organism-supported ENST00000427208.1 GENCODE experimental pipeline ENST00000322353.3 GENCODE experimental pipeline ENST00000332345.6 alternative 5' UTR ENST00000338045.3 alternative 5' UTR ENST00000411710.1 GENCODE experimental pipeline ENST00000425282.2 not organism-supported ENST00000409271.1 alternative 5' UTR ENST00000418513.1 gene fragments AC139850.1 and AC140485.1 are part of the same gene; an assembly gap between them contains one or more exons ENST00000444352.1 gene fragments AC140485.1 and AC139850.1 are part of the same gene; an assembly gap between them contains one or more exons ENST00000437928.1 not organism-supported ENST00000411469.1 alternative 5' UTR ENST00000425576.1 GENCODE experimental pipeline ENST00000303002.5 subject to nonsense-mediated decay ENST00000537472.1 subject to nonsense-mediated decay ENST00000417926.1 GENCODE experimental pipeline ENST00000336905.3 GENCODE experimental pipeline ENST00000448359.1 GENCODE experimental pipeline ENST00000547957.1 subject to nonsense-mediated decay ENST00000456683.2 GENCODE experimental pipeline ENST00000413601.2 GENCODE experimental pipeline ENST00000329516.3 NP_001116835 ENST00000330331.5 NP_001032955 ENST00000447014.1 alternative 5' UTR ENST00000436916.1 alternative 5' UTR ENST00000414159.2 GENCODE experimental pipeline ENST00000448863.1 alternative 5' UTR ENST00000418615.1 GENCODE experimental pipeline ENST00000432179.1 alternative 5' UTR ENST00000393252.3 alternative 5' UTR ENST00000451230.1 GENCODE experimental pipeline ENST00000438897.1 GENCODE experimental pipeline ENST00000455309.1 GENCODE experimental pipeline ENST00000432268.1 GENCODE experimental pipeline ENST00000426124.1 GENCODE experimental pipeline ENST00000451367.1 non-organism_supported ENST00000446998.1 non-organism_supported ENST00000409780.1 non-organism_supported ENST00000441565.1 non-organism_supported ENST00000502881.1 GENCODE experimental pipeline ENST00000438748.1 alternative 5' UTR ENST00000430769.1 alternative 5' UTR ENST00000458012.2 non-organism_supported ENST00000414784.1 GENCODE experimental pipeline ENST00000436885.1 GENCODE experimental pipeline ENST00000480984.1 non-organism_supported ENST00000302450.6 FLJ40629 ENST00000418817.1 alternative 5' UTR ENST00000432018.1 alternative 5' UTR ENST00000416750.1 alternative 5' UTR ENST00000447128.1 alternative 5' UTR ENST00000393200.2 alternative 5' UTR ENST00000437409.1 alternative 5' UTR ENST00000514072.1 GENCODE experimental pipeline ENST00000393197.2 alternative 5' UTR ENST00000409052.1 alternative 5' UTR ENST00000409930.3 alternative 5' UTR ENST00000446590.1 GENCODE experimental pipeline ENST00000333145.5 GENCODE experimental pipeline ENST00000422178.1 GENCODE experimental pipeline ENST00000449954.1 PUTATIVE novel protein ENST00000450636.1 PUTATIVE novel protein (variant 2) ENST00000433106.2 PUTATIVE novel protein (variant 1) ENST00000432583.1 PUTATIVE novel protein (variant 2) ENST00000446648.1 PUTATIVE novel protein (variant 1) ENST00000437401.1 pseudogene similar to part of DEAD/H (Asp-Glu-Ala-Asp/His) box (S.cerevisiae CHL1-like helicase) (variant 1) ENST00000457993.1 pseudogene similar to part of DEAD/H (Asp-Glu-Ala-Asp/His) box (S.cerevisiae CHL1-like helicase) (variant 2) ENST00000449021.1 RPL23A (60S ribosomal protein L23A) pseudogene ENST00000413545.1 alternative 5' UTR ENST00000409121.2 non-organism_supported ENST00000409121.2 alternative 5' UTR ENST00000439382.1 GENCODE experimental pipeline ENST00000424612.1 GENCODE experimental pipeline ENST00000470204.2 non-organism_supported ENST00000446401.1 GENCODE experimental pipeline ENST00000412690.1 GENCODE experimental pipeline ENST00000420161.1 GENCODE experimental pipeline ENST00000461250.1 FLJ30694 ENST00000417844.1 GENCODE experimental pipeline ENST00000446992.1 not organism-supported ENST00000432658.1 GENCODE experimental pipeline ENST00000376300.2 FLJ10996 ENST00000319432.5 GENCODE experimental pipeline ENST00000319432.5 not organism-supported ENST00000414886.1 GENCODE experimental pipeline ENST00000295206.5 not organism-supported ENST00000454260.1 GENCODE experimental pipeline ENST00000334816.7 alternative 5' UTR ENST00000409877.1 alternative 5' UTR ENST00000409523.1 alternative 5' UTR ENST00000498049.1 GENCODE experimental pipeline ENST00000409094.1 alternative 5' UTR ENST00000413602.1 GENCODE experimental pipeline ENST00000443972.1 alternative 3' UTR ENST00000401466.1 alternative 5' UTR ENST00000445518.1 alternative 5' UTR ENST00000420482.1 alternative 5' UTR ENST00000331393.4 alternative 5' UTR ENST00000443124.1 alternative 5' UTR ENST00000455707.1 GENCODE experimental pipeline ENST00000412383.1 alternative 5' UTR ENST00000437837.1 GENCODE experimental pipeline ENST00000413991.1 GENCODE experimental pipeline ENST00000432474.1 GENCODE experimental pipeline ENST00000444963.1 GENCODE experimental pipeline ENST00000418323.1 alternative 5' UTR ENST00000441053.1 GENCODE experimental pipeline ENST00000432984.1 GENCODE experimental pipeline ENST00000449975.1 alternative 5' UTR ENST00000447668.1 GENCODE experimental pipeline ENST00000435441.1 GENCODE experimental pipeline ENST00000432894.1 GENCODE experimental pipeline ENST00000451749.1 GENCODE experimental pipeline ENST00000438816.1 GENCODE experimental pipeline ENST00000431078.1 NP_570129.1 ENST00000430692.1 GENCODE experimental pipeline ENST00000435352.1 GENCODE experimental pipeline ENST00000259254.4 NP_002092.1 ENST00000409836.3 NP_058131.1 ENST00000357970.3 NP_647594.1 ENST00000348750.4 NP_647601.1 ENST00000259238.4 NP_647596.1 ENST00000346226.3 NP_647597.1 ENST00000393041.3 NP_647599.1 isoform 7 ENST00000351659.3 NP_647595.1 ENST00000352848.3 NP_004296.1 ENST00000316724.5 NP_647593.1 ENST00000409327.1 alternative 5' UTR ENST00000344908.5 alternative 5' UTR ENST00000409179.2 alternative 5' UTR ENST00000433673.1 GENCODE experimental pipeline ENST00000429925.1 alternative 5' UTR ENST00000427769.1 alternative 5' UTR ENST00000295321.4 FLJ10006 ENST00000295321.4 NP_060439.1 ENST00000436740.1 Probable_NMD_if_extended ENST00000454503.2 GENCODE experimental pipeline ENST00000409816.2 NP_001073996.1 ENST00000409816.2 non-canonical splice sites between exons 36 and 37 ENST00000437387.1 alternative 5' UTR ENST00000496841.1 non-canonical splice sites between exons 11 and 12 ENST00000409090.1 non-canonical splice sites between exons 12 and 13 ENST00000491278.1 non-canonical splice sites between exons 11 and 12 ENST00000409286.1 alternative 5' UTR ENST00000409754.1 alternative 5' UTR ENST00000409455.1 alternative 5' UTR ENST00000409808.2 alternative 5' UTR ENST00000410011.1 alternative 5' UTR ENST00000410038.1 alternative 5' UTR ENST00000409254.1 alternative 5' UTR ENST00000422034.1 alternative 5' UTR ENST00000423019.1 alternative 5' UTR ENST00000393018.3 alternative 5' UTR ENST00000322313.4 NP_060853.3 ENST00000393006.1 NP_001006624.1 ENST00000409658.3 NP_001006624.1 ENST00000408998.1 alternative 5' UTR ENST00000272647.5 NP_113633.2 ENST00000259234.6 alternative 5' UTR ENST00000424298.1 alternative 5' UTR ENST00000376723.3 NP_001020948.1 ENST00000259253.6 NP_064505.1 isoform 1 ENST00000412312.1 GENCODE experimental pipeline ENST00000413403.1 GENCODE experimental pipeline ENST00000375987.3 GENCODE experimental pipeline ENST00000450531.1 GENCODE experimental pipeline ENST00000450840.1 GENCODE experimental pipeline ENST00000433507.1 GENCODE experimental pipeline ENST00000427638.1 GENCODE experimental pipeline ENST00000310463.6 DKFZp434E2321 ENST00000433118.1 not organism-supported ENST00000441135.1 alternative 5' UTR ENST00000457492.1 not organism-supported ENST00000281871.6 FLJ14346 ENST00000409255.1 not organism-supported ENST00000451531.2 GENCODE experimental pipeline ENST00000450486.1 GENCODE experimental pipeline ENST00000422631.1 GENCODE experimental pipeline ENST00000409259.1 GENCODE experimental pipeline ENST00000419965.1 GENCODE experimental pipeline ENST00000457169.1 GENCODE experimental pipeline ENST00000409602.1 GENCODE experimental pipeline ENST00000448777.1 GENCODE experimental pipeline ENST00000321420.4 FLJ38377 ENST00000431758.1 alternative 5' UTR ENST00000458606.1 alternative 5' UTR ENST00000429282.1 FLJ33681 ENST00000429282.1 GENCODE experimental pipeline ENST00000409185.1 NP_001009993.2 ENST00000389915.3 alternative 5' UTR ENST00000409279.1 alternative 5' UTR ENST00000409279.1 non canonical polymorphism ENST00000295171.6 corf ENST00000417579.1 NP_001003891.1 ENST00000431979.1 GENCODE experimental pipeline ENST00000437330.1 GENCODE experimental pipeline ENST00000421696.2 GENCODE experimental pipeline ENST00000419784.1 GENCODE experimental pipeline ENST00000471048.1 GENCODE experimental pipeline ENST00000450509.1 GENCODE experimental pipeline ENST00000473859.1 GENCODE experimental pipeline ENST00000358991.4 alternative 5' UTR ENST00000424510.1 GENCODE experimental pipeline ENST00000432414.1 GENCODE experimental pipeline ENST00000420184.1 GENCODE experimental pipeline ENST00000428857.1 GENCODE experimental pipeline ENST00000392915.1 FLJ16628 ENST00000478805.1 FLJ23074 ENST00000437365.1 FLJ16104 ENST00000414343.1 alternative 5' UTR ENST00000452187.1 non canonical TEC ENST00000422577.1 non-organism_supported ENST00000480793.1 non-organism_supported ENST00000486532.1 non-organism_supported ENST00000429703.2 non-organism_supported ENST00000445855.1 non-organism_supported ENST00000467065.1 non-organism_supported ENST00000437007.1 GENCODE experimental pipeline ENST00000492091.1 non-organism_supported ENST00000441323.1 alternative 5' UTR ENST00000449218.1 alternative 5' UTR ENST00000463008.1 non-organism_supported ENST00000444406.1 GENCODE experimental pipeline ENST00000448672.1 GENCODE experimental pipeline ENST00000410115.1 alternative 5' UTR ENST00000485653.1 non-organism_supported ENST00000427150.1 non-organism_supported ENST00000420679.1 non-organism_supported ENST00000421326.1 GENCODE experimental pipeline ENST00000441935.1 non-organism_supported ENST00000449129.1 non-organism_supported ENST00000451117.1 non-organism_supported ENST00000389484.3 NP_061027 ENST00000437977.1 non-organism_supported ENST00000442974.1 non-organism_supported ENST00000409512.1 alternative 5' UTR ENST00000409869.1 not organism-supported ENST00000413315.1 GENCODE experimental pipeline ENST00000426716.1 GENCODE experimental pipeline ENST00000409214.1 alternative 5' UTR ENST00000437114.1 alternative 5' UTR ENST00000417450.1 alternative 5' UTR ENST00000409487.2 alternative 5' UTR ENST00000409487.2 not organism-supported ENST00000427902.1 alternative 5' UTR ENST00000392861.2 alternative 5' UTR ENST00000409211.1 alternative 5' UTR ENST00000465308.1 not organism-supported ENST00000444559.1 alternative 5' UTR ENST00000493689.1 non-organism_supported ENST00000493689.1 not organism-supported ENST00000464380.1 non-organism_supported ENST00000464380.1 not organism-supported ENST00000418416.1 GENCODE experimental pipeline ENST00000414967.1 GENCODE experimental pipeline ENST00000404590.1 alternative 5' UTR ENST00000416719.1 alternative 5' UTR ENST00000457954.1 alternative 5' UTR ENST00000440042.1 alternative 5' UTR ENST00000404807.1 FLJ33177 ENST00000416015.1 not organism-supported ENST00000496893.1 FLJ30517 ENST00000457184.1 not organism-supported ENST00000451033.1 gene fragments AC073271.2 and AC073271.3 are part of the same gene; an assembly gap between them contains one or more exons ENST00000334436.5 gene fragments AC073271.3 and AC073271.2 are part of the same gene; an assembly gap between them contains one or more exons ENST00000446781.1 GENCODE experimental pipeline ENST00000409029.1 alternative 5' UTR ENST00000498249.1 GENCODE experimental pipeline ENST00000409381.1 alternative 5' UTR ENST00000414420.1 alternative 5' UTR ENST00000428879.1 alternative 5' UTR ENST00000449714.1 GENCODE experimental pipeline ENST00000295052.3 FLJ32955 ENST00000429317.1 GENCODE experimental pipeline ENST00000375734.2 alternative 5' UTR ENST00000439275.1 alternative 5' UTR ENST00000454202.1 alternative 5' UTR ENST00000416350.1 GENCODE experimental pipeline ENST00000421624.1 GENCODE experimental pipeline ENST00000427615.1 GENCODE experimental pipeline ENST00000409243.1 GENCODE experimental pipeline ENST00000414946.1 alternative 5' UTR ENST00000444746.2 non-canonical splice donor site between exon 16 and exon 17 ENST00000444746.2 alternative 5' UTR ENST00000453091.2 non-canonical splice donor site between exon 16 and exon 17 ENST00000428287.2 non-canonical splice donor site between exon 16 and exon 17 ENST00000428287.2 alternative 5' UTR ENST00000420714.3 alternative 5' UTR ENST00000420714.3 non canonical polymorphism ENST00000243326.4 non-canonical splice donor site between exon 15 and exon 16 ENST00000414861.2 non-canonical splice donor site between exon 15 and exon 16 ENST00000414861.2 upstream_ATG-3 ENST00000430328.2 non-canonical splice donor site between exon 15 and exon 16 ENST00000413693.1 many of the exons for this gene object match in multiple places. This is why the gene object does not appear to reflect the evidence ENST00000434685.1 not organism-supported ENST00000446896.3 NAGNAG splice site ENST00000201943.5 AC097448.2-004 ENST00000434468.1 alternative 5' UTR ENST00000413043.1 GENCODE experimental pipeline ENST00000429916.1 GENCODE experimental pipeline ENST00000454312.1 GENCODE experimental pipeline ENST00000454312.1 Em:DB026818.1 not in Zmap (UCSC found) ENST00000454537.1 Em:DB442132.1 not in Zmap (UCSC found) ENST00000424322.1 Em:DA436465.1 not in Zmap (UCSC found) ENST00000434213.1 alternative 5' UTR ENST00000487047.1 not organism-supported ENST00000434635.1 GENCODE experimental pipeline ENST00000432599.1 GENCODE experimental pipeline ENST00000431457.1 non-organism_supported ENST00000440805.1 non-organism_supported ENST00000426217.1 non-organism_supported ENST00000448255.1 GENCODE experimental pipeline ENST00000409572.1 alternative 5' UTR ENST00000409108.2 not organism-supported ENST00000424077.1 alternative 5' UTR ENST00000421709.1 alternative 5' UTR ENST00000415049.1 alternative 5' UTR ENST00000438166.2 alternative 5' UTR ENST00000409674.1 alternative 5' UTR ENST00000410096.1 NP_065762.1 ENST00000397283.2 NP_001009959.1 ENST00000420317.1 alternative 5' UTR ENST00000411762.1 alternative 5' UTR ENST00000435117.1 alternative 5' UTR ENST00000409283.2 alternative 5' UTR ENST00000409283.2 not organism-supported ENST00000410057.2 alternative 5' UTR ENST00000412025.1 alternative 5' UTR ENST00000440523.1 alternative 5' UTR ENST00000539637.1 alternative 5' UTR ENST00000424669.1 alternative 5' UTR ENST00000460456.1 non-organism_supported ENST00000439185.1 GENCODE experimental pipeline ENST00000412781.2 GENCODE experimental pipeline ENST00000409187.1 non-organism_supported ENST00000342892.4 GENCODE experimental pipeline ENST00000449526.1 GENCODE experimental pipeline ENST00000392796.3 alternative 5' UTR ENST00000409990.3 alternative 5' UTR ENST00000482503.1 alternative 5' UTR ENST00000437839.1 alternative 5' UTR ENST00000420020.1 GENCODE experimental pipeline ENST00000418474.1 GENCODE experimental pipeline ENST00000409175.1 alternative 5' UTR ENST00000421037.1 alternative 5' UTR ENST00000473749.1 alternative 5' UTR ENST00000409872.1 alternative 5' UTR ENST00000409075.1 alternative 5' UTR ENST00000409289.2 alternative 5' UTR ENST00000409289.2 not organism-supported ENST00000409972.1 alternative 5' UTR ENST00000428519.1 alternative 5' UTR ENST00000425470.1 GENCODE experimental pipeline ENST00000445372.1 GENCODE experimental pipeline ENST00000439050.1 GENCODE experimental pipeline ENST00000437630.1 alternative 5' UTR ENST00000411412.1 not organism-supported ENST00000505579.1 GENCODE experimental pipeline ENST00000418335.1 GENCODE experimental pipeline ENST00000418968.1 GENCODE experimental pipeline ENST00000462608.1 not organism-supported ENST00000450031.2 not organism-supported ENST00000453113.2 not organism-supported ENST00000332142.5 Isoform 1 ENST00000446838.2 GENCODE experimental pipeline ENST00000409634.1 not organism-supported ENST00000482917.1 not organism-supported ENST00000456693.1 upstream_ATG-8 ENST00000456693.1 upstream uORF ENST00000448708.1 alternative 5' UTR ENST00000414843.1 alternative 5' UTR ENST00000414885.1 GENCODE experimental pipeline ENST00000409662.1 alternative 5' UTR ENST00000424914.1 not organism-supported ENST00000484898.1 not organism-supported ENST00000453007.1 alternative 5' UTR ENST00000424833.1 alternative 5' UTR ENST00000283256.6 NP_066287.2 ENST00000375427.2 NP_001035233.1 ENST00000375427.2 not organism-supported ENST00000421875.1 alternative 5' UTR ENST00000409664.1 alternative 5' UTR ENST00000412248.1 alternative 5' UTR ENST00000431484.1 alternative 5' UTR ENST00000414977.1 alternative 5' UTR ENST00000422973.1 alternative 5' UTR ENST00000447156.1 alternative 5' UTR ENST00000425688.1 GENCODE experimental pipeline ENST00000428888.1 GENCODE experimental pipeline ENST00000457108.1 GENCODE experimental pipeline ENST00000440322.1 GENCODE experimental pipeline ENST00000303395.4 sodium channel protein, brain i alpha subunit ENST00000375405.3 sodium channel protein, brain i alpha subunit ENST00000507401.1 GENCODE experimental pipeline ENST00000447809.2 GENCODE experimental pipeline ENST00000419992.1 not organism-supported ENST00000419992.1 alternative 5' UTR ENST00000441411.1 alternative 5' UTR ENST00000409195.1 NP_689594.4 ENST00000430546.1 GENCODE experimental pipeline ENST00000425636.2 GENCODE experimental pipeline ENST00000458381.2 alternative 5' UTR ENST00000451987.1 alternative 5' UTR ENST00000327239.4 alternative 5' UTR ENST00000428522.1 alternative 5' UTR ENST00000450153.1 alternative 5' UTR ENST00000436483.2 alternative 5' UTR ENST00000432133.1 GENCODE experimental pipeline ENST00000445210.1 alternative 5' UTR ENST00000448752.2 alternative 5' UTR ENST00000418888.1 alternative 5' UTR ENST00000414307.1 alternative 5' UTR ENST00000438838.1 alternative 5' UTR ENST00000449906.1 alternative 5' UTR ENST00000272797.4 alternative 5' UTR ENST00000422006.1 alternative 5' UTR ENST00000409333.1 alternative 5' UTR ENST00000409340.1 not organism-supported ENST00000409965.1 alternative 5' UTR ENST00000392640.2 alternative 5' UTR ENST00000444475.1 not organism-supported ENST00000428156.1 GENCODE experimental pipeline ENST00000442456.1 GENCODE experimental pipeline ENST00000454603.1 alternative 5' UTR ENST00000445006.1 alternative 5' UTR ENST00000344257.5 isoform 2 ENST00000455008.1 alternative 5' UTR ENST00000456864.1 alternative 5' UTR ENST00000429023.1 non-organism_supported ENST00000418106.1 GENCODE experimental pipeline ENST00000359766.3 non-organism_supported ENST00000413010.1 non-organism_supported ENST00000447486.1 FLJ13984 ENST00000375258.3 Protein truncated due to SNP (rs10205459) ENST00000483284.1 FLJ35899 ENST00000453846.1 alternative 5' UTR ENST00000375255.3 FLJ13096 ENST00000495925.1 non-organism_supported ENST00000452242.1 alternative 5' UTR ENST00000340296.4 alternative 5' UTR ENST00000397119.3 alternative 5' UTR ENST00000410079.3 alternative 5' UTR ENST00000438879.1 alternative 5' UTR ENST00000435234.1 alternative 5' UTR ENST00000443458.1 alternative 5' UTR ENST00000412370.1 alternative 5' UTR ENST00000423910.1 alternative 5' UTR ENST00000425485.1 alternative 5' UTR ENST00000430778.1 alternative 5' UTR ENST00000416361.1 rare donor site between exon 1 and exon 2 ENST00000416361.1 GENCODE experimental pipeline ENST00000475360.2 not organism-supported ENST00000361609.4 alternative 5' UTR ENST00000469444.2 alternative 5' UTR ENST00000234198.4 FLJ75693 ENST00000466293.2 FLJ56718 ENST00000448117.1 GENCODE experimental pipeline ENST00000445613.1 GENCODE experimental pipeline ENST00000409080.1 isoform a precursor ENST00000458314.1 GENCODE experimental pipeline ENST00000436922.1 GENCODE experimental pipeline ENST00000455435.1 GENCODE experimental pipeline ENST00000397081.3 AT-AC splicing at exons 17 and 18 ENST00000498533.1 AT-AC splicing at exons 17 and 18 ENST00000498533.1 Non-canonical splicing between exons 12 and 13 ENST00000409036.1 non-organism_supported ENST00000409176.2 alternative 5' UTR ENST00000422149.1 alternative 5' UTR ENST00000423106.2 GENCODE experimental pipeline ENST00000418620.1 GENCODE experimental pipeline ENST00000418194.2 non-ATG start codon ENST00000409546.1 not organism-supported ENST00000392560.2 not organism-supported ENST00000427472.1 alternative 5' UTR ENST00000394967.2 not organism-supported ENST00000472169.1 GENCODE experimental pipeline ENST00000458563.1 alternative 5' UTR ENST00000435964.1 alternative 5' UTR ENST00000424069.1 alternative 5' UTR ENST00000427038.1 alternative 5' UTR ENST00000548031.1 alternative 5' UTR ENST00000392551.2 alternative 5' UTR ENST00000295500.4 alternative 5' UTR ENST00000417038.1 GENCODE experimental pipeline ENST00000442996.1 GENCODE experimental pipeline ENST00000359761.3 alternative 5' UTR ENST00000392546.2 alternative 5' UTR ENST00000467149.1 not organism-supported ENST00000436221.1 alternative 5' UTR ENST00000469002.1 not organism-supported ENST00000454203.1 GENCODE experimental pipeline ENST00000416004.1 GENCODE experimental pipeline ENST00000409437.1 not organism-supported ENST00000409635.1 alternative 5' UTR ENST00000409635.1 not organism-supported ENST00000435004.2 not organism-supported ENST00000392544.1 alternative 5' UTR ENST00000415955.1 alternative 5' UTR ENST00000435231.1 not organism-supported ENST00000437522.1 alternative 5' UTR ENST00000449168.1 GENCODE experimental pipeline ENST00000409194.1 alternative 5' UTR ENST00000392541.3 alternative 5' UTR ENST00000453206.1 GENCODE experimental pipeline ENST00000458254.1 GENCODE experimental pipeline ENST00000445472.1 alternative 5' UTR ENST00000466445.1 alternative 5' UTR ENST00000308618.4 not organism-supported ENST00000392539.3 not organism-supported ENST00000406506.2 NP_067016 ENST00000406506.2 not organism-supported ENST00000429017.1 NAGNAG splice site ENST00000313173.4 NAGNAG splice site ENST00000548663.1 NAGNAG splice site ENST00000548663.1 not organism-supported ENST00000450510.2 NAGNAG splice site ENST00000432796.2 alternative 5' UTR ENST00000468418.2 alternative 5' UTR ENST00000468418.2 not organism-supported ENST00000410016.1 alternative 5' UTR ENST00000410016.1 not organism-supported ENST00000249442.6 isoform a ENST00000412153.1 GENCODE experimental pipeline ENST00000431455.1 GENCODE experimental pipeline ENST00000295549.3 GENCODE experimental pipeline ENST00000443670.1 GENCODE experimental pipeline ENST00000432925.1 GENCODE experimental pipeline ENST00000455416.1 GENCODE experimental pipeline ENST00000455416.1 not organism-supported ENST00000464747.1 Have made this as a transcript as it runs through to upstream gene AC074286.1 ENST00000397057.2 DKFZp451M2119 ENST00000453859.1 non-organism_supported ENST00000357045.4 GENCODE experimental pipeline ENST00000355689.4 FLJ13946 ENST00000433879.1 non-organism_supported ENST00000492761.1 non-organism_supported ENST00000450227.1 GENCODE experimental pipeline ENST00000457053.1 GENCODE experimental pipeline ENST00000375129.4 non-organism_supported ENST00000375129.4 alternative 5' UTR ENST00000442710.1 non-organism_supported ENST00000418062.1 GENCODE experimental pipeline ENST00000443758.1 non-organism_supported ENST00000446116.1 not organism-supported ENST00000335289.5 non-organism_supported ENST00000440010.1 alternative 5' UTR ENST00000435047.1 alternative 5' UTR ENST00000419129.1 GENCODE experimental pipeline ENST00000410066.1 upstream_ATG-15 ENST00000336917.5 alternative 5' UTR ENST00000409343.1 upstream_ATG-15 ENST00000457304.1 non-organism_supported ENST00000469551.1 non-organism_supported ENST00000451732.1 upstream_ATG-15 ENST00000451732.1 alternative 5' UTR ENST00000438871.1 upstream_ATG-15 ENST00000438871.1 alternative 5' UTR ENST00000429816.1 Em:CF140309.1 ENST00000429816.1 GENCODE experimental pipeline ENST00000430956.1 alternative 5' UTR ENST00000410114.1 alternative 5' UTR ENST00000411535.1 alternative 5' UTR ENST00000414657.2 alternative 5' UTR ENST00000426294.1 alternative 5' UTR ENST00000409247.1 alternative 5' UTR ENST00000456895.1 GENCODE experimental pipeline ENST00000435411.1 FLJ43011 ENST00000456446.1 GENCODE experimental pipeline ENST00000440371.1 GENCODE experimental pipeline ENST00000449835.1 GENCODE experimental pipeline ENST00000409136.1 not organism-supported ENST00000410103.1 alternative 5' UTR ENST00000495511.1 alternative 5' UTR ENST00000482782.1 alternative 5' UTR ENST00000442895.2 alternative 5' UTR ENST00000446612.1 alternative 5' UTR ENST00000472844.1 alternative 5' UTR ENST00000455063.1 alternative 5' UTR ENST00000441026.1 GENCODE experimental pipeline ENST00000421998.1 GENCODE experimental pipeline ENST00000415915.1 FLJ44048 ENST00000436557.1 GENCODE experimental pipeline ENST00000419719.1 GENCODE experimental pipeline ENST00000474571.1 non-organism_supported ENST00000453665.1 GENCODE experimental pipeline ENST00000304698.5 Isoform 1 ENST00000409998.1 alternative 5' UTR ENST00000410068.1 alternative 5' UTR ENST00000447403.1 alternative 5' UTR ENST00000426055.1 alternative 5' UTR ENST00000409676.1 alternative 5' UTR ENST00000437725.1 alternative 5' UTR ENST00000421427.1 alternative 5' UTR ENST00000421427.1 Em:CD654414.1 ENST00000453013.1 alternative 5' UTR ENST00000417013.1 alternative 5' UTR ENST00000420747.1 alternative 5' UTR ENST00000434418.1 GENCODE experimental pipeline ENST00000409830.1 alternative 5' UTR ENST00000409927.1 alternative 5' UTR ENST00000409580.1 alternative 5' UTR ENST00000409637.3 alternative 5' UTR ENST00000409609.1 alternative 5' UTR ENST00000431708.1 GENCODE experimental pipeline ENST00000304636.3 NP_000081 ENST00000419029.1 GENCODE experimental pipeline ENST00000427241.1 alternative 5' UTR ENST00000427419.1 alternative 5' UTR ENST00000425590.1 alternative 5' UTR ENST00000420250.1 alternative 5' UTR ENST00000441800.1 alternative 5' UTR ENST00000522700.1 alternative 5' UTR ENST00000517895.1 alternative 5' UTR ENST00000521630.1 alternative 5' UTR ENST00000325795.3 alternative 5' UTR ENST00000392349.4 alternative 5' UTR ENST00000442547.1 alternative 5' UTR ENST00000458355.1 alternative 5' UTR ENST00000446877.1 alternative 5' UTR ENST00000424766.1 alternative 5' UTR ENST00000420421.1 alternative 5' UTR ENST00000450357.1 alternative 5' UTR ENST00000396974.2 NP_001035986.1 ENST00000409545.2 NP_001035985.1 ENST00000409545.2 alternative 5' UTR ENST00000409870.1 alternative 5' UTR ENST00000340623.4 NP_001035984.1 ENST00000340623.4 alternative 5' UTR ENST00000443551.2 NP_115697.2 ENST00000443551.2 alternative 5' UTR ENST00000399855.2 alternative 3' UTR ENST00000430311.1 alternative 5' UTR ENST00000413239.1 alternative 5' UTR ENST00000431594.1 alternative 5' UTR ENST00000444194.1 alternative 5' UTR ENST00000458647.1 alternative 5' UTR ENST00000423767.1 alternative 5' UTR ENST00000451089.1 alternative 5' UTR ENST00000409027.1 alternative 5' UTR ENST00000409027.1 not organism-supported ENST00000458193.1 alternative 5' UTR ENST00000432036.1 alternative 5' UTR ENST00000417958.1 alternative 5' UTR ENST00000392328.1 FLJ20160 ENST00000457407.1 GENCODE experimental pipeline ENST00000448811.1 alternative 5' UTR ENST00000416973.1 alternative 5' UTR ENST00000426601.1 alternative 5' UTR ENST00000409581.1 alternative 5' UTR ENST00000423376.1 alternative 5' UTR ENST00000413911.1 GENCODE experimental pipeline ENST00000409465.1 alternative 5' UTR ENST00000424722.1 alternative 5' UTR ENST00000454414.1 alternative 5' UTR ENST00000432058.1 alternative 5' UTR ENST00000431351.1 GENCODE experimental pipeline ENST00000431351.1 not organism-supported ENST00000456176.1 GENCODE experimental pipeline ENST00000392320.2 alternative 5' UTR ENST00000450994.1 alternative 5' UTR ENST00000419640.1 GENCODE experimental pipeline ENST00000418908.1 alternative 5' UTR ENST00000339514.4 NP_036355.2 ENST00000392318.3 alternative 5' UTR ENST00000438652.1 alternative 5' UTR ENST00000451437.1 alternative 5' UTR ENST00000420448.1 alternative 5' UTR ENST00000409510.1 alternative 5' UTR ENST00000413304.2 XP_001129762.1 ENST00000424116.1 GENCODE experimental pipeline ENST00000428980.1 GENCODE experimental pipeline ENST00000422017.1 GENCODE experimental pipeline ENST00000438505.1 GENCODE experimental pipeline ENST00000447194.1 GENCODE experimental pipeline ENST00000413290.1 GENCODE experimental pipeline ENST00000458054.1 alternative 5' UTR ENST00000409086.3 alternative 5' UTR ENST00000412905.1 alternative 5' UTR ENST00000418005.1 alternative 5' UTR ENST00000409228.1 alternative 5' UTR ENST00000420683.1 alternative 5' UTR ENST00000449152.1 alternative 5' UTR ENST00000452031.1 alternative 5' UTR ENST00000427457.1 alternative 5' UTR ENST00000451088.2 GENCODE experimental pipeline ENST00000449346.1 GENCODE experimental pipeline ENST00000428191.1 GENCODE experimental pipeline ENST00000442984.1 GENCODE experimental pipeline ENST00000409915.4 alternative 3' UTR ENST00000263960.2 FLJ13448 ENST00000430176.1 alternative 5' UTR ENST00000452200.1 alternative 5' UTR ENST00000428204.1 alternative 5' UTR ENST00000439605.1 alternative 5' UTR ENST00000418022.1 alternative 5' UTR ENST00000409360.1 alternative 5' UTR ENST00000429081.1 alternative 5' UTR ENST00000433157.1 alternative 5' UTR ENST00000448977.1 GENCODE experimental pipeline ENST00000443261.1 GENCODE experimental pipeline ENST00000417098.1 alternative 5' UTR ENST00000443023.1 not organism-supported ENST00000260926.5 alternative 5' UTR ENST00000457245.1 alternative 5' UTR ENST00000440919.1 alternative 5' UTR ENST00000450728.1 GENCODE experimental pipeline ENST00000457577.3 GENCODE experimental pipeline ENST00000392290.1 FLJ22555 ENST00000392290.1 NP_078796.1 ENST00000439084.1 alternative 5' UTR ENST00000409718.1 alternative 5' UTR ENST00000358677.4 alternative 5' UTR ENST00000444012.1 alternative 5' UTR ENST00000451764.2 alternative 5' UTR ENST00000423749.1 alternative 5' UTR ENST00000428692.1 alternative 5' UTR ENST00000457757.1 alternative 5' UTR ENST00000409140.3 alternative 5' UTR ENST00000421573.1 alternative 5' UTR ENST00000449647.1 alternative 5' UTR ENST00000409157.1 alternative 5' UTR ENST00000418045.1 alternative 5' UTR ENST00000452787.1 GENCODE experimental pipeline ENST00000447972.2 GENCODE experimental pipeline ENST00000450637.1 alternative 5' UTR ENST00000452206.1 alternative 5' UTR ENST00000410110.2 alternative 5' UTR ENST00000426253.1 alternative 5' UTR ENST00000454952.1 alternative 5' UTR ENST00000409129.2 dotter required to determine strucutre ENST00000409129.2 alternative 5' UTR ENST00000410039.1 alternative 5' UTR ENST00000457595.1 alternative 5' UTR ENST00000413848.1 GENCODE experimental pipeline ENST00000418596.2 DKFZp313I1420 ENST00000452799.1 alternative 5' UTR ENST00000453765.1 alternative 5' UTR ENST00000450023.1 alternative 5' UTR ENST00000433898.1 alternative 5' UTR ENST00000454214.1 alternative 5' UTR ENST00000448256.1 GENCODE experimental pipeline ENST00000441224.1 alternative 5' UTR ENST00000433445.1 alternative 5' UTR ENST00000425030.1 alternative 5' UTR ENST00000417748.1 alternative 5' UTR ENST00000440180.1 alternative 5' UTR ENST00000415011.1 GENCODE experimental pipeline ENST00000434645.1 GENCODE experimental pipeline ENST00000392263.2 Alternatively spliced 5' UTR, shares CDS with AC007256.1-001 (partial) ENST00000392263.2 alternative 5' UTR ENST00000440732.1 alternative 5' UTR ENST00000323492.7 alternative 5' UTR ENST00000429881.1 alternative 5' UTR ENST00000439709.1 alternative 5' UTR ENST00000418364.1 alternative 5' UTR ENST00000440597.1 alternative 5' UTR ENST00000264276.6 rare donor site between exon 11 and exon 12 ENST00000439495.1 rare donor site between exon 2 and exon 3 ENST00000482891.1 rare donor site between exon 11 and exon 12 ENST00000496244.1 non canonical other ENST00000496244.1 non canonical splice donor site between exon 4 and exon 5 ENST00000409632.2 alternative 5' UTR ENST00000410052.1 alternative 5' UTR ENST00000410091.3 alternative 5' UTR ENST00000498697.1 not organism-supported ENST00000409819.1 GENCODE experimental pipeline ENST00000447111.1 GENCODE experimental pipeline ENST00000409498.2 non canonical TEC ENST00000409205.1 alternative 5' UTR ENST00000392237.2 Isoform1 ENST00000358299.2 alternative 5' UTR ENST00000438804.1 not organism-supported ENST00000450143.1 alternative 5' UTR ENST00000435143.1 alternative 5' UTR ENST00000419460.1 alternative 5' UTR ENST00000412210.1 alternative 5' UTR ENST00000457524.1 alternative 5' UTR ENST00000432273.1 alternative 5' UTR ENST00000416760.1 alternative 5' UTR ENST00000454326.1 alternative 5' UTR ENST00000484561.1 Isoform 2 ENST00000411681.1 alternative 5' UTR ENST00000421334.1 alternative 5' UTR ENST00000431787.1 alternative 5' UTR ENST00000430899.1 alternative 5' UTR ENST00000441569.1 alternative 5' UTR ENST00000432024.1 alternative 5' UTR ENST00000443740.1 alternative 5' UTR ENST00000438828.1 alternative 5' UTR ENST00000449802.1 Merged with ALS2CR16 ENST00000414576.2 not organism-supported ENST00000422511.2 not organism-supported ENST00000464761.1 not organism-supported ENST00000319170.5 Isoform1 ENST00000308091.4 Isoform 3 ENST00000428637.1 alternative 5' UTR ENST00000295854.6 PMID: 10556814 ENST00000295854.6 PMID: 10831323 ENST00000427473.2 not organism-supported ENST00000411436.1 GENCODE experimental pipeline ENST00000419860.1 GENCODE experimental pipeline ENST00000444017.1 GENCODE experimental pipeline ENST00000488622.1 not organism-supported ENST00000450507.1 alternative 5' UTR ENST00000417189.1 NP_957716.1 ENST00000357118.4 NP_957719.1 ENST00000357785.5 NP_003863.2 ENST00000412873.2 NP_958436.1 ENST00000272849.3 NP_061004.3 ENST00000422116.1 GENCODE experimental pipeline ENST00000424117.1 not organism-supported ENST00000414320.1 alternative 5' UTR ENST00000420509.1 GENCODE experimental pipeline ENST00000453039.1 GENCODE experimental pipeline ENST00000449699.1 alternative 5' UTR ENST00000454195.1 alternative 5' UTR ENST00000392222.2 NP_001950.1 ENST00000392222.2 alternative 5' UTR ENST00000445505.1 alternative 5' UTR ENST00000445505.1 NP_001032752.1 ENST00000435123.1 not organism-supported ENST00000455150.1 not organism-supported ENST00000437420.1 alternative 5' UTR ENST00000451790.1 alternative 5' UTR ENST00000447845.1 alternative 5' UTR ENST00000439932.1 alternative 5' UTR ENST00000411719.1 alternative 5' UTR ENST00000458440.1 alternative 5' UTR ENST00000415275.1 GENCODE experimental pipeline ENST00000415029.1 GENCODE experimental pipeline ENST00000441223.1 GENCODE experimental pipeline ENST00000418289.1 alternative 5' UTR ENST00000402774.3 alternative 5' UTR ENST00000403094.3 alternative 5' UTR ENST00000426163.1 alternative 5' UTR ENST00000457962.1 alternative 5' UTR ENST00000428777.1 GENCODE experimental pipeline ENST00000435643.1 GENCODE experimental pipeline ENST00000454444.1 GENCODE experimental pipeline ENST00000440326.1 GENCODE experimental pipeline ENST00000438824.1 GENCODE experimental pipeline ENST00000430624.1 alternative 5' UTR ENST00000445803.1 alternative 5' UTR ENST00000452474.1 alternative 5' UTR ENST00000414681.1 alternative 5' UTR ENST00000458426.1 alternative 5' UTR ENST00000272839.3 not organism-supported ENST00000448823.2 Bos taurus ENST00000448823.2 not organism-supported ENST00000406927.2 alternative 5' UTR ENST00000426075.1 alternative 5' UTR ENST00000442521.1 alternative 5' UTR ENST00000446449.1 GENCODE experimental pipeline ENST00000429730.1 GENCODE experimental pipeline ENST00000343987.2 GENCODE experimental pipeline ENST00000427836.2 NP_001073944.1 ENST00000427836.2 Em:BC156835.1 ENST00000421964.1 GENCODE experimental pipeline ENST00000451346.1 not organism-supported ENST00000423952.2 not organism-supported ENST00000449053.1 alternative 5' UTR ENST00000446179.1 alternative 5' UTR ENST00000415913.1 alternative 5' UTR ENST00000415282.1 alternative 5' UTR ENST00000417583.1 alternative 5' UTR ENST00000451391.1 alternative 5' UTR ENST00000440574.1 GENCODE experimental pipeline ENST00000199940.6 Isoform 5 ENST00000392193.1 Alternatively spliced 5' UTR, shares CDS with AC006385.2-001 (partial) ENST00000392193.1 alternative 5' UTR ENST00000360351.4 Isoform 1 ENST00000392194.1 Isoform 2 ENST00000475600.1 Made from rat cDNA ENST00000475600.1 not organism-supported ENST00000436630.2 alternative 5' UTR ENST00000408981.2 alternative 5' UTR ENST00000429921.1 alternative 5' UTR ENST00000453724.1 alternative 5' UTR ENST00000438265.1 alternative 5' UTR ENST00000441588.1 alternative 5' UTR ENST00000438204.1 alternative 5' UTR ENST00000457374.1 alternative 5' UTR ENST00000452057.1 GENCODE experimental pipeline ENST00000420418.1 GENCODE experimental pipeline ENST00000443314.1 alternative 5' UTR ENST00000441020.3 not organism-supported ENST00000441020.3 alternative 5' UTR ENST00000233714.4 alternative 5' UTR ENST00000431941.2 alternative 5' UTR ENST00000448951.1 alternative 5' UTR ENST00000417946.1 alternative 5' UTR ENST00000518043.1 alternative 5' UTR ENST00000453965.1 GENCODE experimental pipeline ENST00000437261.1 GENCODE experimental pipeline ENST00000433134.1 alternative 5' UTR ENST00000452786.1 alternative 5' UTR ENST00000426870.1 GENCODE experimental pipeline ENST00000360083.3 GENCODE experimental pipeline ENST00000437883.1 GENCODE experimental pipeline ENST00000312504.5 NP_001073969.1 ENST00000416430.1 GENCODE experimental pipeline ENST00000448086.1 GENCODE experimental pipeline ENST00000412951.1 GENCODE experimental pipeline ENST00000414756.1 GENCODE experimental pipeline ENST00000431727.2 GENCODE experimental pipeline ENST00000445174.1 GENCODE experimental pipeline ENST00000415479.1 GENCODE experimental pipeline ENST00000443971.1 GENCODE experimental pipeline ENST00000413311.1 Em:AA830742.1 ENST00000439791.1 alternative 5' UTR ENST00000424992.1 alternative 5' UTR ENST00000497889.1 not organism-supported ENST00000433112.1 alternative 5' UTR ENST00000437356.2 alternative 5' UTR ENST00000455479.1 alternative 5' UTR ENST00000406027.2 alternative 5' UTR ENST00000417481.1 GENCODE experimental pipeline ENST00000452736.1 GENCODE experimental pipeline ENST00000457694.1 GENCODE experimental pipeline ENST00000430374.1 alternative 5' UTR ENST00000444508.1 alternative 5' UTR ENST00000425815.1 alternative 5' UTR ENST00000358207.5 alternative 5' UTR ENST00000434435.1 alternative 5' UTR ENST00000453157.1 GENCODE experimental pipeline ENST00000414135.1 GENCODE experimental pipeline ENST00000446558.1 not organism-supported ENST00000456586.1 not organism-supported ENST00000427280.1 GENCODE experimental pipeline ENST00000449783.1 GENCODE experimental pipeline ENST00000441803.1 GENCODE experimental pipeline ENST00000434973.1 GENCODE experimental pipeline ENST00000440900.1 GENCODE experimental pipeline ENST00000451711.1 GENCODE experimental pipeline ENST00000418591.1 GENCODE experimental pipeline ENST00000456163.1 GENCODE experimental pipeline ENST00000452813.1 GENCODE experimental pipeline ENST00000413280.1 alternative 5' UTR ENST00000439083.1 alternative 5' UTR ENST00000449814.1 alternative 5' UTR ENST00000450996.1 GENCODE experimental pipeline ENST00000453237.1 alternative 5' UTR ENST00000415392.1 alternative 5' UTR ENST00000449014.1 alternative 5' UTR ENST00000454148.1 alternative 5' UTR ENST00000428565.1 alternative 5' UTR ENST00000418878.1 alternative 5' UTR ENST00000315717.5 alternative 5' UTR ENST00000420104.1 alternative 5' UTR ENST00000444881.1 alternative 5' UTR ENST00000439306.1 not organism-supported ENST00000429501.1 alternative 5' UTR ENST00000425694.1 alternative 5' UTR ENST00000418569.1 alternative 5' UTR ENST00000440422.1 alternative 5' UTR ENST00000444183.1 alternative 5' UTR ENST00000444000.1 alternative 5' UTR ENST00000453281.1 alternative 5' UTR ENST00000451181.1 alternative 5' UTR ENST00000413976.1 alternative 5' UTR ENST00000420341.1 alternative 5' UTR ENST00000411433.1 GENCODE experimental pipeline ENST00000441749.1 GENCODE experimental pipeline ENST00000464255.1 not organism-supported ENST00000454775.1 alternative 5' UTR ENST00000418019.1 alternative 5' UTR ENST00000418808.1 alternative 3' UTR ENST00000417849.1 alternative 3' UTR ENST00000415854.1 alternative 5' UTR ENST00000432688.1 non-organism_supported ENST00000457773.1 alternative 3' UTR ENST00000433921.1 alternative 5' UTR ENST00000450560.1 alternative 5' UTR ENST00000432460.1 alternative 5' UTR ENST00000428880.1 alternative 5' UTR ENST00000430322.1 alternative 5' UTR ENST00000359273.3 alternative 5' UTR ENST00000392110.2 alternative 5' UTR ENST00000423377.1 alternative 5' UTR ENST00000392111.2 alternative 5' UTR ENST00000412366.1 alternative 5' UTR ENST00000439945.1 alternative 5' UTR ENST00000431802.1 alternative 5' UTR ENST00000465706.1 not organism-supported ENST00000440309.1 alternative 5' UTR ENST00000424080.1 alternative 5' UTR ENST00000457313.1 confirm experimentally ENST00000415717.1 alternative 5' UTR ENST00000437755.1 alternative 5' UTR ENST00000424644.1 alternative 5' UTR ENST00000417196.1 not organism-supported ENST00000434241.1 not organism-supported ENST00000448224.1 not organism-supported ENST00000529249.1 not organism-supported ENST00000486233.1 not organism-supported ENST00000419511.1 GENCODE experimental pipeline ENST00000419101.1 GENCODE experimental pipeline ENST00000295728.2 alternative 5' UTR ENST00000453769.1 alternative 5' UTR ENST00000441450.1 GENCODE experimental pipeline ENST00000441450.1 LOC100129175 ENST00000295729.2 NP_689602 ENST00000458526.1 alternative 5' UTR ENST00000457600.1 alternative 5' UTR ENST00000409878.3 non_organism_supported ENST00000409789.1 alternative 5' UTR ENST00000453038.1 alternative 5' UTR ENST00000443757.1 alternative 5' UTR ENST00000430747.1 alternative 5' UTR ENST00000452022.1 alternative 5' UTR ENST00000409206.1 alternative 5' UTR ENST00000422255.1 alternative 5' UTR ENST00000409336.1 alternative 5' UTR ENST00000409319.1 alternative 5' UTR ENST00000469596.1 not organism-supported ENST00000448398.1 not organism-supported ENST00000409618.1 alternative 5' UTR ENST00000361242.4 alternative 5' UTR ENST00000429920.1 not organism-supported ENST00000436856.1 alternative 5' UTR ENST00000457841.1 alternative 5' UTR ENST00000428226.1 alternative 5' UTR ENST00000432520.1 alternative 5' UTR ENST00000439812.1 alternative 5' UTR ENST00000455079.1 alternative 5' UTR ENST00000443140.1 aletrnative_5'_UTR ENST00000434939.1 alternative 5' UTR ENST00000410034.3 alternative 5' UTR ENST00000447157.1 alternative 5' UTR ENST00000436226.1 alternative 5' UTR ENST00000392089.2 alternative 5' UTR ENST00000428427.1 alternative 5' UTR ENST00000424620.1 alternative 5' UTR ENST00000396738.2 alternative 5' UTR ENST00000486813.1 non-organism_supported ENST00000427737.1 alternative 5' UTR ENST00000425450.1 alternative 5' UTR ENST00000392087.2 not organism-supported ENST00000442681.1 alternative 5' UTR ENST00000439026.1 alternative 5' UTR ENST00000412847.1 alternative 5' UTR ENST00000446182.1 alternative 5' UTR ENST00000442029.1 alternative 5' UTR ENST00000451506.1 alternative 5' UTR ENST00000417355.1 GENCODE experimental pipeline ENST00000431523.1 novel protein ENST00000485069.1 novel transcript ENST00000429882.1 missed on first pass annotation ENST00000480506.1 novel transcript ENST00000443704.1 novel transcript ENST00000493655.1 novel transcript ENST00000480034.1 novel transcript ENST00000496536.1 novel transcript ENST00000373883.3 MGC99813 ENST00000451952.1 GENCODE experimental pipeline ENST00000462534.1 novel transcript ENST00000465149.1 KIAA0657 ENST00000465149.1 novel transcript ENST00000472388.1 novel transcript ENST00000462385.1 novel transcript ENST00000465589.1 novel transcript ENST00000432993.1 GENCODE experimental pipeline ENST00000438633.1 GENCODE experimental pipeline ENST00000541600.1 alternative 5' UTR ENST00000434266.1 alternative 5' UTR ENST00000453706.2 GENCODE experimental pipeline ENST00000392069.2 NM_181459.2 ENST00000392069.2 PMID:10521655, 10191090 ENST00000392069.2 not organism-supported ENST00000344493.4 NP_852126 ENST00000350526.4 NP_852122.1 ENST00000350526.4 not organism-supported ENST00000392070.2 NP_852123.1 ENST00000336840.5 NP_852125.1 ENST00000409828.3 NP_000429.2 ENST00000258387.5 NP_039230.1 ENST00000440903.1 alternative 5' UTR ENST00000429475.1 GENCODE experimental pipeline ENST00000392066.3 alternative 5' UTR ENST00000535678.1 alternative 5' UTR ENST00000413316.1 alternative 5' UTR ENST00000446709.1 GENCODE experimental pipeline ENST00000422118.1 GENCODE experimental pipeline ENST00000440341.1 GENCODE experimental pipeline ENST00000421386.1 alternative 5' UTR ENST00000433889.1 alternative 5' UTR ENST00000425192.1 GENCODE experimental pipeline ENST00000409840.3 alternative 5' UTR ENST00000432738.1 alternative 5' UTR ENST00000454956.1 alternative 5' UTR ENST00000423446.1 alternative 5' UTR ENST00000243806.2 alternative 3' UTR ENST00000409777.1 alternative 5' UTR ENST00000451538.1 not organism-supported ENST00000409802.2 non-organism_supported ENST00000409802.2 not organism-supported ENST00000423838.1 GENCODE experimental pipeline ENST00000424132.1 alternative 5' UTR ENST00000437454.1 alternative 5' UTR ENST00000443477.1 alternative 5' UTR ENST00000423616.1 alternative 5' UTR ENST00000448992.1 alternative 5' UTR ENST00000436481.1 alternative 5' UTR ENST00000439598.2 rs6729258 ENST00000439598.2 non canonical polymorphism ENST00000423098.1 alternative 5' UTR ENST00000354503.6 alternative 5' UTR ENST00000452930.1 alternative 5' UTR ENST00000525195.1 alternative 5' UTR ENST00000349901.7 alternative 5' UTR ENST00000436237.1 alternative 5' UTR ENST00000443428.2 alternative 5' UTR ENST00000418961.1 alternative 5' UTR ENST00000449706.1 alternative 5' UTR ENST00000413096.1 GENCODE experimental pipeline ENST00000456524.1 alternative 5' UTR ENST00000419059.1 alternative 5' UTR ENST00000409456.2 alternative 5' UTR ENST00000426132.1 GENCODE experimental pipeline ENST00000442062.1 GENCODE experimental pipeline ENST00000435716.1 alternative 5' UTR ENST00000428959.1 alternative 5' UTR ENST00000430954.1 alternative 5' UTR ENST00000343290.5 alternative 5' UTR ENST00000409992.1 not organism-supported ENST00000432957.1 GENCODE experimental pipeline ENST00000425822.1 alternative 5' UTR ENST00000436869.1 alternative 5' UTR ENST00000445199.1 GENCODE experimental pipeline ENST00000258381.6 NP_536349 ENST00000258382.5 NP_004501 ENST00000409815.2 alternative 5' UTR ENST00000416610.1 alternative 5' UTR ENST00000454058.1 GENCODE experimental pipeline ENST00000392045.3 NP_009168 ENST00000340126.4 NP_001073860 ENST00000414539.1 GENCODE experimental pipeline ENST00000415174.1 GENCODE experimental pipeline ENST00000409788.3 alternative 5' UTR ENST00000410084.3 alternative 5' UTR ENST00000457215.1 alternative 5' UTR ENST00000541852.1 alternative 5' UTR ENST00000409704.2 alternative 5' UTR ENST00000418408.2 alternative 5' UTR ENST00000415628.1 GENCODE experimental pipeline ENST00000438398.1 alternative 5' UTR ENST00000424440.1 alternative 3' UTR ENST00000452881.1 NP_620712 ENST00000433428.2 alternative 3' UTR ENST00000455816.1 alternative 3' UTR ENST00000495639.1 alternative 3' UTR ENST00000463834.1 GENCODE experimental pipeline ENST00000440107.1 alternative 5' UTR ENST00000415129.1 GENCODE experimental pipeline ENST00000370380.2 GENCODE experimental pipeline ENST00000417652.1 alternative 5' UTR ENST00000453992.1 alternative 5' UTR ENST00000436894.1 alternative 5' UTR ENST00000466801.1 not organism-supported ENST00000410024.1 alternative 5' UTR ENST00000409091.1 not organism-supported ENST00000412922.1 not organism-supported ENST00000409852.1 alternative 3' UTR ENST00000441279.1 alternative 5' UTR ENST00000413841.1 GENCODE experimental pipeline ENST00000392027.2 upstream_ATG-15 aa ENST00000441266.1 GENCODE experimental pipeline ENST00000439072.1 not organism-supported ENST00000409322.1 non_organism_supported ENST00000415506.1 GENCODE experimental pipeline ENST00000427698.1 alternative 5' UTR ENST00000410095.1 alternative 5' UTR ENST00000427233.1 alternative 5' UTR ENST00000373563.4 alternative 5' UTR ENST00000428883.1 alternative 5' UTR ENST00000421433.1 alternative 5' UTR ENST00000425040.1 alternative 5' UTR ENST00000423659.1 not organism-supported ENST00000463554.1 not organism-supported ENST00000429187.1 alternative 5' UTR ENST00000440945.1 alternative 5' UTR ENST00000427649.1 not organism-supported ENST00000410029.1 alternative 5' UTR ENST00000444142.1 not organism-supported ENST00000448993.1 alternative 5' UTR ENST00000409533.1 alternative 5' UTR ENST00000409230.1 upstream_ATG-24 aa ENST00000422935.1 This gene fragment and fragment AC114729.1-001 are part of the same gene; there is a genomic sequence gap between these 2 fragments ENST00000451407.1 This gene fragment and fragment AC114729.1-006 are part of the same gene; there is a genomic sequence gap between these 2 fragments ENST00000435188.1 This gene fragment and fragment AC114729.1-005 are part of the same gene; there is a genomic sequence gap between these 2 fragments ENST00000415617.1 This gene fragment and fragment AC114729.1-002 are part of the same gene; there is a genomic sequence gap between these 2 fragments ENST00000447536.1 alternative 5' UTR ENST00000489613.1 not organism-supported ENST00000427112.2 alternative 5' UTR ENST00000411486.1 FLJ90328 ENST00000434039.1 GENCODE experimental pipeline ENST00000456930.1 not organism-supported ENST00000475044.1 alternative 5' UTR ENST00000418025.1 GENCODE experimental pipeline ENST00000439798.1 GENCODE experimental pipeline ENST00000413842.1 GENCODE experimental pipeline ENST00000416021.1 alternative 5' UTR ENST00000409212.1 alternative 5' UTR ENST00000344528.4 alternative 5' UTR ENST00000444916.1 alternative 5' UTR ENST00000446904.1 alternative 5' UTR ENST00000462602.2 not organism-supported ENST00000454947.1 alternative 5' UTR ENST00000444926.1 GENCODE experimental pipeline ENST00000449362.1 GENCODE experimental pipeline ENST00000409538.1 non-organism_supported ENST00000448025.1 non-organism_supported ENST00000453371.1 not organism-supported ENST00000440498.1 GENCODE experimental pipeline ENST00000440101.1 GENCODE experimental pipeline ENST00000430053.1 not organism-supported ENST00000409100.1 not organism-supported ENST00000467572.1 non-organism_supported ENST00000413353.1 GENCODE experimental pipeline ENST00000447924.1 alternative 5' UTR ENST00000244820.2 LOC93463 ENST00000418430.1 GENCODE experimental pipeline ENST00000392008.2 NP_937832 ENST00000409334.1 not organism-supported ENST00000447464.1 alternative 3' UTR ENST00000445534.2 GENCODE experimental pipeline ENST00000295550.4 NP_004360 ENST00000409162.1 GENCODE experimental pipeline ENST00000422695.1 alternative 5' UTR ENST00000429898.1 alternative 5' UTR ENST00000409822.1 not organism-supported ENST00000452801.1 GENCODE experimental pipeline ENST00000417947.1 GENCODE experimental pipeline ENST00000480583.1 upstream_atg-1aa ENST00000409864.1 NP_001073973 ENST00000404910.2 alternative 5' UTR ENST00000409726.1 alternative 5' UTR ENST00000409332.1 not organism-supported ENST00000434655.1 alternative 5' UTR ENST00000434137.2 not organism-supported ENST00000449891.1 subject to nonsense-mediated decay ENST00000449191.1 subject to nonsense-mediated decay ENST00000423032.1 alternative 5' UTR ENST00000473274.1 FLJ37034 ENST00000473274.1 hypothetical protein LOC151176 ENST00000409376.1 hypothetical protein LOC151174 ENST00000409942.1 alternative 5' UTR ENST00000470346.1 hypothetical protein LOC151174 ENST00000431832.1 alternative 5' UTR ENST00000481566.1 not organism-supported ENST00000446979.1 GENCODE experimental pipeline ENST00000448543.1 GENCODE experimental pipeline ENST00000441444.1 GENCODE experimental pipeline ENST00000455228.1 GENCODE experimental pipeline ENST00000532238.1 alternative 5' UTR ENST00000446029.1 GENCODE experimental pipeline ENST00000404554.1 not organism-supported ENST00000453063.1 unitary_pseudogene ENST00000391989.2 upstream_ATG-25aa ENST00000457178.1 not organism-supported ENST00000404327.3 GENCODE experimental pipeline ENST00000418708.1 alternative 5' UTR ENST00000411765.1 alternative 5' UTR ENST00000404753.3 not organism-supported ENST00000319838.5 upstream_ATG-21aa ENST00000403859.1 upstream_ATG-21aa ENST00000403859.1 alternative 5' UTR ENST00000407714.1 alternative 5' UTR ENST00000448728.1 alternative 5' UTR ENST00000414499.1 alternative 5' UTR ENST00000443866.1 GENCODE experimental pipeline ENST00000457369.1 GENCODE experimental pipeline ENST00000425110.1 GENCODE experimental pipeline ENST00000493169.1 NAGNAG ENST00000424798.1 not organism-supported ENST00000405260.1 alternative 5' UTR ENST00000452907.1 alternative 5' UTR ENST00000407025.1 not organism-supported ENST00000407025.1 alternative 5' UTR ENST00000427172.1 alternative 5' UTR ENST00000391976.2 alternative 5' UTR ENST00000310931.4 alternative 5' UTR ENST00000422933.1 alternative 5' UTR ENST00000452065.1 alternative 5' UTR ENST00000444092.1 alternative 5' UTR ENST00000441124.1 alternative 5' UTR ENST00000426343.1 upstream_ATG-36aa ENST00000426343.1 alternative 5' UTR ENST00000413241.1 upstream_ATG-36aa ENST00000413241.1 alternative 5' UTR ENST00000423693.1 alternative 5' UTR ENST00000425989.1 alternative 5' UTR ENST00000420451.1 alternative 5' UTR ENST00000422080.1 alternative 5' UTR ENST00000458564.1 alternative 5' UTR ENST00000427007.1 alternative 5' UTR ENST00000449504.1 alternative 5' UTR ENST00000417540.1 alternative 5' UTR ENST00000428524.1 alternative 5' UTR ENST00000445030.1 alternative 5' UTR ENST00000391971.2 alternative 5' UTR ENST00000407971.1 non-organism_supported ENST00000436795.1 alternative 5' UTR ENST00000402092.2 alternative 5' UTR ENST00000441533.1 alternative 5' UTR ENST00000437066.1 upstream_ATG_35aa ENST00000429791.1 alternative 5' UTR ENST00000420786.1 alternative 5' UTR ENST00000449239.1 upstream_ATG_19aa ENST00000449239.1 alternative 5' UTR ENST00000451310.1 alternative 3' UTR ENST00000418082.1 alternative 5' UTR ENST00000445489.1 alternative 5' UTR ENST00000412332.1 alternative 3' UTR ENST00000403346.3 alternative 5' UTR ENST00000401869.1 alternative 5' UTR ENST00000436402.1 not organism-supported ENST00000436402.1 alternative 5' UTR ENST00000405546.3 upstream_ATG-88aa ENST00000402096.1 upstream_ATG-74aa ENST00000430617.2 alternative 5' UTR ENST00000433036.1 GENCODE experimental pipeline ENST00000463932.1 not organism-supported ENST00000437164.1 not organism-supported ENST00000454048.1 non-organism_supported ENST00000417267.1 GENCODE experimental pipeline ENST00000437438.1 GENCODE experimental pipeline ENST00000405370.1 alternative 5' UTR ENST00000423583.1 alternative 5' UTR ENST00000404257.1 upstream_ATG-12aa ENST00000391969.2 alternative 5' UTR ENST00000420288.1 alternative 5' UTR ENST00000419912.1 not organism-supported ENST00000404031.1 LOC285095 ENST00000456398.1 LOC728323 ENST00000444990.1 LOC728323 ENST00000403324.2 LOC728323 ENST00000431796.1 LOC728323 ENST00000442213.1 LOC728323 ENST00000416103.1 LOC728323 ENST00000433444.1 LOC728323 ENST00000422330.1 alternative 5' UTR ENST00000455083.1 alternative 5' UTR ENST00000418658.1 alternative 5' UTR ENST00000438282.2 alternative 5' UTR ENST00000434053.1 alternative 5' UTR ENST00000397459.2 NP_783302.1 ENST00000473845.1 GENCODE experimental pipeline ENST00000447256.2 GENCODE experimental pipeline ENST00000438560.1 GENCODE experimental pipeline ENST00000256452.3 alternative 5' UTR ENST00000311981.8 alternative 5' UTR ENST00000430514.2 alternative 5' UTR ENST00000445701.1 alternative 5' UTR ENST00000427088.1 alternative 5' UTR ENST00000251607.6 NP_886552 ENST00000339437.6 alternative 5' UTR ENST00000420393.1 alternative 5' UTR ENST00000402675.1 FLJ42143 ENST00000413000.1 alternative 5' UTR ENST00000484993.1 GENCODE experimental pipeline ENST00000319331.3 NP_065924.3 ENST00000358065.4 NP_006506.3 ENST00000425863.1 GENCODE experimental pipeline ENST00000358950.4 GENCODE experimental pipeline ENST00000462115.1 GENCODE experimental pipeline ENST00000412804.1 GENCODE experimental pipeline ENST00000357086.4 isoform 1 ENST00000357086.4 non-canonical splice sites between exons 26 and 27 ENST00000456211.2 387857 ENST00000456211.2 isoform 2 ENST00000456211.2 non-canonical splice sites between exons 25 and 26 ENST00000443694.2 non-canonical splice sites between exons 23 and 24 ENST00000414938.1 Wagner et al. (2007) PMID: 17351112 ENST00000458338.1 P25063 ENST00000440923.3 non canonical polymorphism ENST00000445087.1 GENCODE experimental pipeline ENST00000426878.1 GENCODE experimental pipeline ENST00000341795.3 LOC51066 ENST00000316793.3 NP_000907 ENST00000431493.1 alternative 5' UTR ENST00000413832.1 alternative 5' UTR ENST00000452837.2 alternative 5' UTR ENST00000417036.1 alternative 5' UTR ENST00000419437.1 alternative 5' UTR ENST00000515662.1 alternative 5' UTR ENST00000416603.1 GENCODE experimental pipeline ENST00000406341.1 not organism-supported ENST00000406341.1 alternative 5' UTR ENST00000302463.6 DKFZp686J18276 ENST00000493918.1 KIAA1757 ENST00000466242.1 FLJ45365 ENST00000431250.1 GENCODE experimental pipeline ENST00000433861.2 GENCODE experimental pipeline ENST00000424362.1 GENCODE experimental pipeline ENST00000420291.1 alternative 5' UTR ENST00000302008.8 NP_058437.1 ENST00000383826.5 NP_058436.1 ENST00000426518.1 GENCODE experimental pipeline ENST00000440161.1 alternative 5' UTR ENST00000439043.1 alternative 5' UTR ENST00000453882.1 GENCODE experimental pipeline ENST00000418745.1 GENCODE experimental pipeline ENST00000430718.1 alternative 5' UTR ENST00000455274.1 GENCODE experimental pipeline ENST00000423108.1 GENCODE experimental pipeline ENST00000433535.2 NP_001136019.1 ENST00000397170.3 alternative 5' UTR ENST00000452070.1 alternative 5' UTR ENST00000435417.1 GENCODE experimental pipeline ENST00000449238.2 NP_001128417.1 ENST00000437422.2 NP_001128416.1 ENST00000439975.2 NP_001128418.1 ENST00000429122.1 alternative 5' UTR ENST00000397102.1 GENCODE experimental pipeline ENST00000432213.1 GENCODE experimental pipeline ENST00000460129.1 not organism-supported ENST00000440266.2 GENCODE experimental pipeline ENST00000425938.1 alternative 5' UTR ENST00000414969.2 GENCODE experimental pipeline ENST00000438284.2 alternative 5' UTR ENST00000431010.2 alternative 5' UTR ENST00000413416.1 alternative 5' UTR ENST00000451513.1 alternative 5' UTR ENST00000444619.1 alternative 5' UTR ENST00000419112.1 alternative 5' UTR ENST00000423116.1 alternative 5' UTR ENST00000414717.1 GENCODE experimental pipeline ENST00000413604.1 GENCODE experimental pipeline ENST00000445411.1 alternative 5' UTR ENST00000418000.1 alternative 5' UTR ENST00000458499.1 GENCODE experimental pipeline ENST00000417206.2 alternative 5' UTR ENST00000424709.1 GENCODE experimental pipeline ENST00000424709.1 alternative 5' UTR ENST00000419541.1 alternative 5' UTR ENST00000437722.1 GENCODE experimental pipeline ENST00000437722.1 alternative 5' UTR ENST00000414047.1 GENCODE experimental pipeline ENST00000425297.1 not organism-supported ENST00000397010.2 alternative 5' UTR ENST00000397029.3 alternative 5' UTR ENST00000309576.6 alternative 5' UTR ENST00000397015.2 alternative 5' UTR ENST00000455517.1 alternative 5' UTR ENST00000397026.2 not organism-supported ENST00000438682.1 alternative 5' UTR ENST00000397000.1 GENCODE experimental pipeline ENST00000287820.6 NP_056953.2 ENST00000397023.1 not organism-supported ENST00000446004.1 alternative 5' UTR ENST00000402228.3 alternative 5' UTR ENST00000447550.1 GENCODE experimental pipeline ENST00000448482.1 GENCODE experimental pipeline ENST00000442415.2 not organism-supported ENST00000264728.8 alternative 5' UTR ENST00000454887.1 GENCODE experimental pipeline ENST00000435983.1 alternative 5' UTR ENST00000396953.2 alternative 5' UTR ENST00000457131.1 alternative 5' UTR ENST00000434963.1 alternative 5' UTR ENST00000254508.5 non-canonical splice donor site between exons 7 and 8 ENST00000420141.2 non-canonical splice donor site between exons 7 and 8 ENST00000424112.2 GENCODE experimental pipeline ENST00000433119.1 GENCODE experimental pipeline ENST00000402259.1 GENCODE experimental pipeline ENST00000522202.1 NP_001129513.1 ENST00000416248.1 GENCODE experimental pipeline ENST00000437379.2 non-organism_supported ENST00000495099.2 not organism-supported ENST00000404922.3 isoform a precursor ENST00000295760.7 isoform b precursor ENST00000465610.1 alternative 5' UTR ENST00000492059.1 alternative 5' UTR ENST00000295761.7 GENCODE experimental pipeline ENST00000489346.1 GENCODE experimental pipeline ENST00000532880.1 alternative 5' UTR ENST00000530586.1 alternative 5' UTR ENST00000524375.1 alternative 5' UTR ENST00000529129.1 alternative 5' UTR ENST00000528312.1 alternative 5' UTR ENST00000424053.1 alternative 5' UTR ENST00000528067.1 alternative 5' UTR ENST00000429201.1 alternative 5' UTR ENST00000532924.1 alternative 5' UTR ENST00000528040.1 alternative 5' UTR ENST00000295767.5 NP_653237.1 ENST00000396914.3 NP_001091972.1 ENST00000420253.1 GENCODE experimental pipeline ENST00000502417.1 FLJ23502 ENST00000452775.1 alternative 5' UTR ENST00000424242.1 GENCODE experimental pipeline ENST00000412910.1 alternative 5' UTR ENST00000422657.1 GENCODE experimental pipeline ENST00000413118.1 alternative 5' UTR ENST00000435454.1 alternative 5' UTR ENST00000393102.3 alternative 5' UTR ENST00000437120.1 alternative 5' UTR ENST00000439011.1 GENCODE experimental pipeline ENST00000413194.1 GENCODE experimental pipeline ENST00000446690.2 DIVA ENST00000383791.3 isoform a ENST00000383791.3 NP_004835.2 ENST00000426925.1 alternative 5' UTR ENST00000408919.3 NP_001018009.2 ENST00000366391.2 alternative 5' UTR ENST00000450625.1 alternative 5' UTR ENST00000417936.1 alternative 5' UTR ENST00000443029.1 alternative 3' UTR ENST00000458728.1 GENCODE experimental pipeline ENST00000383790.3 NP_689609.2 ENST00000450816.2 GENCODE experimental pipeline ENST00000494875.2 GENCODE experimental pipeline ENST00000454772.1 GENCODE experimental pipeline ENST00000495788.1 GENCODE experimental pipeline ENST00000451445.2 GENCODE experimental pipeline ENST00000303498.5 NP_000051.1 ENST00000480711.1 GENCODE experimental pipeline ENST00000467027.1 GENCODE experimental pipeline ENST00000437172.1 GENCODE experimental pipeline ENST00000436193.1 alternative 5' UTR ENST00000437509.1 GENCODE experimental pipeline ENST00000470031.1 GENCODE experimental pipeline ENST00000435829.1 alternative 5' UTR ENST00000451036.1 alternative 5' UTR ENST00000470458.1 GENCODE experimental pipeline ENST00000449415.1 alternative 5' UTR ENST00000431547.1 alternative 5' UTR ENST00000429949.1 GENCODE experimental pipeline ENST00000429383.4 alternative 5' UTR ENST00000415814.2 alternative 5' UTR ENST00000507877.1 alternative 5' UTR ENST00000449613.1 GENCODE experimental pipeline ENST00000454909.2 alternative 5' UTR ENST00000440737.1 alternative 5' UTR ENST00000452260.2 alternative 5' UTR ENST00000415069.1 alternative 5' UTR ENST00000457005.1 alternative 5' UTR ENST00000414509.1 alternative 5' UTR ENST00000487699.1 alternative 5' UTR ENST00000444341.1 alternative 5' UTR ENST00000450898.1 alternative 5' UTR ENST00000453361.1 GENCODE experimental pipeline ENST00000344838.4 GENCODE experimental pipeline ENST00000344838.4 FLJ16028 ENST00000467602.1 GENCODE experimental pipeline ENST00000443878.1 alternative 5' UTR ENST00000422242.1 GENCODE experimental pipeline ENST00000425061.1 alternative 5' UTR ENST00000443724.1 alternative 5' UTR ENST00000421451.1 alternative 5' UTR ENST00000452020.1 alternative 5' UTR ENST00000412997.1 Isoform A1 ENST00000437051.1 Isoform B1 ENST00000417364.1 alternative 5' UTR ENST00000448208.1 GENCODE experimental pipeline ENST00000469927.1 GENCODE experimental pipeline ENST00000425792.1 alternative 5' UTR ENST00000306627.3 Isoform 1 ENST00000346855.3 Isoform 2 ENST00000481622.1 GENCODE experimental pipeline ENST00000481622.1 not organism-supported ENST00000442670.1 alternative 5' UTR ENST00000443659.2 alternative 5' UTR ENST00000421515.2 alternative 5' UTR ENST00000425478.2 alternative 5' UTR ENST00000437230.1 alternative 5' UTR ENST00000415901.2 alternative 5' UTR ENST00000416026.2 alternative 5' UTR ENST00000307839.4 corf ENST00000422218.1 GENCODE experimental pipeline ENST00000422218.1 alternative 5' UTR ENST00000434031.2 alternative 5' UTR ENST00000434031.2 not organism-supported ENST00000413699.1 alternative 5' UTR ENST00000412097.1 alternative 5' UTR ENST00000415719.1 alternative 5' UTR ENST00000435882.1 alternative 5' UTR ENST00000354811.5 alternative 5' UTR ENST00000356447.4 corf ENST00000416420.1 alternative 5' UTR ENST00000280696.5 GENCODE experimental pipeline ENST00000413780.1 alternative 5' UTR ENST00000415021.1 alternative 5' UTR ENST00000447875.1 alternative 5' UTR ENST00000453729.2 alternative 5' UTR ENST00000431815.1 alternative 5' UTR ENST00000447414.1 alternative 5' UTR ENST00000428492.1 alternative 5' UTR ENST00000418247.1 alternative 5' UTR ENST00000438096.1 GENCODE experimental pipeline ENST00000437042.2 isoform 2 ENST00000489694.1 GENCODE experimental pipeline ENST00000458646.1 alternative 5' UTR ENST00000424225.1 alternative 5' UTR ENST00000427041.1 GENCODE experimental pipeline ENST00000464688.1 GENCODE experimental pipeline ENST00000452098.1 alternative 5' UTR ENST00000449808.1 Probable_NMD_if_extended ENST00000428266.1 alternative 5' UTR ENST00000414619.1 alternative 5' UTR ENST00000432040.1 alternative 5' UTR ENST00000417744.1 alternative 5' UTR ENST00000456208.2 alternative 5' UTR ENST00000446601.1 GENCODE experimental pipeline ENST00000383771.4 NP_001026911.1 ENST00000357467.2 NP_689747.2 ENST00000435584.1 alternative 5' UTR ENST00000474938.1 GENCODE experimental pipeline ENST00000435750.1 alternative 5' UTR ENST00000429845.1 alternative 5' UTR ENST00000295736.5 NP_003606.3 ENST00000428179.1 non-organism_supported ENST00000429369.1 GENCODE experimental pipeline ENST00000334100.6 NP_001127905.1 ENST00000420543.2 NP_001127904.1 ENST00000457172.1 alternative 5' UTR ENST00000414162.1 alternative 5' UTR ENST00000415852.1 alternative 5' UTR ENST00000420223.1 alternative 5' UTR ENST00000428875.1 GENCODE experimental pipeline ENST00000383767.2 NM_001003793.1 ENST00000273139.9 NM_014483.2 ENST00000383766.2 NM_001003792.1 ENST00000414547.1 GENCODE experimental pipeline ENST00000450746.1 GENCODE experimental pipeline ENST00000295754.5 NM_003242.5 ENST00000359013.4 NM_001024847.2 ENST00000282538.5 NP_997242.2 ENST00000429432.1 alternative 5' UTR ENST00000425459.1 GENCODE experimental pipeline ENST00000494439.1 non-canonical splice donor site between exon 2 and exon 3 ENST00000494439.1 non canonical other ENST00000430408.1 GENCODE experimental pipeline ENST00000399402.2 Isoform b ENST00000307363.4 Isoform a ENST00000481581.1 GENCODE experimental pipeline ENST00000440656.1 GENCODE experimental pipeline ENST00000450835.1 GENCODE experimental pipeline ENST00000436768.1 GENCODE experimental pipeline ENST00000416695.2 Isoform 2 ENST00000342462.4 Isoform 1 ENST00000449224.1 GENCODE experimental pipeline ENST00000283628.5 alternative 5' UTR ENST00000467613.1 not organism-supported ENST00000456378.1 alternative 5' UTR ENST00000487553.1 GENCODE experimental pipeline ENST00000482561.1 not organism-supported ENST00000450234.1 alternative 5' UTR ENST00000428373.1 NP_938409.1 ENST00000428373.1 NP_001020239.1 ENST00000428373.1 NP_001020240.1 ENST00000421492.1 alternative 5' UTR ENST00000449196.1 alternative 5' UTR ENST00000187397.4 NP_057384.2 ENST00000452563.1 alternative 5' UTR ENST00000438577.1 alternative 5' UTR ENST00000419330.1 alternative 5' UTR ENST00000427542.1 alternative 5' UTR ENST00000474696.1 alternative 5' UTR ENST00000412048.1 alternative 5' UTR ENST00000396482.2 alternative 5' UTR ENST00000432682.1 alternative 5' UTR ENST00000413378.1 alternative 5' UTR ENST00000396481.2 alternative 5' UTR ENST00000441454.1 alternative 5' UTR ENST00000436702.1 alternative 5' UTR ENST00000438071.1 alternative 5' UTR ENST00000415706.1 GENCODE experimental pipeline ENST00000416516.2 NP_208382.1 ENST00000428977.2 gene fragments AC105749.6-006, AC105749.6-007, AC105749.8-001 and AC105749.7-001 are part of the same gene; the exact structure linking the fragments is yet to be determined ENST00000513141.1 gene fragments AC105749.6-006, AC105749.6-007, AC105749.8-001 and AC105749.7-001 are part of the same gene; the exact structure linking the fragments is yet to be determined ENST00000505962.1 gene fragments AC105749.6-006, AC105749.6-007, AC105749.8-001 and AC105749.7-001 are part of the same gene; the exact structure linking the fragments is yet to be determined ENST00000463764.1 GENCODE experimental pipeline ENST00000511973.1 gene fragments AC105749.6-006, AC105749.6-007, AC105749.8-001 and AC105749.7-001 are part of the same gene; the exact structure linking the fragments is yet to be determined ENST00000231790.2 NP_000240.1 ENST00000458205.2 GENCODE experimental pipeline ENST00000455445.2 alternative 5' UTR ENST00000441265.1 alternative 5' UTR ENST00000429117.1 alternative 5' UTR ENST00000416425.1 GENCODE experimental pipeline ENST00000438374.1 alternative 5' UTR ENST00000434749.1 alternative 5' UTR ENST00000436858.1 alternative 5' UTR ENST00000452742.1 alternative 5' UTR ENST00000425932.1 alternative 5' UTR ENST00000328376.5 NP_848029.2 ENST00000332506.3 GENCODE experimental pipeline ENST00000426078.1 NP_848032.1 ENST00000425564.2 alternative 5' UTR ENST00000264741.5 NP_002198.2 ENST00000449586.1 GENCODE experimental pipeline ENST00000447745.1 GENCODE experimental pipeline ENST00000283713.6 NP_056957.3 ENST00000416303.1 alternative 5' UTR ENST00000492491.2 alternative 5' UTR ENST00000463876.1 NP_001124436.1 ENST00000473834.1 GENCODE experimental pipeline ENST00000451419.1 GENCODE experimental pipeline ENST00000333167.8 NP_001598.1 ENST00000396334.3 NP_002459.2 ENST00000443433.2 GENCODE experimental pipeline ENST00000446845.1 GENCODE experimental pipeline ENST00000448498.1 alternative 5' UTR ENST00000427323.1 GENCODE experimental pipeline ENST00000487569.1 GENCODE experimental pipeline ENST00000441531.1 GENCODE experimental pipeline ENST00000414099.2 NP_001092875.1 ENST00000413689.1 NP_001092874.1 ENST00000327956.6 alternative 5' UTR ENST00000449082.2 non canonical U12 ENST00000432250.1 GENCODE experimental pipeline ENST00000302328.3 at/ac splicing between exons 2 and 3 ENST00000302328.3 at/ac splicing between exons 23 and 24 ENST00000456224.3 at/ac splicing between exons 23 and 24 ENST00000456224.3 at/ac splicing between exons 2 and 3 ENST00000444237.2 at/ac splicing between exons 2 and 3 ENST00000444237.2 AT/AC splicing between exons 23 and 24 ENST00000441361.1 GENCODE experimental pipeline ENST00000319283.3 corf ENST00000422110.2 GENCODE experimental pipeline ENST00000427459.1 GENCODE experimental pipeline ENST00000416741.1 GENCODE experimental pipeline ENST00000493751.1 GENCODE experimental pipeline ENST00000440121.1 Sw:Q8NDW8-6.2 ENST00000273153.5 corf ENST00000514182.1 alternative 5' UTR ENST00000435290.1 alternative 5' UTR ENST00000412814.1 alternative 5' UTR ENST00000458478.1 alternative 5' UTR ENST00000451925.1 alternative 5' UTR ENST00000428261.1 alternative 5' UTR ENST00000415443.1 alternative 5' UTR ENST00000447324.1 alternative 5' UTR ENST00000436143.2 GENCODE experimental pipeline ENST00000441980.2 alternative 5' UTR ENST00000444716.1 alternative 5' UTR ENST00000420850.1 GENCODE experimental pipeline ENST00000456402.1 alternative 5' UTR ENST00000445129.1 GENCODE experimental pipeline ENST00000445129.1 alternative 5' UTR ENST00000396203.2 alternative 5' UTR ENST00000522736.1 NP_001138566 ENST00000521353.1 NP_001138554.1 ENST00000432264.2 NP_001138565.1 ENST00000420891.1 alternative 5' UTR ENST00000418905.1 GENCODE experimental pipeline ENST00000403205.2 alternative 5' UTR ENST00000453351.1 alternative 5' UTR ENST00000456335.1 GENCODE experimental pipeline ENST00000412811.1 GENCODE experimental pipeline ENST00000453828.1 GENCODE experimental pipeline ENST00000426215.1 GENCODE experimental pipeline ENST00000426215.1 alternative 5' UTR ENST00000405570.1 alternative 5' UTR ENST00000433400.1 alternative 5' UTR ENST00000431914.1 alternative 5' UTR ENST00000450969.1 alternative 5' UTR ENST00000441708.1 alternative 5' UTR ENST00000471014.1 GENCODE experimental pipeline ENST00000420927.1 GENCODE experimental pipeline ENST00000420927.1 alternative 5' UTR ENST00000377407.3 rare donor site between exon 1 and exon 2 ENST00000449246.1 GENCODE experimental pipeline ENST00000427771.1 GENCODE experimental pipeline ENST00000396169.2 alternative 5' UTR ENST00000434608.1 alternative 5' UTR ENST00000441172.1 alternative 5' UTR ENST00000450274.1 GENCODE experimental pipeline ENST00000439731.1 GENCODE experimental pipeline ENST00000417572.1 alternative 5' UTR ENST00000456515.1 GENCODE experimental pipeline ENST00000456515.1 alternative 5' UTR ENST00000450981.1 alternative 5' UTR ENST00000416880.1 alternative 5' UTR ENST00000232974.6 NP_660149.2 ENST00000435327.2 NMD if extended ENST00000441594.1 alternative 5' UTR ENST00000457462.1 GENCODE experimental pipeline ENST00000416756.1 alternative 5' UTR ENST00000418900.2 alternative 5' UTR ENST00000452906.2 NP_001093138.1 ENST00000442925.1 alternative 5' UTR ENST00000437102.1 GENCODE experimental pipeline ENST00000328199.6 NP_001128128.1 ENST00000441964.1 alternative 5' UTR ENST00000429705.2 alternative 5' UTR ENST00000296088.7 alternative 5' UTR ENST00000468628.2 GENCODE experimental pipeline ENST00000414522.2 GENCODE experimental pipeline ENST00000448045.1 GENCODE experimental pipeline ENST00000444344.1 alternative 5' UTR ENST00000456438.1 alternative 5' UTR ENST00000436073.1 alternative 5' UTR ENST00000383746.3 NP_001025011.1 ENST00000417237.1 alternative 5' UTR ENST00000396078.3 alternative 5' UTR ENST00000342649.4 NP_776187.2 ENST00000431636.1 alternative 5' UTR ENST00000426540.1 alternative 5' UTR ENST00000341840.3 NP_079445.1 ENST00000273320.3 NP_061121.2 ENST00000447279.1 GENCODE experimental pipeline ENST00000416644.1 alternative 5' UTR ENST00000441021.1 alternative 5' UTR ENST00000412641.1 alternative 5' UTR ENST00000383744.4 alternative 5' UTR ENST00000344387.4 alternative 5' UTR ENST00000415571.2 alternative 5' UTR ENST00000432115.2 alternative 5' UTR ENST00000399560.2 alternative 5' UTR ENST00000453164.1 GENCODE experimental pipeline ENST00000453164.1 alternative 5' UTR ENST00000436624.2 alternative 5' UTR ENST00000411443.1 alternative 5' UTR ENST00000481166.2 non-organism_supported ENST00000427258.1 GENCODE experimental pipeline ENST00000342790.4 GENCODE experimental pipeline ENST00000478669.1 GENCODE experimental pipeline ENST00000478669.1 not organism-supported ENST00000477865.1 GENCODE experimental pipeline ENST00000498168.1 GENCODE experimental pipeline ENST00000459856.1 GENCODE experimental pipeline ENST00000415258.1 alternative 5' UTR ENST00000431023.1 alternative 5' UTR ENST00000430399.1 alternative 5' UTR ENST00000440097.1 GENCODE experimental pipeline ENST00000353278.4 Isoform 2 ENST00000358525.4 Isoform 1 ENST00000413781.1 GENCODE experimental pipeline ENST00000445698.1 GENCODE experimental pipeline ENST00000357632.2 Isoform A ENST00000395963.2 Isoform B ENST00000422395.1 GENCODE experimental pipeline ENST00000438735.1 alternative 5' UTR ENST00000458629.1 alternative 5' UTR ENST00000457814.1 alternative 5' UTR ENST00000395946.2 alternative 5' UTR ENST00000395940.2 alternative 5' UTR ENST00000452454.1 alternative 5' UTR ENST00000457243.1 alternative 5' UTR ENST00000395942.2 alternative 5' UTR ENST00000421659.1 alternative 5' UTR ENST00000445772.1 alternative 5' UTR ENST00000400880.3 alternative 5' UTR ENST00000433848.1 alternative 5' UTR ENST00000400882.2 alternative 5' UTR ENST00000441909.1 GENCODE experimental pipeline ENST00000417439.1 GENCODE experimental pipeline ENST00000443496.1 GENCODE experimental pipeline ENST00000415180.1 GENCODE experimental pipeline ENST00000498301.1 GENCODE experimental pipeline ENST00000296144.3 alternative 5' UTR ENST00000415953.1 alternative 5' UTR ENST00000460241.1 alternative 5' UTR ENST00000447340.1 GENCODE experimental pipeline ENST00000431168.1 alternative 5' UTR ENST00000418619.1 alternative 5' UTR ENST00000427125.2 alternative 5' UTR ENST00000446836.1 alternative 5' UTR ENST00000423436.1 GENCODE experimental pipeline ENST00000452770.2 alternative 5' UTR ENST00000456548.1 GENCODE experimental pipeline ENST00000425853.1 alternative 5' UTR ENST00000416847.1 alternative 5' UTR ENST00000495603.2 alternative 5' UTR ENST00000448217.1 alternative 5' UTR ENST00000446787.1 GENCODE experimental pipeline ENST00000423088.1 GENCODE experimental pipeline ENST00000439356.1 alternative 5' UTR ENST00000437972.1 alternative 5' UTR ENST00000427617.2 GENCODE experimental pipeline ENST00000440261.2 GENCODE experimental pipeline ENST00000452211.1 alternative 5' UTR ENST00000456495.1 GENCODE experimental pipeline ENST00000447724.1 GENCODE experimental pipeline ENST00000358536.4 alternative 5' UTR ENST00000412398.2 alternative 5' UTR ENST00000442740.1 alternative 5' UTR ENST00000446140.1 alternative 5' UTR ENST00000438370.1 alternative 5' UTR ENST00000444115.1 alternative 5' UTR ENST00000416568.1 GENCODE experimental pipeline ENST00000452531.1 GENCODE experimental pipeline ENST00000422701.1 GENCODE experimental pipeline ENST00000328333.8 NP_000085 ENST00000455886.2 GENCODE experimental pipeline ENST00000413374.1 GENCODE experimental pipeline ENST00000413654.1 GENCODE experimental pipeline ENST00000437427.1 alternative 5' UTR ENST00000413298.1 alternative 5' UTR ENST00000443964.1 GENCODE experimental pipeline ENST00000296446.8 GENCODE experimental pipeline ENST00000437821.2 confirm experimentally ENST00000437821.2 GENCODE experimental pipeline ENST00000438535.1 GENCODE experimental pipeline ENST00000430379.1 GENCODE experimental pipeline ENST00000449376.1 alternative 5' UTR ENST00000429900.2 alternative 5' UTR ENST00000415265.2 GENCODE experimental pipeline ENST00000448293.1 alternative 5' UTR ENST00000419837.1 alternative 5' UTR ENST00000440857.1 GENCODE experimental pipeline ENST00000429182.1 GENCODE experimental pipeline ENST00000442157.1 GENCODE experimental pipeline ENST00000357496.2 alternative 5' UTR ENST00000424300.1 alternative 5' UTR ENST00000437939.1 alternative 5' UTR ENST00000450685.1 GENCODE experimental pipeline ENST00000450685.1 alternative 5' UTR ENST00000411682.1 alternative 5' UTR ENST00000430979.1 GENCODE experimental pipeline ENST00000430979.1 alternative 5' UTR ENST00000452739.1 GENCODE experimental pipeline ENST00000398898.2 not organism-supported ENST00000398892.3 not organism-supported ENST00000479073.2 GENCODE experimental pipeline ENST00000305544.4 alternative 5' UTR ENST00000296449.5 alternative 5' UTR ENST00000452691.2 NP_835467.2 ENST00000431357.1 GENCODE experimental pipeline ENST00000419783.1 selenoprotein ENST00000454011.2 GENCODE experimental pipeline ENST00000445425.1 GENCODE experimental pipeline ENST00000427987.1 GENCODE experimental pipeline ENST00000430521.1 GENCODE experimental pipeline ENST00000421560.1 alternative 5' UTR ENST00000418588.1 alternative 5' UTR ENST00000452317.1 alternative 5' UTR ENST00000435508.2 alternative 5' UTR ENST00000428779.1 alternative 5' UTR ENST00000296452.4 NMD exception ENST00000491943.1 GENCODE experimental pipeline ENST00000454491.1 alternative 5' UTR ENST00000308388.6 alternative 5' UTR ENST00000468463.1 GENCODE experimental pipeline ENST00000494212.1 Em:CK430594.1 ENST00000463537.1 GENCODE experimental pipeline ENST00000296474.3 Isoform 1 ENST00000344206.4 Isoform 2 ENST00000434765.1 GENCODE experimental pipeline ENST00000412015.1 GENCODE experimental pipeline ENST00000417270.1 GENCODE experimental pipeline ENST00000417270.1 not organism-supported ENST00000416583.1 alternative 5' UTR ENST00000433811.1 alternative 5' UTR ENST00000491874.1 alternative 5' UTR ENST00000488807.2 GENCODE experimental pipeline ENST00000464013.1 not organism-supported ENST00000446471.1 GENCODE experimental pipeline ENST00000421682.1 GENCODE experimental pipeline ENST00000441305.1 alternative 5' UTR ENST00000437500.1 alternative 5' UTR ENST00000417905.1 alternative 5' UTR ENST00000474470.1 GENCODE experimental pipeline ENST00000414301.1 alternative 5' UTR ENST00000450338.1 alternative 5' UTR ENST00000426511.1 alternative 5' UTR ENST00000434342.1 alternative 5' UTR ENST00000420831.1 not organism-supported ENST00000420502.1 suspected genomic sequence error affecting CDS in coding exon 1 and 2 resulting in a missing g ENST00000491100.1 upORF is conserved back to horse, however, made as a transcript otherwise it would be NMD ENST00000480090.1 GENCODE experimental pipeline ENST00000440628.1 upORF not conserved and would induce NMD, so made putative CDS ENST00000426302.1 GENCODE experimental pipeline ENST00000453717.1 GENCODE experimental pipeline ENST00000421735.1 GENCODE experimental pipeline ENST00000418948.1 suspected genomic sequence error affecting exon 1 ENST00000426144.2 suspected genomic sequence error affecting exon 1 ENST00000436390.1 alternative 5' UTR ENST00000417393.1 alternative 5' UTR ENST00000443842.1 alternative 5' UTR ENST00000450489.1 alternative 5' UTR ENST00000442620.1 alternative 5' UTR ENST00000452674.1 alternative 5' UTR ENST00000395144.2 Isoform 1 ENST00000266031.4 alternative 5' UTR ENST00000320295.8 alternative 5' UTR ENST00000395143.2 Isoform 2 ENST00000457214.2 Isoform3 ENST00000447605.2 Isoform 5 ENST00000418723.1 alternative 5' UTR ENST00000452672.1 alternative 5' UTR ENST00000447092.1 alternative 5' UTR ENST00000395139.3 alternative 5' UTR ENST00000442581.1 alternative 5' UTR ENST00000458018.1 alternative 5' UTR ENST00000426286.1 alternative 5' UTR ENST00000428028.1 alternative 5' UTR ENST00000415028.1 alternative 5' UTR ENST00000415028.1 not organism-supported ENST00000231749.3 Isoform 1 ENST00000360165.3 Isoform 2 ENST00000425346.1 alternative 5' UTR ENST00000424512.1 alternative 5' UTR ENST00000418577.1 alternative 5' UTR ENST00000490926.1 GENCODE experimental pipeline ENST00000266025.3 PL6 protein (deleted in Small Cell Lung Carcinoma) ENST00000423994.2 non canonical U12 ENST00000266039.3 non canonical U12 ENST00000360963.3 non canonical U12 ENST00000422619.1 GENCODE experimental pipeline ENST00000232854.4 alternative 5' UTR ENST00000455834.1 alternative 5' UTR ENST00000446044.1 alternative 5' UTR ENST00000430409.1 alternative 5' UTR ENST00000457064.1 alternative 5' UTR ENST00000451680.1 GENCODE experimental pipeline ENST00000528157.1 NP_006001 ENST00000423656.1 gene fragments RP11-89F17.4-001 and RP11-89F17.5-001 are part of the same gene; an assembly gap between them contains one or more exons ENST00000504652.1 gene fragments RP11-89F17.4-001 and RP11-89F174-002 are part of the same gene; an assembly gap between them contains one or more exons ENST00000432863.1 GENCODE experimental pipeline ENST00000419358.1 alternative 5' UTR ENST00000412249.1 alternative 5' UTR ENST00000425781.1 alternative 5' UTR ENST00000415259.1 alternative 5' UTR ENST00000395057.1 alternative 5' UTR ENST00000416589.1 alternative 5' UTR ENST00000457927.1 alternative 5' UTR ENST00000444233.1 alternative 5' UTR ENST00000419928.1 alternative 5' UTR ENST00000442933.2 GENCODE experimental pipeline ENST00000446775.1 alternative 5' UTR ENST00000498510.1 alternative 5' UTR ENST00000461554.1 alternative 5' UTR ENST00000471622.1 GENCODE experimental pipeline ENST00000468324.1 alternative 5' UTR ENST00000466412.1 alternative 5' UTR ENST00000497653.1 alternative 5' UTR ENST00000489595.2 alternative 5' UTR ENST00000490063.1 alternative 5' UTR ENST00000483411.1 alternative 5' UTR ENST00000461544.1 alternative 5' UTR ENST00000483233.1 alternative 5' UTR ENST00000361143.5 alternative 5' UTR ENST00000525795.1 alternative 5' UTR ENST00000497864.1 GENCODE experimental pipeline ENST00000494478.1 GENCODE experimental pipeline ENST00000491470.1 GENCODE experimental pipeline ENST00000469863.1 GENCODE experimental pipeline ENST00000466397.1 alternative 5' UTR ENST00000479017.1 alternative 5' UTR ENST00000495383.1 alternative 5' UTR ENST00000475248.1 alternative 5' UTR ENST00000492277.1 alternative 5' UTR ENST00000493402.1 GENCODE experimental pipeline ENST00000494383.1 GENCODE experimental pipeline ENST00000499914.2 GENCODE experimental pipeline ENST00000443681.1 GENCODE experimental pipeline ENST00000296490.3 NP_079498 ENST00000461183.1 GENCODE experimental pipeline ENST00000472761.1 not organism-supported ENST00000466628.1 not organism-supported ENST00000462532.1 alternative 5' UTR ENST00000478707.1 non canonical conserved ENST00000478707.1 not organism-supported ENST00000461861.1 GENCODE experimental pipeline ENST00000496590.1 GENCODE experimental pipeline ENST00000477703.1 LOC440957 ENST00000446103.1 FLJ31979 ENST00000431678.1 alternative 5' UTR ENST00000420148.1 alternative 5' UTR ENST00000450271.1 alternative 5' UTR ENST00000439181.1 alternative 5' UTR ENST00000458294.1 alternative 5' UTR ENST00000424867.1 alternative 5' UTR ENST00000394783.3 alternative 5' UTR ENST00000233025.7 NP_054760.3 ENST00000383721.4 GENCODE experimental pipeline ENST00000461689.1 GENCODE experimental pipeline ENST00000465243.2 not organism-supported ENST00000513520.1 GENCODE experimental pipeline ENST00000486659.1 GENCODE experimental pipeline ENST00000485356.1 GENCODE experimental pipeline ENST00000394738.3 GENCODE experimental pipeline ENST00000478843.1 alternative 5' UTR ENST00000330452.3 alternative 5' UTR ENST00000487897.1 alternative 5' UTR ENST00000480258.1 suspected genomic sequence error affecting CDS in exon 8 ENST00000494659.2 suspected genomic sequence error affecting CDS in exon 7 ENST00000481085.1 GENCODE experimental pipeline ENST00000481668.1 alternative 5' UTR ENST00000467802.1 alternative 5' UTR ENST00000494338.1 GENCODE experimental pipeline ENST00000482349.1 GENCODE experimental pipeline ENST00000498740.1 GENCODE experimental pipeline ENST00000482079.1 alternative 5' UTR ENST00000394672.3 There is a deletion in the refrence genome that resullts in a missing S at 607 from this translation relative to the SwissProt entry. This sequence is therefore 948aa rather than the 949 in the SwissProt entry SW:A2RUB6.3 ENST00000497267.1 GENCODE experimental pipeline ENST00000473779.1 GENCODE experimental pipeline ENST00000463523.1 alternative 5' UTR ENST00000467210.1 alternative 5' UTR ENST00000473921.1 GENCODE experimental pipeline ENST00000473921.1 not organism-supported ENST00000495160.2 alternative 5' UTR ENST00000495803.1 not organism-supported ENST00000487349.1 non canonical TEC ENST00000462199.1 gene fragments RP11-229A12.3-003 and RP11-229A12.3-004 are part of the same gene; the exact exon structure linking the fragments is yet to be determined ENST00000495027.1 gene fragments RP11-229A12.3-003 and RP11-229A12.3-004 are part of the same gene; the exact exon structure linking the fragments is yet to be determined ENST00000495027.1 GENCODE experimental pipeline ENST00000496292.1 GENCODE experimental pipeline ENST00000463880.1 alternative 5' UTR ENST00000495354.1 GENCODE experimental pipeline ENST00000488156.1 alternative 5' UTR ENST00000470427.1 GENCODE experimental pipeline ENST00000295951.3 Extended at 5' end with rabbit cDNA, whihc gives an N-terminal extension of 121 amnio acids ENST00000461354.1 alternative 5' UTR ENST00000466255.1 alternative 5' UTR ENST00000490882.1 GENCODE experimental pipeline ENST00000486455.1 GENCODE experimental pipeline ENST00000483681.1 GENCODE experimental pipeline ENST00000477209.1 GENCODE experimental pipeline ENST00000461914.3 alternative 5' UTR ENST00000461914.3 not organism-supported ENST00000460422.1 alternative 5' UTR ENST00000295962.4 alternative 5' UTR ENST00000475982.1 not organism-supported ENST00000485900.1 alternative 5' UTR ENST00000445193.2 alternative 5' UTR ENST00000466547.1 alternative 5' UTR ENST00000479134.1 GENCODE experimental pipeline ENST00000404589.3 alternative 5' UTR ENST00000490264.1 alternative 5' UTR ENST00000479179.1 alternative 5' UTR ENST00000479470.1 GENCODE experimental pipeline ENST00000459701.2 GENCODE experimental pipeline ENST00000459701.2 not organism-supported ENST00000474098.1 alternative 5' UTR ENST00000394481.1 alternative 5' UTR ENST00000465970.1 alternative 5' UTR ENST00000497310.1 GENCODE experimental pipeline ENST00000498347.1 alternative 5' UTR ENST00000472469.1 GENCODE experimental pipeline ENST00000471288.1 This start is found in the Rat/Mouse Sw protein ENST00000478363.1 not organism-supported ENST00000462069.1 alternative 5' UTR ENST00000232519.5 alternative 5' UTR ENST00000465142.1 alternative 5' UTR ENST00000486811.1 alternative 5' UTR ENST00000475839.1 alternative 5' UTR ENST00000468271.1 GENCODE experimental pipeline ENST00000490353.2 confirm experimentally ENST00000479198.1 GENCODE experimental pipeline ENST00000496807.1 GENCODE experimental pipeline ENST00000430831.1 probably a unitary pseudogene, but the gene in mouse is very poor that I can't say with complete conviction ENST00000468961.2 GENCODE experimental pipeline ENST00000474513.2 alternative 5' UTR ENST00000487717.1 alternative 5' UTR ENST00000462717.1 GENCODE experimental pipeline ENST00000498162.1 alternative 5' UTR ENST00000476308.1 GENCODE experimental pipeline ENST00000484703.1 GENCODE experimental pipeline ENST00000481060.1 alternative 3' UTR ENST00000413054.1 GENCODE experimental pipeline ENST00000469661.1 GENCODE experimental pipeline ENST00000496687.1 alternative 5' UTR ENST00000495737.1 alternative 5' UTR ENST00000424374.1 alternative 5' UTR ENST00000456376.1 alternative 5' UTR ENST00000349511.4 NP_937838.1 ENST00000489031.1 alternative 5' UTR ENST00000475434.1 alternative 5' UTR ENST00000489817.1 alternative 5' UTR ENST00000473029.1 alternative 5' UTR ENST00000460709.1 alternative 5' UTR ENST00000459638.1 alternative 5' UTR ENST00000478490.1 not organism-supported ENST00000394348.1 GENCODE experimental pipeline ENST00000475937.1 alternative 5' UTR ENST00000498215.1 alternative 5' UTR ENST00000491567.1 GENCODE experimental pipeline ENST00000478745.1 GENCODE experimental pipeline ENST00000494559.1 GENCODE experimental pipeline ENST00000462146.2 alternative 5' UTR ENST00000479530.1 GENCODE experimental pipeline ENST00000308062.3 not best-in-genome evidence ENST00000308062.3 NAGNAG splice site ENST00000464571.1 not best-in-genome evidence ENST00000464571.1 NAGNAG splice site ENST00000471541.2 alternative 5' UTR ENST00000332191.8 GENCODE experimental pipeline ENST00000471893.1 GENCODE experimental pipeline ENST00000490534.1 GENCODE experimental pipeline ENST00000461186.1 GENCODE experimental pipeline ENST00000496674.1 GENCODE experimental pipeline ENST00000472273.1 GENCODE experimental pipeline ENST00000495273.1 NP_001139316 ENST00000467549.1 NP_001139317 ENST00000478239.1 GENCODE experimental pipeline ENST00000497946.1 GENCODE experimental pipeline ENST00000467225.1 GENCODE experimental pipeline ENST00000471660.1 GENCODE experimental pipeline ENST00000494980.1 GENCODE experimental pipeline ENST00000344265.3 NP_001116229.1 ENST00000561167.1 not organism-supported ENST00000560656.1 not organism-supported ENST00000398392.2 alternative 5' UTR ENST00000482016.1 alternative 5' UTR ENST00000462901.1 alternative 5' UTR ENST00000467332.1 alternative 5' UTR ENST00000473136.1 GENCODE experimental pipeline ENST00000486971.1 GENCODE experimental pipeline ENST00000348974.4 GENCODE experimental pipeline ENST00000394222.3 alternative 3' UTR ENST00000492165.1 non-organism_supported ENST00000314636.2 alternative 5' UTR ENST00000496983.1 alternative 5' UTR ENST00000514100.1 GENCODE experimental pipeline ENST00000462412.1 alternative 5' UTR ENST00000476753.1 GENCODE experimental pipeline ENST00000333396.6 alternative 5' UTR ENST00000506099.1 alternative 5' UTR ENST00000429239.1 unitary_pseudogene ENST00000394191.2 unitary_pseudogene ENST00000502288.1 GENCODE experimental pipeline ENST00000507874.1 GENCODE experimental pipeline ENST00000394180.2 alternative 5' UTR ENST00000506885.1 GENCODE experimental pipeline ENST00000503004.1 alternative 5' UTR ENST00000394185.2 alternative 5' UTR ENST00000394181.2 alternative 5' UTR ENST00000510545.1 alternative 5' UTR ENST00000513287.1 alternative 5' UTR ENST00000513452.1 alternative 5' UTR ENST00000502299.1 alternative 5' UTR ENST00000508902.1 alternative 5' UTR ENST00000514537.1 alternative 5' UTR ENST00000515620.1 alternative 5' UTR ENST00000507944.1 alternative 5' UTR ENST00000508659.1 alternative 5' UTR ENST00000508071.1 alternative 5' UTR ENST00000513130.2 non-canonical splice acceptor site between exons 1 and 2 ENST00000513130.2 alternative 5' UTR ENST00000506575.1 alternative 5' UTR ENST00000512905.1 not organism-supported ENST00000486334.2 alternative 5' UTR ENST00000485391.1 alternative 5' UTR ENST00000485145.1 GENCODE experimental pipeline ENST00000449482.1 GENCODE experimental pipeline ENST00000261037.3 NP_001841 ENST00000452013.1 alternative 5' UTR ENST00000478909.1 GENCODE experimental pipeline ENST00000477258.1 GENCODE experimental pipeline ENST00000485687.1 GENCODE experimental pipeline ENST00000475134.1 GENCODE experimental pipeline ENST00000403410.1 GENCODE experimental pipeline ENST00000475887.1 GENCODE experimental pipeline ENST00000490574.1 alternative 5' UTR ENST00000479672.1 alternative 5' UTR ENST00000463568.1 alternative 5' UTR ENST00000487505.1 alternative 5' UTR ENST00000471714.1 confirm experimentally ENST00000528305.1 not organism-supported ENST00000494050.1 GENCODE experimental pipeline ENST00000478083.1 not organism-supported ENST00000447441.1 alternative 5' UTR ENST00000443752.1 alternative 5' UTR ENST00000479612.1 GENCODE experimental pipeline ENST00000402543.1 GENCODE experimental pipeline ENST00000416476.2 GENCODE experimental pipeline ENST00000431630.1 GENCODE experimental pipeline ENST00000458347.1 GENCODE experimental pipeline ENST00000471694.1 CD47 antigen ENST00000355354.7 1st exon found using dotter ENST00000355354.7 CD47 antigen ENST00000355354.7 NP_942088.1 ENST00000398258.3 CD47 antigen ENST00000361309.5 1st exon found using dotter ENST00000361309.5 CD47 antigen ENST00000467282.1 GENCODE experimental pipeline ENST00000463019.3 alternative 5' UTR ENST00000482430.1 alternative 5' UTR ENST00000462629.1 alternative 5' UTR ENST00000467761.1 alternative 5' UTR ENST00000489514.2 alternative 5' UTR ENST00000479138.1 alternative 5' UTR ENST00000497905.1 alternative 5' UTR ENST00000484927.1 GENCODE experimental pipeline ENST00000478830.1 GENCODE experimental pipeline ENST00000477303.1 GENCODE experimental pipeline ENST00000486596.1 GENCODE experimental pipeline ENST00000486596.1 not organism-supported ENST00000493615.1 GENCODE experimental pipeline ENST00000478327.1 GENCODE experimental pipeline ENST00000493131.1 GENCODE experimental pipeline ENST00000498699.1 alternative 5' UTR ENST00000393925.3 alternative 5' UTR ENST00000470699.2 not organism-supported ENST00000478951.1 alternative 5' UTR ENST00000455401.2 alternative 5' UTR ENST00000494932.1 not organism-supported ENST00000486460.1 not organism-supported ENST00000469385.1 GENCODE experimental pipeline ENST00000452346.2 NAGNAG splice site ENST00000452346.2 not organism-supported ENST00000435737.1 NAGNAG splice site ENST00000419127.1 NAGNAG splice site ENST00000460599.1 NAGNAG splice site ENST00000484193.1 GENCODE experimental pipeline ENST00000488580.1 GENCODE experimental pipeline ENST00000487901.1 GENCODE experimental pipeline ENST00000486726.2 not organism-supported ENST00000484995.1 alternative 5' UTR ENST00000468642.1 alternative 5' UTR ENST00000439685.2 alternative 5' UTR ENST00000475181.1 GENCODE experimental pipeline ENST00000475181.1 alternative 5' UTR ENST00000488794.1 alternative 5' UTR ENST00000473129.1 GENCODE experimental pipeline ENST00000472166.1 GENCODE experimental pipeline ENST00000473008.1 GENCODE experimental pipeline ENST00000488854.2 not organism-supported ENST00000467618.1 GENCODE experimental pipeline ENST00000491165.1 GENCODE experimental pipeline ENST00000477813.1 not organism-supported ENST00000497255.1 GENCODE experimental pipeline ENST00000493454.1 alternative 5' UTR ENST00000467022.1 GENCODE experimental pipeline ENST00000475322.1 alternative 5' UTR ENST00000463760.1 not organism-supported ENST00000484714.2 not organism-supported ENST00000472026.1 GENCODE experimental pipeline ENST00000462838.1 alternative 5' UTR ENST00000491556.1 alternative 5' UTR ENST00000488129.1 GENCODE experimental pipeline ENST00000480588.1 not organism-supported ENST00000482307.1 not organism-supported ENST00000467632.1 alternative 5' UTR ENST00000295881.6 NP_387512.3 ENST00000295881.6 non-canonical splice donor site between exons 6 and 7 ENST00000461158.1 alternative 5' UTR ENST00000462705.1 alternative 5' UTR ENST00000481632.1 alternative 5' UTR ENST00000464560.1 alternative 5' UTR ENST00000470311.1 alternative 5' UTR ENST00000482689.1 alternative 5' UTR ENST00000468769.1 GENCODE experimental pipeline ENST00000487814.1 GENCODE experimental pipeline ENST00000465249.1 GENCODE experimental pipeline ENST00000498630.1 GENCODE experimental pipeline ENST00000482766.1 GENCODE experimental pipeline ENST00000483401.1 GENCODE experimental pipeline ENST00000494105.1 not organism-supported ENST00000460150.1 GENCODE experimental pipeline ENST00000460150.1 not organism-supported ENST00000473121.1 GENCODE experimental pipeline ENST00000492792.1 GENCODE experimental pipeline ENST00000497685.1 GENCODE experimental pipeline ENST00000479520.1 alternative 5' UTR ENST00000494855.1 alternative 5' UTR ENST00000359213.3 alternative 5' UTR ENST00000393765.2 alternative 5' UTR ENST00000475803.1 alternative 5' UTR ENST00000479150.1 alternative 5' UTR ENST00000470111.1 alternative 5' UTR ENST00000493932.1 alternative 5' UTR ENST00000473887.1 alternative 5' UTR ENST00000459778.1 alternative 5' UTR ENST00000459820.1 alternative 5' UTR ENST00000479308.1 GENCODE experimental pipeline ENST00000473684.1 non canonical conserved ENST00000473684.1 not organism-supported ENST00000491685.1 GENCODE experimental pipeline ENST00000493694.1 GENCODE experimental pipeline ENST00000494440.1 GENCODE experimental pipeline ENST00000475963.1 GENCODE experimental pipeline ENST00000493094.1 GENCODE experimental pipeline ENST00000484810.1 GENCODE experimental pipeline ENST00000273390.5 NP_203528.2 ENST00000494869.1 GENCODE experimental pipeline ENST00000469005.1 alternative 5' UTR ENST00000475447.2 GENCODE experimental pipeline ENST00000494453.1 GENCODE experimental pipeline ENST00000476082.2 GENCODE experimental pipeline ENST00000476082.2 < ENST00000476082.2 not organism-supported ENST00000473654.1 not organism-supported ENST00000485161.1 not organism-supported ENST00000481015.1 not organism-supported ENST00000465022.1 not organism-supported ENST00000484715.1 alternative 5' UTR ENST00000469772.1 not organism-supported ENST00000492959.1 alternative 5' UTR ENST00000495504.1 alternative 5' UTR ENST00000472475.1 alternative 5' UTR ENST00000462442.1 alternative 5' UTR ENST00000497726.1 not organism-supported ENST00000232125.5 GENCODE experimental pipeline ENST00000465882.1 alternative 5' UTR ENST00000482287.1 alternative 5' UTR ENST00000493510.1 alternative 5' UTR ENST00000466126.1 GENCODE experimental pipeline ENST00000474629.2 NP_060024.2 ENST00000421053.1 alternative 5' UTR ENST00000449546.1 alternative 5' UTR ENST00000484644.1 GENCODE experimental pipeline ENST00000473494.2 alternative 5' UTR ENST00000491366.1 non canonical conserved ENST00000487572.1 non canonical conserved ENST00000491190.1 GENCODE experimental pipeline ENST00000485727.1 alternative 5' UTR ENST00000433542.2 NP_073594.4 ENST00000419247.1 GENCODE experimental pipeline ENST00000495336.2 alternative 5' UTR ENST00000291478.4 NP_008995.2 ENST00000462213.1 GENCODE experimental pipeline ENST00000481591.1 GENCODE experimental pipeline ENST00000495917.1 GENCODE experimental pipeline ENST00000311075.3 1missing aa compared to SwissProt due to genomic sequencing error (3bp deletion) in exon 2 ENST00000480667.1 GENCODE experimental pipeline ENST00000477536.1 GENCODE experimental pipeline ENST00000469902.1 alternative 5' UTR ENST00000462437.1 GENCODE experimental pipeline ENST00000481760.2 GENCODE experimental pipeline ENST00000492394.1 alternative 5' UTR ENST00000485866.1 alternative 5' UTR ENST00000496732.1 GENCODE experimental pipeline ENST00000465763.1 alternative 5' UTR ENST00000495019.1 alternative 5' UTR ENST00000471196.1 alternative 5' UTR ENST00000465505.2 not organism-supported ENST00000514116.1 alternative 5' UTR ENST00000513830.1 alternative 5' UTR ENST00000508088.1 alternative 5' UTR ENST00000509879.1 alternative 5' UTR ENST00000505382.1 alternative 5' UTR ENST00000360370.4 NP_060306.3 ENST00000514677.1 GENCODE experimental pipeline ENST00000513723.1 GENCODE experimental pipeline ENST00000512470.1 alternative 5' UTR ENST00000514333.1 alternative 5' UTR ENST00000507280.1 alternative 5' UTR ENST00000514891.1 alternative 5' UTR ENST00000504035.1 alternative 5' UTR ENST00000509064.1 alternative 5' UTR ENST00000509452.1 alternative 5' UTR ENST00000507924.1 GENCODE experimental pipeline ENST00000273450.3 GENCODE experimental pipeline ENST00000472186.1 alternative 5' UTR ENST00000490367.1 alternative 5' UTR ENST00000460368.1 alternative 5' UTR ENST00000488356.1 alternative 5' UTR ENST00000509952.1 alternative 5' UTR ENST00000502278.1 GENCODE experimental pipeline ENST00000511512.1 GENCODE experimental pipeline ENST00000509675.1 GENCODE experimental pipeline ENST00000511287.1 GENCODE experimental pipeline ENST00000523403.1 A transcriptional start site could be found but the translational start site could not be accurately found as there was no evidence ENST00000450633.2 alternative 5' UTR ENST00000489960.1 alternative 5' UTR ENST00000490290.1 alternative 5' UTR ENST00000469111.1 alternative 5' UTR ENST00000490643.1 alternative 5' UTR ENST00000462228.1 alternative 5' UTR ENST00000491422.1 GENCODE experimental pipeline ENST00000468137.1 alternative 5' UTR ENST00000491633.1 non canonical TEC ENST00000398101.3 GENCODE experimental pipeline ENST00000494830.1 alternative 5' UTR ENST00000407609.3 GENCODE experimental pipeline ENST00000343941.4 GENCODE experimental pipeline ENST00000464451.1 GENCODE experimental pipeline ENST00000481210.1 GENCODE experimental pipeline ENST00000464873.1 GENCODE experimental pipeline ENST00000478892.1 GENCODE experimental pipeline ENST00000469083.1 alternative 5' UTR ENST00000487848.1 alternative 5' UTR ENST00000492608.1 alternative 5' UTR ENST00000498200.1 alternative 5' UTR ENST00000482525.1 GENCODE experimental pipeline ENST00000464496.1 alternative 5' UTR ENST00000490093.1 GENCODE experimental pipeline ENST00000483906.1 GENCODE experimental pipeline ENST00000485280.1 GENCODE experimental pipeline ENST00000511526.1 non canonical TEC ENST00000515659.1 GENCODE experimental pipeline ENST00000393304.1 alternative 5' UTR ENST00000393308.1 alternative 5' UTR ENST00000393307.1 alternative 5' UTR ENST00000393305.1 alternative 5' UTR ENST00000457077.1 alternative 5' UTR ENST00000393292.3 GENCODE experimental pipeline ENST00000451728.2 non canonical TEC ENST00000446936.2 non canonical TEC ENST00000441626.2 non canonical TEC ENST00000314797.6 CCDS33851.1 ENST00000509042.1 GENCODE experimental pipeline ENST00000383463.3 CCDS33852.1 ENST00000502878.1 alternative 5' UTR ENST00000389735.3 alternative 5' UTR ENST00000249910.1 CCDS3058.1 ENST00000347300.2 NM_018262.2 ENST00000296266.3 NM_052985.1 ENST00000349441.2 NM_052990.1 ENST00000511498.1 alternative 5' UTR ENST00000511425.1 or is this novel beacuse its quite close to a splice site at the begining ENST00000503977.1 GENCODE experimental pipeline ENST00000504689.1 GENCODE experimental pipeline ENST00000513411.1 alternative 5' UTR ENST00000503256.1 GENCODE experimental pipeline ENST00000509440.1 GENCODE experimental pipeline ENST00000507066.1 not organism-supported ENST00000507856.1 GENCODE experimental pipeline ENST00000504808.1 GENCODE experimental pipeline ENST00000512836.1 GENCODE experimental pipeline ENST00000373157.4 Supporting allele has a single nucleotide deltion in the second to last exon ENST00000507330.1 alternative 5' UTR ENST00000512430.1 alternative 5' UTR ENST00000505330.1 alternative 5' UTR ENST00000507488.2 alternative 5' UTR ENST00000510168.1 alternative 5' UTR ENST00000505072.1 alternative 5' UTR ENST00000509662.1 alternative 5' UTR ENST00000428331.2 alternative 5' UTR ENST00000422190.2 alternative 5' UTR ENST00000508297.1 alternative 5' UTR ENST00000509150.1 GENCODE experimental pipeline ENST00000514044.1 GENCODE experimental pipeline ENST00000505545.1 alternative 5' UTR ENST00000504725.1 alternative 5' UTR ENST00000509060.1 alternative 5' UTR ENST00000513550.1 GENCODE experimental pipeline ENST00000507967.1 GENCODE experimental pipeline ENST00000508196.1 CCDS3069.1 ENST00000511339.1 GENCODE experimental pipeline ENST00000521288.1 NP_689608.2 ENST00000425847.2 GENCODE experimental pipeline ENST00000510154.1 GENCODE experimental pipeline ENST00000510154.1 alternative 5' UTR ENST00000505219.1 AJ609450.1 ENST00000511604.1 alternative 5' UTR ENST00000502818.1 alternative 5' UTR ENST00000505881.1 alternative 5' UTR ENST00000514999.1 alternative 5' UTR ENST00000505957.1 GENCODE experimental pipeline ENST00000505957.1 alternative 5' UTR ENST00000495911.1 GENCODE experimental pipeline ENST00000475741.1 GENCODE experimental pipeline ENST00000471702.1 Isoform 3 ENST00000512094.1 GENCODE experimental pipeline ENST00000464068.1 GENCODE experimental pipeline ENST00000505557.1 GENCODE experimental pipeline ENST00000393130.3 alternative 5' UTR ENST00000514894.1 GENCODE experimental pipeline ENST00000514894.1 alternative 5' UTR ENST00000512137.1 alternative 5' UTR ENST00000511555.1 alternative 5' UTR ENST00000510183.1 alternative 5' UTR ENST00000508481.1 alternative 5' UTR ENST00000420115.2 NP_001127895.1 ENST00000504867.1 GENCODE experimental pipeline ENST00000504867.1 alternative 5' UTR ENST00000507408.1 alternative 5' UTR ENST00000511392.1 alternative 5' UTR ENST00000515421.1 GENCODE experimental pipeline ENST00000515421.1 alternative 5' UTR ENST00000508524.1 GENCODE experimental pipeline ENST00000484684.1 alternative 5' UTR ENST00000460865.3 not organism-supported ENST00000488969.1 alternative 5' UTR ENST00000493729.1 GENCODE experimental pipeline ENST00000481359.3 not organism-supported ENST00000483245.1 GENCODE experimental pipeline ENST00000484106.1 GENCODE experimental pipeline ENST00000514516.1 GENCODE experimental pipeline ENST00000510560.1 alternative 5' UTR ENST00000504234.1 alternative 5' UTR ENST00000505596.1 alternative 5' UTR ENST00000506107.1 alternative 5' UTR ENST00000515172.1 alternative 5' UTR ENST00000502491.1 alternative 5' UTR ENST00000354910.5 alternative 5' UTR ENST00000514612.1 alternative 5' UTR ENST00000511751.1 alternative 5' UTR ENST00000511574.1 alternative 5' UTR ENST00000512894.1 alternative 5' UTR ENST00000467013.1 GENCODE experimental pipeline ENST00000472904.1 GENCODE experimental pipeline ENST00000488154.1 NMD candidate ENST00000497173.1 alternative 5' UTR ENST00000473867.1 alternative 5' UTR ENST00000474732.1 alternative 5' UTR ENST00000423778.2 not organism-supported ENST00000490504.1 GENCODE experimental pipeline ENST00000483687.1 GENCODE experimental pipeline ENST00000471595.1 GENCODE experimental pipeline ENST00000474833.1 Subject to NMD if additional splicing supported ENST00000494742.1 GENCODE experimental pipeline ENST00000480733.1 possible retained intron ENST00000393079.3 alternative 5' UTR ENST00000481752.1 alternative 5' UTR ENST00000491539.1 alternative 5' UTR ENST00000485096.1 alternative 5' UTR ENST00000476286.1 alternative 5' UTR ENST00000488930.1 GENCODE experimental pipeline ENST00000469404.1 GENCODE experimental pipeline ENST00000462176.2 GENCODE experimental pipeline ENST00000469243.1 alternative 5' UTR ENST00000467030.1 alternative 5' UTR ENST00000492010.1 alternative 5' UTR ENST00000477557.3 not organism-supported ENST00000461600.1 alternative 5' UTR ENST00000461600.1 not organism-supported ENST00000466749.1 alternative 5' UTR ENST00000358441.2 alternative 5' UTR ENST00000468560.1 alternative 5' UTR ENST00000469860.2 GENCODE experimental pipeline ENST00000464181.2 not organism-supported ENST00000475751.1 alternative 5' UTR ENST00000460099.1 alternative 5' UTR ENST00000423968.2 alternative 5' UTR ENST00000494949.1 alternative 5' UTR ENST00000475711.1 alternative 5' UTR ENST00000461114.1 GENCODE experimental pipeline ENST00000474559.1 alternative 5' UTR ENST00000484888.1 alternative 5' UTR ENST00000470159.1 alternative 5' UTR ENST00000485115.1 alternative 5' UTR ENST00000338446.4 NP_001028202.1 ENST00000360570.3 NP_001028203.1 ENST00000393035.2 alternative 5' UTR ENST00000464668.1 alternative 5' UTR ENST00000464668.1 not organism-supported ENST00000479848.1 alternative 5' UTR ENST00000479848.1 not organism-supported ENST00000462898.1 not organism-supported ENST00000462294.1 GENCODE experimental pipeline ENST00000462294.1 not organism-supported ENST00000483968.1 alternative 5' UTR ENST00000461451.1 alternative 5' UTR ENST00000465581.1 alternative 5' UTR ENST00000495225.1 GENCODE experimental pipeline ENST00000465373.1 GENCODE experimental pipeline ENST00000329447.5 FLJ46116 ENST00000329447.5 CCDS33868.1 ENST00000413199.1 FLJ46210 ENST00000503326.1 GENCODE experimental pipeline ENST00000512309.1 not organism-supported ENST00000512153.1 GENCODE experimental pipeline ENST00000512153.1 alternative 5' UTR ENST00000513274.1 alternative 5' UTR ENST00000512242.1 alternative 5' UTR ENST00000514508.1 alternative 5' UTR ENST00000511956.1 alternative 5' UTR ENST00000506825.1 alternative 5' UTR ENST00000232219.2 NP_002890.2 ENST00000492918.1 NP_001124464 ENST00000509291.1 alternative 5' UTR ENST00000514703.1 GENCODE experimental pipeline ENST00000505779.1 GENCODE experimental pipeline ENST00000483759.2 GENCODE experimental pipeline ENST00000513887.1 GENCODE experimental pipeline ENST00000508828.1 GENCODE experimental pipeline ENST00000507895.1 GENCODE experimental pipeline ENST00000512277.1 GENCODE experimental pipeline ENST00000505013.1 alternative 5' UTR ENST00000393010.2 alternative 5' UTR ENST00000514680.1 alternative 5' UTR ENST00000512457.1 alternative 5' UTR ENST00000504264.1 GENCODE experimental pipeline ENST00000508812.1 GENCODE experimental pipeline ENST00000514263.2 GENCODE experimental pipeline ENST00000509842.1 alternative 5' UTR ENST00000507722.1 alternative 5' UTR ENST00000503809.1 alternative 5' UTR ENST00000513258.1 alternative 5' UTR ENST00000509883.1 alternative 5' UTR ENST00000510338.1 alternative 5' UTR ENST00000504673.1 alternative 5' UTR ENST00000513570.1 alternative 5' UTR ENST00000441582.2 alternative 5' UTR ENST00000510726.1 alternative 5' UTR ENST00000509813.1 alternative 5' UTR ENST00000512769.1 GENCODE experimental pipeline ENST00000393000.3 NP_899060.1 ENST00000492725.1 GENCODE experimental pipeline ENST00000486111.1 alternative 5' UTR ENST00000467667.1 alternative 5' UTR ENST00000497579.1 alternative 5' UTR ENST00000488107.2 alternative 5' UTR ENST00000475734.1 alternative 5' UTR ENST00000494358.1 alternative 5' UTR ENST00000467634.1 alternative 5' UTR ENST00000483373.1 alternative 5' UTR ENST00000475296.1 alternative 5' UTR ENST00000495744.1 alternative 5' UTR ENST00000461644.1 alternative 5' UTR ENST00000464320.1 alternative 5' UTR ENST00000337777.3 alternative 5' UTR ENST00000497199.1 alternative 5' UTR ENST00000497002.1 alternative 5' UTR ENST00000485338.1 GENCODE experimental pipeline ENST00000470310.1 alternative 3' UTR ENST00000485766.1 GENCODE experimental pipeline ENST00000493782.1 alternative 5' UTR ENST00000467348.1 GENCODE experimental pipeline ENST00000483262.1 GENCODE experimental pipeline ENST00000491347.1 GENCODE experimental pipeline ENST00000492452.2 GENCODE experimental pipeline ENST00000441925.2 GENCODE experimental pipeline ENST00000482351.1 GENCODE experimental pipeline ENST00000446574.2 alternative 5' UTR ENST00000493382.1 alternative 5' UTR ENST00000460350.1 alternative 5' UTR ENST00000476202.1 alternative 5' UTR ENST00000481701.1 alternative 5' UTR ENST00000498625.1 alternative 5' UTR ENST00000497985.1 GENCODE experimental pipeline ENST00000489015.1 alternative 5' UTR ENST00000484560.1 GENCODE experimental pipeline ENST00000486631.1 alternative 5' UTR ENST00000472349.1 alternative 5' UTR ENST00000477974.1 GENCODE experimental pipeline ENST00000443512.1 alternative 3' UTR ENST00000473817.1 GENCODE experimental pipeline ENST00000484399.1 alternative 5' UTR ENST00000473123.1 alternative 5' UTR ENST00000491672.1 GENCODE experimental pipeline ENST00000462748.2 alternative 5' UTR ENST00000484586.1 alternative 5' UTR ENST00000463250.1 alternative 5' UTR ENST00000462168.1 GENCODE experimental pipeline ENST00000474034.1 GENCODE experimental pipeline ENST00000481840.1 GENCODE experimental pipeline ENST00000469812.1 GENCODE experimental pipeline ENST00000497524.1 alternative 5' UTR ENST00000404754.2 alternative 5' UTR ENST00000475347.1 alternative 5' UTR ENST00000474935.1 alternative 5' UTR ENST00000461609.1 alternative 5' UTR ENST00000494888.1 alternative 5' UTR ENST00000462345.1 alternative 5' UTR ENST00000498639.1 GENCODE experimental pipeline ENST00000461191.1 GENCODE experimental pipeline ENST00000473005.1 alternative 5' UTR ENST00000479119.1 GENCODE experimental pipeline ENST00000310053.5 alternative 3' UTR ENST00000392912.2 alternative 3' UTR ENST00000479771.1 GENCODE experimental pipeline ENST00000455472.3 GENCODE experimental pipeline ENST00000470080.1 alternative 5' UTR ENST00000474754.1 alternative 5' UTR ENST00000496491.1 GENCODE experimental pipeline ENST00000484046.1 GENCODE experimental pipeline ENST00000465758.1 GENCODE experimental pipeline ENST00000360632.3 alternative 5' UTR ENST00000467467.1 alternative 5' UTR ENST00000472417.1 GENCODE experimental pipeline ENST00000479238.1 alternative 5' UTR ENST00000485352.1 alternative 5' UTR ENST00000475579.1 alternative 5' UTR ENST00000460517.1 alternative 5' UTR ENST00000484019.1 GENCODE experimental pipeline ENST00000474224.1 GENCODE experimental pipeline ENST00000462561.1 GENCODE experimental pipeline ENST00000497728.1 GENCODE experimental pipeline ENST00000473672.1 GENCODE experimental pipeline ENST00000344229.3 alternative 5' UTR ENST00000470151.1 alternative 5' UTR ENST00000466478.1 alternative 5' UTR ENST00000491086.1 alternative 5' UTR ENST00000467977.1 alternative 5' UTR ENST00000468648.1 alternative 5' UTR ENST00000459632.1 alternative 5' UTR ENST00000466795.1 alternative 5' UTR ENST00000482539.2 alternative 5' UTR ENST00000482083.3 alternative 5' UTR ENST00000423691.2 GENCODE experimental pipeline ENST00000494827.1 alternative 5' UTR ENST00000490975.1 GENCODE experimental pipeline ENST00000497148.1 alternative 5' UTR ENST00000475518.1 alternative 5' UTR ENST00000481275.1 alternative 5' UTR ENST00000498307.1 alternative 5' UTR ENST00000472821.1 GENCODE experimental pipeline ENST00000489690.1 GENCODE experimental pipeline ENST00000487153.1 GENCODE experimental pipeline ENST00000491195.1 GENCODE experimental pipeline ENST00000484608.2 GENCODE experimental pipeline ENST00000487799.1 GENCODE experimental pipeline ENST00000465535.1 GENCODE experimental pipeline ENST00000480740.1 GENCODE experimental pipeline ENST00000477889.1 GENCODE experimental pipeline ENST00000477889.1 alternative 5' UTR ENST00000485923.1 GENCODE experimental pipeline ENST00000485923.1 alternative 5' UTR ENST00000482706.1 GENCODE experimental pipeline ENST00000474598.1 GENCODE experimental pipeline ENST00000468836.1 alternative 5' UTR ENST00000488092.1 GENCODE experimental pipeline ENST00000480322.1 alternative 5' UTR ENST00000424796.2 alternative 5' UTR ENST00000494668.1 alternative 5' UTR ENST00000497472.1 GENCODE experimental pipeline ENST00000492731.1 GENCODE experimental pipeline ENST00000471766.1 GENCODE experimental pipeline ENST00000463420.1 GENCODE experimental pipeline ENST00000461436.1 GENCODE experimental pipeline ENST00000324210.5 NP_066368.2 ENST00000460591.1 alternative 5' UTR ENST00000498502.1 non-organism_supported ENST00000492948.1 NP_997180.1 ENST00000485509.1 NP_997179.1 ENST00000464596.1 non-organism_supported ENST00000496084.1 GENCODE experimental pipeline ENST00000487827.1 GENCODE experimental pipeline ENST00000498457.1 GENCODE experimental pipeline ENST00000462300.1 GENCODE experimental pipeline ENST00000462835.1 GENCODE experimental pipeline ENST00000465093.1 alternative 5' UTR ENST00000481941.1 GENCODE experimental pipeline ENST00000469977.1 GENCODE experimental pipeline ENST00000492661.1 alternative 5' UTR ENST00000481828.1 alternative 5' UTR ENST00000462745.1 non-organism_supported ENST00000462745.1 alternative 5' UTR ENST00000493237.1 alternative 5' UTR ENST00000360490.2 alternative 5' UTR ENST00000491026.1 alternative 5' UTR ENST00000473730.1 alternative 5' UTR ENST00000497890.1 alternative 5' UTR ENST00000462837.1 alternative 5' UTR ENST00000477669.1 GENCODE experimental pipeline ENST00000484721.1 GENCODE experimental pipeline ENST00000489090.1 GENCODE experimental pipeline ENST00000475196.1 GENCODE experimental pipeline ENST00000472913.1 GENCODE experimental pipeline ENST00000465810.1 not organism-supported ENST00000392845.2 alternative 3' UTR ENST00000475842.1 GENCODE experimental pipeline ENST00000496772.1 GENCODE experimental pipeline ENST00000460729.1 GENCODE experimental pipeline ENST00000467789.1 GENCODE experimental pipeline ENST00000476217.1 GENCODE experimental pipeline ENST00000496050.1 GENCODE experimental pipeline ENST00000496050.1 alternative 5' UTR ENST00000463449.1 GENCODE experimental pipeline ENST00000486483.1 alternative 5' UTR ENST00000486483.1 not organism-supported ENST00000461166.1 alternative 5' UTR ENST00000473702.1 alternative 5' UTR ENST00000481853.1 alternative 5' UTR ENST00000469196.1 GENCODE experimental pipeline ENST00000474477.1 GENCODE experimental pipeline ENST00000471719.1 GENCODE experimental pipeline ENST00000480817.1 GENCODE experimental pipeline ENST00000392832.2 alternative 5' UTR ENST00000494677.1 alternative 5' UTR ENST00000490235.1 GENCODE experimental pipeline ENST00000487753.1 alternative 5' UTR ENST00000461299.1 alternative 5' UTR ENST00000489602.1 alternative 5' UTR ENST00000468043.1 GENCODE experimental pipeline ENST00000459838.1 GENCODE experimental pipeline ENST00000491909.1 GENCODE experimental pipeline ENST00000480820.1 alternative 5' UTR ENST00000480820.1 not organism-supported ENST00000494002.1 alternative 5' UTR ENST00000471994.1 alternative 5' UTR ENST00000464171.1 non-organsim_supported ENST00000312179.6 alternative 5' UTR ENST00000475278.2 not organism-supported ENST00000476899.1 alternative 5' UTR ENST00000484955.1 alternative 5' UTR ENST00000482628.1 alternative 5' UTR ENST00000482628.1 not organism-supported ENST00000478894.2 GENCODE experimental pipeline ENST00000478894.2 alternative 5' UTR ENST00000464732.1 GENCODE experimental pipeline ENST00000462663.1 GENCODE experimental pipeline ENST00000477743.1 GENCODE experimental pipeline ENST00000496842.1 GENCODE experimental pipeline ENST00000471575.1 GENCODE experimental pipeline ENST00000467377.1 alternative 5' UTR ENST00000460298.1 GENCODE experimental pipeline ENST00000472451.1 alternative 5' UTR ENST00000460574.1 GENCODE experimental pipeline ENST00000483730.1 GENCODE experimental pipeline ENST00000473137.1 GENCODE experimental pipeline ENST00000483754.1 subject to nonsense-mediated decay ENST00000483465.1 alternative 5' UTR ENST00000483325.1 GENCODE experimental pipeline ENST00000465537.1 alternative 5' UTR ENST00000475677.1 alternative 5' UTR ENST00000498409.1 alternative 5' UTR ENST00000468218.1 alternative 5' UTR ENST00000486856.1 alternative 5' UTR ENST00000478370.1 alternative 5' UTR ENST00000489004.1 alternative 5' UTR ENST00000478536.1 alternative 5' UTR ENST00000465903.1 alternative 5' UTR ENST00000485645.1 alternative 5' UTR ENST00000489573.1 alternative 5' UTR ENST00000490207.1 alternative 5' UTR ENST00000485867.1 GENCODE experimental pipeline ENST00000344722.5 alternative 5' UTR ENST00000479460.1 alternative 5' UTR ENST00000471396.1 alternative 5' UTR ENST00000471155.1 alternative 5' UTR ENST00000494486.1 alternative 5' UTR ENST00000469804.1 GENCODE experimental pipeline ENST00000320474.4 alternative 5' UTR ENST00000392781.2 alternative 5' UTR ENST00000473285.1 not organism-supported ENST00000473285.1 alternative 5' UTR ENST00000488170.1 alternative 5' UTR ENST00000468268.1 alternative 5' UTR ENST00000492353.1 alternative 5' UTR ENST00000473142.1 alternative 5' UTR ENST00000498216.1 alternative 5' UTR ENST00000484127.1 alternative 5' UTR ENST00000494173.1 alternative 5' UTR ENST00000468606.1 alternative 5' UTR ENST00000460503.1 alternative 5' UTR ENST00000493066.1 alternative 5' UTR ENST00000463518.1 alternative 5' UTR ENST00000476237.1 alternative 5' UTR ENST00000460469.1 alternative 5' UTR ENST00000497137.1 alternative 5' UTR ENST00000497285.1 GENCODE experimental pipeline ENST00000463978.1 GENCODE experimental pipeline ENST00000497379.2 GENCODE experimental pipeline ENST00000475390.1 alternative 5' UTR ENST00000497724.1 alternative 5' UTR ENST00000488954.1 GENCODE experimental pipeline ENST00000474464.1 alternative 5' UTR ENST00000485651.1 GENCODE experimental pipeline ENST00000476257.1 alternative 5' UTR ENST00000471111.1 alternative 5' UTR ENST00000466903.1 alternative 5' UTR ENST00000467583.1 GENCODE experimental pipeline ENST00000493061.1 GENCODE experimental pipeline ENST00000473645.2 alternative 5' UTR ENST00000461494.1 alternative 5' UTR ENST00000470131.1 alternative 5' UTR ENST00000475915.2 alternative 5' UTR ENST00000462725.2 alternative 5' UTR ENST00000492139.1 alternative 5' UTR ENST00000464360.1 alternative 5' UTR ENST00000472941.1 alternative 5' UTR ENST00000446050.2 alternative 5' UTR ENST00000472747.2 alternative 5' UTR ENST00000493529.1 GENCODE experimental pipeline ENST00000431685.2 C3orf50 ENST00000472280.1 GENCODE experimental pipeline ENST00000472280.1 alternative 5' UTR ENST00000492586.1 GENCODE experimental pipeline ENST00000460890.1 alternative 5' UTR ENST00000487503.1 alternative 5' UTR ENST00000494597.1 alternative 5' UTR ENST00000475754.1 alternative 5' UTR ENST00000481315.1 alternative 5' UTR ENST00000466623.1 alternative 5' UTR ENST00000469794.1 GENCODE experimental pipeline ENST00000335556.3 alternative 5' UTR ENST00000487580.1 GENCODE experimental pipeline ENST00000483289.1 DKFZp313A137 ENST00000483289.1 FLJ41016 ENST00000483289.1 LOC100128164 ENST00000461933.1 GENCODE experimental pipeline ENST00000480708.1 alternative 3' UTR ENST00000492492.1 alternative 5' UTR ENST00000482813.1 GENCODE experimental pipeline ENST00000491740.1 GENCODE experimental pipeline ENST00000476668.1 GENCODE experimental pipeline ENST00000482710.1 alternative 5' UTR ENST00000473675.1 alternative 5' UTR ENST00000484068.1 alternative 3' UTR ENST00000495893.1 alternative 5' UTR ENST00000475729.1 alternative 5' UTR ENST00000476188.1 alternative 5' UTR ENST00000259119.4 alternative 5' UTR ENST00000490989.1 GENCODE experimental pipeline ENST00000466168.1 GENCODE experimental pipeline ENST00000468757.1 GENCODE experimental pipeline ENST00000465393.1 GENCODE experimental pipeline ENST00000420943.1 NP_536845 ENST00000463281.1 GENCODE experimental pipeline ENST00000418087.1 alternative 5' UTR ENST00000334567.5 FLJ23172 ENST00000450693.1 alternative 3' UTR ENST00000456146.1 GENCODE experimental pipeline ENST00000415807.2 alternative 5' UTR ENST00000423424.1 alternative 5' UTR ENST00000416957.1 alternative 5' UTR ENST00000424772.1 GENCODE experimental pipeline ENST00000232458.5 Human Swiss-Prot isoform Q9H8V3-1.3 ENST00000428567.1 alternative 5' UTR ENST00000426894.1 alternative 5' UTR ENST00000366090.2 alternative 5' UTR ENST00000366254.2 alternative 5' UTR ENST00000415665.1 alternative 5' UTR ENST00000438041.1 alternative 5' UTR ENST00000441497.2 alternative 5' UTR ENST00000444250.1 GENCODE experimental pipeline ENST00000423427.1 alternative 5' UTR ENST00000413821.1 alternative 5' UTR ENST00000361589.4 alternative 5' UTR ENST00000457192.1 GENCODE experimental pipeline ENST00000426315.1 GENCODE experimental pipeline ENST00000434969.1 GENCODE experimental pipeline ENST00000421034.1 GENCODE experimental pipeline ENST00000457928.2 alternative 5' UTR ENST00000424913.1 alternative 5' UTR ENST00000352800.5 alternative 5' UTR ENST00000437738.1 alternative 5' UTR ENST00000431421.1 alternative 5' UTR ENST00000450267.1 alternative 5' UTR ENST00000431674.1 alternative 5' UTR ENST00000422066.1 alternative 5' UTR ENST00000443315.1 alternative 5' UTR ENST00000422442.1 alternative 5' UTR ENST00000427349.1 alternative 5' UTR ENST00000413084.1 alternative 5' UTR ENST00000454723.2 GENCODE experimental pipeline ENST00000445673.1 GENCODE experimental pipeline ENST00000456755.1 GENCODE experimental pipeline ENST00000414475.1 GENCODE experimental pipeline ENST00000437510.1 alternative 5' UTR ENST00000420517.2 alternative 5' UTR ENST00000432997.1 alternative 5' UTR ENST00000455865.1 alternative 5' UTR ENST00000436247.1 GENCODE experimental pipeline ENST00000455307.1 GENCODE experimental pipeline ENST00000436432.1 GENCODE experimental pipeline ENST00000432729.1 alternative 5' UTR ENST00000414084.1 alternative 5' UTR ENST00000477735.1 alternative 5' UTR ENST00000468036.1 alternative 5' UTR ENST00000349697.2 AF204159.1 ENST00000496856.1 alternative 5' UTR ENST00000491818.1 alternative 5' UTR ENST00000481587.1 alternative 5' UTR ENST00000466264.1 alternative 5' UTR ENST00000484866.1 alternative 5' UTR ENST00000494234.1 alternative 5' UTR ENST00000467174.2 alternative 5' UTR ENST00000263969.5 alternative 5' UTR ENST00000489329.1 GENCODE experimental pipeline ENST00000466899.1 GENCODE experimental pipeline ENST00000468623.1 alternative 5' UTR ENST00000497513.1 alternative 5' UTR ENST00000490364.1 alternative 5' UTR ENST00000496721.1 alternative 5' UTR ENST00000466064.1 GENCODE experimental pipeline ENST00000462801.1 GENCODE experimental pipeline ENST00000472596.1 GENCODE experimental pipeline ENST00000495660.1 alternative 5' UTR ENST00000442201.2 NP_852091 ENST00000495357.1 GENCODE experimental pipeline ENST00000469882.1 alternative 5' UTR ENST00000484790.1 alternative 5' UTR ENST00000465551.1 alternative 5' UTR ENST00000472339.1 non-organism_supported ENST00000484958.1 alternative 5' UTR ENST00000479269.1 alternative 5' UTR ENST00000487240.1 GENCODE experimental pipeline ENST00000474045.1 not organism-supported ENST00000462382.1 GENCODE experimental pipeline ENST00000473893.1 GENCODE experimental pipeline ENST00000488882.1 not organism-supported ENST00000482794.1 not organism-supported ENST00000498086.1 non-organism_supported ENST00000482070.1 GENCODE experimental pipeline ENST00000469954.1 GENCODE experimental pipeline ENST00000497606.1 alternative 5' UTR ENST00000460412.1 alternative 5' UTR ENST00000487822.1 alternative 5' UTR ENST00000466812.1 alternative 5' UTR ENST00000476015.1 alternative 5' UTR ENST00000470251.1 GENCODE experimental pipeline ENST00000470251.1 alternative 5' UTR ENST00000493370.1 GENCODE experimental pipeline ENST00000493370.1 alternative 5' UTR ENST00000464191.1 alternative 5' UTR ENST00000460419.1 alternative 5' UTR ENST00000464923.1 alternative 5' UTR ENST00000496270.1 GENCODE experimental pipeline ENST00000465010.1 alternative 5' UTR ENST00000477699.1 GENCODE experimental pipeline ENST00000481531.1 alternative 5' UTR ENST00000493074.1 alternative 5' UTR ENST00000437402.1 alternative 5' UTR ENST00000454495.2 alternative 5' UTR ENST00000473045.1 alternative 5' UTR ENST00000468101.1 alternative 5' UTR ENST00000427201.2 alternative 5' UTR ENST00000482138.1 alternative 5' UTR ENST00000454652.1 alternative 5' UTR ENST00000468001.1 alternative 5' UTR ENST00000432781.1 GENCODE experimental pipeline ENST00000431348.1 GENCODE experimental pipeline ENST00000392579.2 GENCODE experimental pipeline ENST00000437341.1 alternative 5' UTR ENST00000422946.1 GENCODE experimental pipeline ENST00000428798.2 NP_001138615.1 ENST00000431427.1 GENCODE experimental pipeline ENST00000455925.1 alternative 5' UTR ENST00000439647.1 alternative 5' UTR ENST00000426955.2 NP_612354 ENST00000455059.1 GENCODE experimental pipeline ENST00000324557.4 NP_115707 ENST00000402825.3 NP_055508 ENST00000310118.4 upstream_ATG-80 aa ENST00000417952.1 GENCODE experimental pipeline ENST00000432855.1 GENCODE experimental pipeline ENST00000444134.1 non-organism_supported ENST00000444134.1 alternative 5' UTR ENST00000450424.1 non-organism_supported ENST00000421110.1 non-organism_supported ENST00000382330.3 alternative 5' UTR ENST00000455679.1 alternative 5' UTR ENST00000427845.1 alternative 5' UTR ENST00000456033.1 GENCODE experimental pipeline ENST00000427607.1 alternative 5' UTR ENST00000435046.2 not organism-supported ENST00000448284.1 GENCODE experimental pipeline ENST00000450976.1 alternative 5' UTR ENST00000433578.1 alternative 5' UTR ENST00000418768.1 alternative 5' UTR ENST00000383847.2 NP_653236.3 ENST00000453072.1 alternative 5' UTR ENST00000412877.1 alternative 5' UTR ENST00000455712.1 alternative 5' UTR ENST00000452961.1 alternative 5' UTR ENST00000429568.1 GENCODE experimental pipeline ENST00000450923.1 GENCODE experimental pipeline ENST00000419960.1 GENCODE experimental pipeline ENST00000451348.1 GENCODE experimental pipeline ENST00000457449.1 GENCODE experimental pipeline ENST00000436792.2 NP_056118 ENST00000422105.1 alternative 5' UTR ENST00000453056.1 alternative 5' UTR ENST00000471655.1 GENCODE experimental pipeline ENST00000441141.1 alternative 5' UTR ENST00000445089.1 alternative 5' UTR ENST00000456310.1 GENCODE experimental pipeline ENST00000465178.1 GENCODE experimental pipeline ENST00000447637.1 alternative 5' UTR ENST00000454237.1 GENCODE experimental pipeline ENST00000454237.1 alternative 5' UTR ENST00000438798.1 alternative 5' UTR ENST00000428617.1 alternative 5' UTR ENST00000420577.1 GENCODE experimental pipeline ENST00000296254.3 GENCODE experimental pipeline ENST00000467520.1 GENCODE experimental pipeline ENST00000424591.2 GENCODE experimental pipeline ENST00000452897.1 GENCODE experimental pipeline ENST00000296257.5 upstream_ATG-75 aa ENST00000444509.1 GENCODE experimental pipeline ENST00000382199.2 NP_006539 ENST00000382191.4 Sw:P62995-3 ENST00000342294.4 Sw:P62995-2 ENST00000434744.1 alternative 5' UTR ENST00000472868.2 not organism-supported ENST00000440773.1 alternative 5' UTR ENST00000421809.1 alternative 5' UTR ENST00000413301.1 alternative 5' UTR ENST00000453370.1 GENCODE experimental pipeline ENST00000434896.1 GENCODE experimental pipeline ENST00000441169.1 GENCODE experimental pipeline ENST00000427474.1 GENCODE experimental pipeline ENST00000456535.1 GENCODE experimental pipeline ENST00000307944.5 alternative 5' UTR ENST00000446782.1 GENCODE experimental pipeline ENST00000479590.1 GENCODE experimental pipeline ENST00000413695.1 alternative 5' UTR ENST00000430560.1 GENCODE experimental pipeline ENST00000273784.5 GENCODE experimental pipeline ENST00000450521.1 alternative 5' UTR ENST00000431018.1 GENCODE experimental pipeline ENST00000455926.1 GENCODE experimental pipeline ENST00000428501.1 GENCODE experimental pipeline ENST00000447445.1 GENCODE experimental pipeline ENST00000441007.1 alternative 5' UTR ENST00000445596.1 alternative 5' UTR ENST00000418288.1 alternative 5' UTR ENST00000447345.1 alternative 5' UTR ENST00000427785.1 alternative 5' UTR ENST00000448497.1 alternative 5' UTR ENST00000411792.1 alternative 5' UTR ENST00000434957.1 GENCODE experimental pipeline ENST00000320741.2 alternative 5' UTR ENST00000427315.1 alternative 5' UTR ENST00000458216.1 alternative 5' UTR ENST00000430309.1 alternative 5' UTR ENST00000417392.1 alternative 5' UTR ENST00000438590.1 alternative 5' UTR ENST00000448408.1 alternative 5' UTR ENST00000440338.1 alternative 5' UTR ENST00000448044.1 alternative 5' UTR ENST00000416235.1 alternative 5' UTR ENST00000423451.1 alternative 5' UTR ENST00000446170.1 alternative 5' UTR ENST00000442023.1 GENCODE experimental pipeline ENST00000442023.1 alternative 5' UTR ENST00000296277.4 alternative 5' UTR ENST00000433055.1 alternative 5' UTR ENST00000392470.2 GENCODE experimental pipeline ENST00000392475.2 GENCODE experimental pipeline ENST00000465015.1 GENCODE experimental pipeline ENST00000439271.1 GENCODE experimental pipeline ENST00000425937.1 alternative 5' UTR ENST00000449623.1 GENCODE experimental pipeline ENST00000232014.4 alternative 5' UTR ENST00000430339.1 alternative 5' UTR ENST00000438077.1 alternative 5' UTR ENST00000433178.1 GENCODE experimental pipeline ENST00000417384.1 GENCODE experimental pipeline ENST00000446091.1 GENCODE experimental pipeline ENST00000423643.1 GENCODE experimental pipeline ENST00000415940.1 GENCODE experimental pipeline ENST00000444379.1 GENCODE experimental pipeline ENST00000416784.1 alternative 5' UTR ENST00000430340.1 alternative 5' UTR ENST00000414139.1 alternative 5' UTR ENST00000454789.1 alternative 5' UTR ENST00000426274.1 alternative 5' UTR ENST00000420410.1 alternative 5' UTR ENST00000443217.1 alternative 5' UTR ENST00000457242.1 lternative_5'_UTR ENST00000474472.1 GENCODE experimental pipeline ENST00000484468.1 GENCODE experimental pipeline ENST00000487347.1 GENCODE experimental pipeline ENST00000483938.1 GENCODE experimental pipeline ENST00000494044.1 GENCODE experimental pipeline ENST00000444488.1 GENCODE experimental pipeline ENST00000433971.1 alternative 5' UTR ENST00000412373.1 alternative 5' UTR ENST00000473790.1 GENCODE experimental pipeline ENST00000456832.1 GENCODE experimental pipeline ENST00000493725.1 GENCODE experimental pipeline ENST00000425454.1 GENCODE experimental pipeline ENST00000392461.3 Sw:Q9H3D4-8.1 ENST00000444866.1 alternative 5' UTR ENST00000426003.1 alternative 5' UTR ENST00000456423.1 GENCODE experimental pipeline ENST00000439062.1 alternative 5' UTR ENST00000447382.1 alternative 5' UTR ENST00000422625.1 alternative 5' UTR ENST00000422940.1 alternative 5' UTR ENST00000453359.1 upstream_ATG-1aa ENST00000453359.1 alternative 5' UTR ENST00000445281.1 not organism-supported ENST00000427544.2 alternative 5' UTR ENST00000432514.1 alternative 5' UTR ENST00000438488.1 GENCODE experimental pipeline ENST00000452657.1 GENCODE experimental pipeline ENST00000450716.1 alternative 5' UTR ENST00000450716.1 not organism-supported ENST00000418610.1 alternative 5' UTR ENST00000443165.1 GENCODE experimental pipeline ENST00000414895.1 GENCODE experimental pipeline ENST00000264735.2 upstream_ATG-105 aa ENST00000416012.1 not organism-supported ENST00000495496.1 not organism-supported ENST00000414634.1 GENCODE experimental pipeline ENST00000392443.3 GENCODE experimental pipeline ENST00000392443.3 not organism-supported ENST00000429164.1 GENCODE experimental pipeline ENST00000444085.1 GENCODE experimental pipeline ENST00000457815.1 GENCODE experimental pipeline ENST00000455821.1 GENCODE experimental pipeline ENST00000440556.1 not organism-supported ENST00000457986.1 alternative 5' UTR ENST00000446356.1 alternative 5' UTR ENST00000448892.1 GENCODE experimental pipeline ENST00000437597.1 GENCODE experimental pipeline ENST00000419571.1 GENCODE experimental pipeline ENST00000476750.1 GENCODE experimental pipeline ENST00000429560.1 GENCODE experimental pipeline ENST00000447139.1 GENCODE experimental pipeline ENST00000437613.1 GENCODE experimental pipeline ENST00000480853.1 GENCODE experimental pipeline ENST00000439479.1 GENCODE experimental pipeline ENST00000455796.1 GENCODE experimental pipeline ENST00000415410.1 GENCODE experimental pipeline ENST00000427064.1 GENCODE experimental pipeline ENST00000460582.1 GENCODE experimental pipeline ENST00000458531.1 GENCODE experimental pipeline ENST00000447975.1 GENCODE experimental pipeline ENST00000426468.1 GENCODE experimental pipeline ENST00000426109.1 GENCODE experimental pipeline ENST00000417011.1 GENCODE experimental pipeline ENST00000415451.1 GENCODE experimental pipeline ENST00000453131.1 alternative 5' UTR ENST00000485430.1 GENCODE experimental pipeline ENST00000480350.1 GENCODE experimental pipeline ENST00000451982.1 GENCODE experimental pipeline ENST00000445707.1 GENCODE experimental pipeline ENST00000455807.1 GENCODE experimental pipeline ENST00000486425.1 GENCODE experimental pipeline ENST00000478685.1 GENCODE experimental pipeline ENST00000429834.1 GENCODE experimental pipeline ENST00000444346.1 GENCODE experimental pipeline ENST00000411741.1 GENCODE experimental pipeline ENST00000438207.1 GENCODE experimental pipeline ENST00000433111.1 alternative 5' UTR ENST00000448113.1 GENCODE experimental pipeline ENST00000392396.3 alternative 5' UTR ENST00000457079.1 GENCODE experimental pipeline ENST00000296326.3 non-organism_supported ENST00000416660.1 GENCODE experimental pipeline ENST00000428985.1 GENCODE experimental pipeline ENST00000496737.1 GENCODE experimental pipeline ENST00000419333.1 not organism-supported ENST00000431016.1 alternative 5' UTR ENST00000411591.1 alternative 5' UTR ENST00000433733.1 GENCODE experimental pipeline ENST00000412869.1 alternative 5' UTR ENST00000443555.1 alternative 5' UTR ENST00000491186.1 GENCODE experimental pipeline ENST00000446879.1 GENCODE experimental pipeline ENST00000454715.1 GENCODE experimental pipeline ENST00000420226.1 GENCODE experimental pipeline ENST00000452051.1 GENCODE experimental pipeline ENST00000433160.1 GENCODE experimental pipeline ENST00000456677.1 alternative 5' UTR ENST00000425888.1 alternative 5' UTR ENST00000426755.1 alternative 5' UTR ENST00000409690.3 NM_032898.2 ENST00000399942.4 GENCODE experimental pipeline ENST00000434433.1 GENCODE experimental pipeline ENST00000467803.1 GENCODE experimental pipeline ENST00000447325.1 GENCODE experimental pipeline ENST00000321256.5 upstream-ATG-31aa ENST00000452404.2 GENCODE experimental pipeline ENST00000422610.1 alternative 5' UTR ENST00000411704.1 alternative 5' UTR ENST00000455953.1 alternative 5' UTR ENST00000447775.1 GENCODE experimental pipeline ENST00000413127.1 GENCODE experimental pipeline ENST00000443835.1 GENCODE experimental pipeline ENST00000424769.1 GENCODE experimental pipeline ENST00000414354.1 GENCODE experimental pipeline ENST00000419354.1 alternative 5' UTR ENST00000392380.2 alternative 5' UTR ENST00000419553.1 alternative 5' UTR ENST00000436682.1 alternative 5' UTR ENST00000412364.1 alternative 5' UTR ENST00000434148.1 alternative 5' UTR ENST00000430666.1 GENCODE experimental pipeline ENST00000438408.1 GENCODE experimental pipeline ENST00000445908.1 GENCODE experimental pipeline ENST00000441275.1 GENCODE experimental pipeline ENST00000446746.1 alternative 5' UTR ENST00000455876.1 GENCODE experimental pipeline ENST00000483920.1 GENCODE experimental pipeline ENST00000432819.1 alternative 5' UTR ENST00000431056.1 alternative 5' UTR ENST00000445160.2 alternative 5' UTR ENST00000468710.1 GENCODE experimental pipeline ENST00000476764.1 GENCODE experimental pipeline ENST00000447048.1 GENCODE experimental pipeline ENST00000472149.1 GENCODE experimental pipeline ENST00000428738.1 GENCODE experimental pipeline ENST00000428738.1 alternative 5' UTR ENST00000415708.2 GENCODE experimental pipeline ENST00000424384.2 GENCODE experimental pipeline ENST00000428136.1 alternative 3' UTR ENST00000455191.1 alternative 5' UTR ENST00000452735.1 alternative 5' UTR ENST00000448864.1 alternative 5' UTR ENST00000442341.1 alternative 5' UTR ENST00000513889.1 Variant fragments RP11-2H3.5-001 and RP11-2H3.5-005 are part of the same variant; the exact exon structure linking the fragments is yet to be determined, as a possible genomic assembly error between them deletes one or more exons ENST00000502662.1 Variant fragments RP11-2H3.5-001 and RP11-2H3.5-005 are part of the same variant; the exact exon structure linking the fragments is yet to be determined, as a possible genomic assembly error between them deletes one or more exons ENST00000511833.2 NP_597731.2 ENST00000509768.1 GENCODE experimental pipeline ENST00000510235.1 GENCODE experimental pipeline ENST00000465426.1 alternative 5' UTR ENST00000487902.1 GENCODE experimental pipeline ENST00000488061.1 alternative 5' UTR ENST00000471824.2 GENCODE experimental pipeline ENST00000461490.1 GENCODE experimental pipeline ENST00000489312.1 GENCODE experimental pipeline ENST00000505477.1 alternative 5' UTR ENST00000511290.1 alternative 5' UTR ENST00000515118.1 GENCODE experimental pipeline ENST00000512249.1 GENCODE experimental pipeline ENST00000419774.1 alternative 5' UTR ENST00000427463.1 alternative 5' UTR ENST00000470161.2 alternative 5' UTR ENST00000430644.1 FLJ32562 ENST00000440452.1 FLJ43813 ENST00000440452.1 alternative 5' UTR ENST00000433814.1 alternative 5' UTR ENST00000503571.1 GENCODE experimental pipeline ENST00000503405.1 GENCODE experimental pipeline ENST00000454037.1 GENCODE experimental pipeline ENST00000514453.1 GENCODE experimental pipeline ENST00000515492.1 alternative 5' UTR ENST00000510493.1 alternative 5' UTR ENST00000514546.1 alternative 5' UTR ENST00000509465.1 GENCODE experimental pipeline ENST00000515182.1 not organism-supported ENST00000398520.2 NP_602297.1 ENST00000398516.2 alternative 5' UTR ENST00000510644.1 alternative 5' UTR ENST00000504138.1 alternative 5' UTR ENST00000512174.1 alternative 5' UTR ENST00000507339.1 alternative 5' UTR ENST00000504969.1 GENCODE experimental pipeline ENST00000510332.1 GENCODE experimental pipeline ENST00000503765.1 alternative 5' UTR ENST00000515004.1 alternative 5' UTR ENST00000502483.1 alternative 5' UTR ENST00000514490.1 alternative 5' UTR ENST00000509233.1 alternative 5' UTR ENST00000511679.1 alternative 5' UTR ENST00000511672.1 alternative 5' UTR ENST00000502657.1 GENCODE experimental pipeline ENST00000505653.1 GENCODE experimental pipeline ENST00000515553.1 GENCODE experimental pipeline ENST00000382952.3 NP_001012632.1 ENST00000515399.1 alternative 5' UTR ENST00000513420.1 alternative 5' UTR ENST00000514984.1 GENCODE experimental pipeline ENST00000505364.1 GENCODE experimental pipeline ENST00000505177.2 GENCODE experimental pipeline ENST00000505177.2 not organism-supported ENST00000264750.6 NP_005873.2 ENST00000510794.1 GENCODE experimental pipeline ENST00000512842.1 GENCODE experimental pipeline ENST00000505839.1 GENCODE experimental pipeline ENST00000511216.1 alternative 5' UTR ENST00000507531.1 alternative 5' UTR ENST00000511563.1 alternative 5' UTR ENST00000422806.1 confirm experimentally ENST00000485989.2 GENCODE experimental pipeline ENST00000458173.3 non-organism_supported ENST00000458173.3 not organism-supported ENST00000508803.1 alternative 5' UTR ENST00000507820.1 alternative 5' UTR ENST00000514045.1 alternative 5' UTR ENST00000509115.1 alternative 5' UTR ENST00000416258.1 GENCODE experimental pipeline ENST00000453740.1 GENCODE experimental pipeline ENST00000455762.1 GENCODE experimental pipeline ENST00000411649.1 GENCODE experimental pipeline ENST00000502636.1 GENCODE experimental pipeline ENST00000443786.2 alternative 5' UTR ENST00000514395.1 alternative 5' UTR ENST00000502440.1 alternative 5' UTR ENST00000508471.1 GENCODE experimental pipeline ENST00000290974.2 CCDS33942.1 ENST00000502316.1 alternative 5' UTR ENST00000503123.1 GENCODE experimental pipeline ENST00000506706.1 alternative 5' UTR ENST00000511600.1 alternative 5' UTR ENST00000513450.1 alternative 5' UTR ENST00000509050.1 alternative 5' UTR ENST00000502458.1 GENCODE experimental pipeline ENST00000503219.1 alternative 5' UTR ENST00000504294.1 alternative 5' UTR ENST00000508385.1 alternative 5' UTR ENST00000512014.1 alternative 5' UTR ENST00000513095.1 alternative 5' UTR ENST00000502260.1 alternative 5' UTR ENST00000435136.2 alternative 5' UTR ENST00000511747.1 alternative 5' UTR ENST00000356331.5 alternative 5' UTR ENST00000511797.1 alternative 5' UTR ENST00000355842.3 GENCODE experimental pipeline ENST00000398123.2 NP_789771 ENST00000329687.4 alternative 5' UTR ENST00000508221.1 GENCODE experimental pipeline ENST00000502735.1 GENCODE experimental pipeline ENST00000507492.1 GENCODE experimental pipeline ENST00000438480.2 NP_001036155 ENST00000510580.1 not organism-supported ENST00000507039.1 GENCODE experimental pipeline ENST00000505702.1 GENCODE experimental pipeline ENST00000508619.1 GENCODE experimental pipeline ENST00000254742.2 MGC13159 ENST00000343470.4 FLJ20425 ENST00000513174.1 alternative 5' UTR ENST00000502918.1 alternative 5' UTR ENST00000513555.1 alternative 5' UTR ENST00000505246.1 alternative 5' UTR ENST00000506380.1 alternative 5' UTR ENST00000433139.2 alternative 5' UTR ENST00000504171.1 alternative 5' UTR ENST00000505286.1 GENCODE experimental pipeline ENST00000507908.1 alternative 5' UTR ENST00000506508.1 GENCODE experimental pipeline ENST00000512636.1 not organism-supported ENST00000505296.1 GENCODE experimental pipeline ENST00000509451.1 GENCODE experimental pipeline ENST00000409831.1 alternative 5' UTR ENST00000409831.1 FLJ42728 ENST00000503569.1 alternative 5' UTR ENST00000335585.5 Isoform 2 ENST00000515571.1 Isoform 3 ENST00000382599.4 overlapping uORF ENST00000285599.3 Isoform 1 ENST00000504248.1 GENCODE experimental pipeline ENST00000505907.1 Isoform 2 ENST00000307533.6 LOC93622 ENST00000508423.1 alternative 5' UTR ENST00000444368.1 alternative 5' UTR ENST00000427736.1 alternative 5' UTR ENST00000410031.1 GENCODE experimental pipeline ENST00000451522.2 NP_001106834 ENST00000310074.6 Isoform 1 ENST00000512388.1 Isoform 2 ENST00000515646.1 Isoform 3 ENST00000512594.1 long polyA tail annotated in cDNA ENST00000512594.1 Actin-binding LIM protein ENST00000514025.1 Actin-binding LIM protein 9bp missing ENST00000447017.2 NP_001123555 ENST00000407564.3 NP_115808 ENST00000505872.1 NP_001123558 ENST00000507123.1 two thirds of EST is missing from alignment probably due to the presence of tandem repeats ENST00000457650.2 alternative 5' UTR ENST00000508641.1 GENCODE experimental pipeline ENST00000512966.1 GENCODE experimental pipeline ENST00000509453.1 GENCODE experimental pipeline ENST00000503233.1 alternative 5' UTR ENST00000513449.2 GENCODE experimental pipeline ENST00000389737.4 NP_689757.2 ENST00000511149.1 GENCODE experimental pipeline ENST00000511366.2 GENCODE experimental pipeline ENST00000503981.1 alternative 5' UTR ENST00000503448.1 GENCODE experimental pipeline ENST00000503448.1 alternative 5' UTR ENST00000512047.1 not best-in-genome evidence ENST00000512047.1 GENCODE experimental pipeline ENST00000508324.1 not best-in-genome evidence ENST00000513129.1 alternative 5' UTR ENST00000504249.1 GENCODE experimental pipeline ENST00000503493.1 GENCODE experimental pipeline ENST00000508566.1 93921 ENST00000507515.1 alternative 5' UTR ENST00000514690.1 alternative 5' UTR ENST00000510712.1 alternative 5' UTR ENST00000510639.1 GENCODE experimental pipeline ENST00000509244.1 GENCODE experimental pipeline ENST00000505386.1 GENCODE experimental pipeline ENST00000511649.1 GENCODE experimental pipeline ENST00000504644.1 GENCODE experimental pipeline ENST00000040738.5 KIAA1327 ENST00000507943.1 GENCODE experimental pipeline ENST00000514401.1 GENCODE experimental pipeline ENST00000295297.4 NP_001128642 ENST00000511544.1 NP_065836.2 ENST00000512702.1 alternative 5' UTR ENST00000503658.1 alternative 5' UTR ENST00000512066.1 GENCODE experimental pipeline ENST00000503196.1 GENCODE experimental pipeline ENST00000509314.1 GENCODE experimental pipeline ENST00000509314.1 alternative 5' UTR ENST00000510802.1 alternative 5' UTR ENST00000507899.1 GENCODE experimental pipeline ENST00000515679.1 alternative 5' UTR ENST00000515430.1 This could encode the N-terminal 162 aa of an 657 aa open reading frame according to RefSeq however there are no convincing cDNAs or ESTs ENST00000503617.1 alternative 5' UTR ENST00000382346.3 not organism-supported ENST00000503884.1 GENCODE experimental pipeline ENST00000508167.1 alternative 5' UTR ENST00000508322.1 alternative 5' UTR ENST00000508940.1 alternative 5' UTR ENST00000514967.1 alternative 5' UTR ENST00000514693.1 GENCODE experimental pipeline ENST00000512304.2 dotter required to determine structure ENST00000515064.1 GENCODE experimental pipeline ENST00000507464.1 GENCODE experimental pipeline ENST00000503945.1 GENCODE experimental pipeline ENST00000382247.1 FLJ20280 ENST00000326877.3 Isoform 3 ENST00000382224.1 non-organism_supported ENST00000512376.2 non-organism_supported ENST00000512376.2 not organism-supported ENST00000273739.5 not organism-supported ENST00000508824.1 GENCODE experimental pipeline ENST00000511508.1 not organism-supported ENST00000510700.1 GENCODE experimental pipeline ENST00000502374.1 GENCODE experimental pipeline ENST00000511160.1 GENCODE experimental pipeline ENST00000514292.1 GENCODE experimental pipeline ENST00000502938.1 GENCODE experimental pipeline ENST00000509625.1 GENCODE experimental pipeline ENST00000382148.3 NP_001030175 ENST00000509207.1 alternative 5' UTR ENST00000511835.1 GENCODE experimental pipeline ENST00000510705.2 not organism-supported ENST00000506346.1 GENCODE experimental pipeline ENST00000509702.1 not organism-supported ENST00000515534.1 not organism-supported ENST00000503714.1 GENCODE experimental pipeline ENST00000503714.1 not organism-supported ENST00000389609.4 GENCODE experimental pipeline ENST00000512108.1 GENCODE experimental pipeline ENST00000510415.1 GENCODE experimental pipeline ENST00000505991.1 alternative 5' UTR ENST00000513204.1 alternative 5' UTR ENST00000503434.1 alternative 5' UTR ENST00000507530.1 alternative 5' UTR ENST00000510033.2 not organism-supported ENST00000510448.1 GENCODE experimental pipeline ENST00000507618.1 GENCODE experimental pipeline ENST00000514321.1 GENCODE experimental pipeline ENST00000510880.1 alternative 5' UTR ENST00000513691.1 alternative 5' UTR ENST00000514872.1 alternative 5' UTR ENST00000510905.1 GENCODE experimental pipeline ENST00000515764.2 not organism-supported ENST00000506197.2 NP_001138904 ENST00000514384.1 GENCODE experimental pipeline ENST00000514384.1 not organism-supported ENST00000512351.1 alternative 5' UTR ENST00000510778.2 not organism-supported ENST00000506956.1 alternative 5' UTR ENST00000512671.1 alternative 5' UTR ENST00000514807.1 alternative 5' UTR ENST00000348160.4 NP_056958 ENST00000509158.1 alternative 5' UTR ENST00000505958.1 alternative 5' UTR ENST00000514730.1 alternative 5' UTR ENST00000507574.1 alternative 5' UTR ENST00000514675.1 alternative 5' UTR ENST00000515573.1 alternative 5' UTR ENST00000511546.1 alternative 5' UTR ENST00000514656.3 GENCODE experimental pipeline ENST00000504938.1 alternative 5' UTR ENST00000467087.1 non-ATG start ENST00000467011.1 GENCODE experimental pipeline ENST00000465503.1 non-ATG start ENST00000473519.1 GENCODE experimental pipeline ENST00000477474.2 GENCODE experimental pipeline ENST00000382007.1 FLJ45721 ENST00000507759.1 GENCODE experimental pipeline ENST00000507864.1 GENCODE experimental pipeline ENST00000506189.1 alternative 5' UTR ENST00000508199.1 GENCODE experimental pipeline ENST00000501725.2 GENCODE experimental pipeline ENST00000284437.6 alternative 5' UTR ENST00000454158.2 alternative 3' UTR ENST00000510084.1 not organism-supported ENST00000443855.1 GENCODE experimental pipeline ENST00000502321.1 GENCODE experimental pipeline ENST00000505940.1 alternative 5' UTR ENST00000515861.1 alternative 5' UTR ENST00000506146.1 alternative 5' UTR ENST00000508364.1 alternative 5' UTR ENST00000508254.1 alternative 5' UTR ENST00000514655.1 alternative 5' UTR ENST00000358869.2 LOC92689 ENST00000344606.6 GENCODE experimental pipeline ENST00000502718.1 GENCODE experimental pipeline ENST00000449470.2 alternative 5' UTR ENST00000504470.1 alternative 5' UTR ENST00000340169.2 NP_919433.1 ENST00000513731.1 GENCODE experimental pipeline ENST00000506179.1 not organism-supported ENST00000506179.1 alternative 5' UTR ENST00000515021.1 GENCODE experimental pipeline ENST00000514106.1 alternative 5' UTR ENST00000509391.1 alternative 5' UTR ENST00000505698.1 alternative 5' UTR ENST00000510490.1 alternative 5' UTR ENST00000505729.1 alternative 5' UTR ENST00000513798.1 GENCODE experimental pipeline ENST00000515550.1 GENCODE experimental pipeline ENST00000505618.1 alternative 5' UTR ENST00000507851.1 alternative 5' UTR ENST00000508513.1 alternative 5' UTR ENST00000503941.1 alternative 5' UTR ENST00000511121.1 alternative 5' UTR ENST00000515422.1 GENCODE experimental pipeline ENST00000295971.7 alternative 5' UTR ENST00000515053.1 alternative 5' UTR ENST00000513473.1 alternative 5' UTR ENST00000514782.1 alternative 5' UTR ENST00000507180.1 alternative 5' UTR ENST00000511598.1 alternative 5' UTR ENST00000511902.1 alternative 5' UTR ENST00000505220.1 alternative 5' UTR ENST00000381782.2 FLJ14001 ENST00000316607.5 FLJ14001 ENST00000504305.1 alternative 5' UTR ENST00000510670.1 alternative 5' UTR ENST00000514920.1 alternative 5' UTR ENST00000513516.1 alternative 5' UTR ENST00000508707.1 alternative 5' UTR ENST00000508676.1 alternative 5' UTR ENST00000503503.1 alternative 5' UTR ENST00000514924.1 alternative 5' UTR ENST00000503431.1 alternative 5' UTR ENST00000284440.4 CCDS3462.1 ENST00000513024.1 alternative 5' UTR ENST00000509638.1 alternative 5' UTR ENST00000446625.2 alternative 5' UTR ENST00000503057.1 alternative 5' UTR ENST00000511496.1 alternative 5' UTR ENST00000514096.1 GENCODE experimental pipeline ENST00000514096.1 alternative 5' UTR ENST00000509277.1 alternative 5' UTR ENST00000509454.1 GENCODE experimental pipeline ENST00000509454.1 alternative 5' UTR ENST00000381753.4 alternative 5' UTR ENST00000505705.1 GENCODE experimental pipeline ENST00000506475.1 GENCODE experimental pipeline ENST00000510602.1 GENCODE experimental pipeline ENST00000510772.1 GENCODE experimental pipeline ENST00000508448.1 alternative 5' UTR ENST00000513702.1 alternative 5' UTR ENST00000513558.1 GENCODE experimental pipeline ENST00000502486.1 NP_997289 ENST00000504360.1 upstream_ATG-4 ENST00000514372.1 alternative 5' UTR ENST00000415895.3 confirm experimentally ENST00000415895.3 non canonical conserved ENST00000415895.3 not organism-supported ENST00000510035.1 non canonical conserved ENST00000281543.5 FLJ13220 ENST00000507917.1 GENCODE experimental pipeline ENST00000510861.1 non-organism_supported ENST00000510861.1 alternative 5' UTR ENST00000510861.1 not organism-supported ENST00000514090.1 not organism-supported ENST00000514090.1 alternative 5' UTR ENST00000356504.1 alternative 5' UTR ENST00000507069.1 confirm experimentally ENST00000514236.1 not organism-supported ENST00000503806.1 alternative 5' UTR ENST00000506961.1 alternative 5' UTR ENST00000507460.1 confirm experimentally ENST00000396533.1 alternative 5' UTR ENST00000505102.1 alternative 5' UTR ENST00000502874.1 not organism-supported ENST00000507889.1 tandem repeats in the last exon ENST00000507489.1 alternative 5' UTR ENST00000508115.1 repeated sequence in the last exon ENST00000402813.3 NP_001136036.1 ENST00000420489.2 alternative 5' UTR ENST00000504722.1 alternative 5' UTR ENST00000514520.1 alternative 5' UTR ENST00000513178.1 alternative 5' UTR ENST00000506073.1 GENCODE experimental pipeline ENST00000505452.1 not organism-supported ENST00000504700.2 not organism-supported ENST00000504654.1 alternative 5' UTR ENST00000509122.1 alternative 5' UTR ENST00000509664.1 alternative 5' UTR ENST00000514981.1 alternative 5' UTR ENST00000511662.1 alternative 5' UTR ENST00000508996.1 alternative 5' UTR ENST00000507210.1 alternative 5' UTR ENST00000264312.7 Swissprot: Q9NX40-1 ENST00000512236.1 alternative 5' UTR ENST00000509164.1 alternative 5' UTR ENST00000381473.3 alternative 5' UTR ENST00000444354.2 NP_001073309 ENST00000444354.2 NM_001079840.1 ENST00000510824.1 GENCODE experimental pipeline ENST00000508293.1 alternative 5' UTR ENST00000513391.2 alternative 5' UTR ENST00000513391.2 not organism-supported ENST00000508329.1 GENCODE experimental pipeline ENST00000381464.2 alternative 5' UTR ENST00000226432.4 FLJ21511 ENST00000514053.2 not organism-supported ENST00000511875.1 GENCODE experimental pipeline ENST00000419395.2 GENCODE experimental pipeline ENST00000443173.1 FLJ37999 ENST00000514957.1 non canonical conserved ENST00000401642.3 Isoform 1 ENST00000388940.4 Isoform 2 ENST00000503450.1 GENCODE experimental pipeline ENST00000358575.5 NP_001128409.1 ENST00000306932.6 NP_001128410.1 ENST00000510668.1 not organism-supported ENST00000504094.1 GENCODE experimental pipeline ENST00000513421.1 alternative 5' UTR ENST00000510143.1 alternative 5' UTR ENST00000512247.1 alternative 5' UTR ENST00000504299.1 alternative 5' UTR ENST00000508112.1 not organism-supported ENST00000512405.1 GENCODE experimental pipeline ENST00000512964.1 not organism-supported ENST00000503800.1 GENCODE experimental pipeline ENST00000503800.1 not organism-supported ENST00000503856.1 alternative 5' UTR ENST00000504461.1 alternative 5' UTR ENST00000512522.1 alternative 5' UTR ENST00000309964.3 alternative 5' UTR ENST00000381322.1 alternative 5' UTR ENST00000513440.1 alternative 5' UTR ENST00000506747.1 332 bp at the start of the cDNA don't align to genomic seuence ENST00000381295.2 alternative 5' UTR ENST00000264229.6 alternative 5' UTR ENST00000503808.1 GENCODE experimental pipeline ENST00000514888.1 alternative 5' UTR ENST00000505164.1 alternative 5' UTR ENST00000512576.1 alternative 5' UTR ENST00000508121.1 NP_115884.4 ENST00000556376.1 alternative 5' UTR ENST00000553379.1 alternative 5' UTR ENST00000381260.2 alternative 5' UTR ENST00000381255.3 alternative 5' UTR ENST00000317745.7 alternative 5' UTR ENST00000503864.1 alternative 5' UTR ENST00000337881.7 alternative 5' UTR ENST00000555760.1 alternative 5' UTR ENST00000556614.1 alternative 5' UTR ENST00000514890.1 alternative 5' UTR ENST00000506661.1 alternative 5' UTR ENST00000557328.1 alternative 5' UTR ENST00000450656.1 alternative 5' UTR ENST00000441246.2 alternative 5' UTR ENST00000433463.1 alternative 5' UTR ENST00000510355.1 only 577 bp out of 1103 of the EST aligned to genomic DNA ENST00000511330.1 GENCODE experimental pipeline ENST00000508135.2 GENCODE experimental pipeline ENST00000508135.2 not organism-supported ENST00000508292.1 GENCODE experimental pipeline ENST00000514591.1 NP_056051.2 ENST00000508946.1 not organism-supported ENST00000506720.1 not organism-supported ENST00000506746.1 not organism-supported ENST00000514996.1 not organism-supported ENST00000507440.1 not organism-supported ENST00000432638.2 not organism-supported ENST00000322244.4 Isoform 1 ENST00000514261.1 not organism-supported ENST00000505673.2 not organism-supported ENST00000226413.4 Isoform 1 ENST00000420975.2 Isoform 2 ENST00000508048.1 Isoform 2 ENST00000334830.7 Isoform 1 ENST00000513536.1 GENCODE experimental pipeline ENST00000513536.1 not organism-supported ENST00000265403.7 rs2942857 ENST00000265403.7 non-canonical acceptor splice site at exon 3 ENST00000458688.2 rs2942857 ENST00000458688.2 non-canonical acceptor splice site at exon 3 ENST00000508661.1 GENCODE experimental pipeline ENST00000510114.1 alternative 5' UTR ENST00000286604.4 GENCODE experimental pipeline ENST00000505512.1 alternative 5' UTR ENST00000510821.1 alternative 5' UTR ENST00000512870.1 GENCODE experimental pipeline ENST00000381060.2 NP_001009181.1 ENST00000530128.1 alternative 3' UTR ENST00000511674.1 alternative 3' UTR ENST00000502294.1 alternative 5' UTR ENST00000273936.4 NMD exception ENST00000504825.1 alternative 5' UTR ENST00000505411.1 alternative 5' UTR ENST00000510437.1 alternative 5' UTR ENST00000470866.1 alternative 5' UTR ENST00000514898.1 alternative 5' UTR ENST00000503876.1 alternative 5' UTR ENST00000417478.2 NP_001124181.1 ENST00000513597.1 GENCODE experimental pipeline ENST00000254799.6 non-organism_supported ENST00000502323.1 GENCODE experimental pipeline ENST00000514161.1 GENCODE experimental pipeline ENST00000509617.1 alternative 5' UTR ENST00000506245.1 alternative 5' UTR ENST00000507544.2 NAGNAG splice site ENST00000421792.2 GENCODE experimental pipeline ENST00000421792.2 CCDS3554 ENST00000558247.1 NAGNAG splice site ENST00000561029.1 not organism-supported ENST00000560372.1 non canonical TEC ENST00000415165.2 splice donor of exon 2 wobble ENST00000503124.1 GENCODE experimental pipeline ENST00000226359.2 GENCODE experimental pipeline ENST00000503446.1 GENCODE experimental pipeline ENST00000359107.4 alternative 5' UTR ENST00000465255.1 GENCODE experimental pipeline ENST00000490128.1 GENCODE experimental pipeline ENST00000395748.3 in frame 5' stop, prior to ATG ENST00000512706.1 GENCODE experimental pipeline ENST00000513909.1 121749 ENST00000506261.1 alternative 5' UTR ENST00000504218.1 alternative 5' UTR ENST00000502620.1 GENCODE experimental pipeline ENST00000514480.1 alternative 5' UTR ENST00000307465.4 GENCODE experimental pipeline ENST00000395719.3 alternative 5' UTR ENST00000503660.1 alternative 5' UTR ENST00000507745.1 alternative 5' UTR ENST00000509100.1 alternative 5' UTR ENST00000511146.1 alternative 5' UTR ENST00000515457.1 alternative 5' UTR ENST00000507252.1 alternative 5' UTR ENST00000511868.1 alternative 5' UTR ENST00000509561.1 alternative 5' UTR ENST00000508510.1 alternative 5' UTR ENST00000499709.2 alternative 5' UTR ENST00000508939.2 confirm experimentally ENST00000513045.1 GENCODE experimental pipeline ENST00000513353.1 alternative 5' UTR ENST00000341029.5 alternative 5' UTR ENST00000513122.1 alternative 5' UTR ENST00000504914.1 alternative 5' UTR ENST00000510423.1 alternative 5' UTR ENST00000503860.1 alternative 5' UTR ENST00000514987.1 GENCODE experimental pipeline ENST00000452464.2 GENCODE experimental pipeline ENST00000510197.1 GENCODE experimental pipeline ENST00000515589.1 GENCODE experimental pipeline ENST00000434846.2 GENCODE experimental pipeline ENST00000466541.1 GENCODE experimental pipeline ENST00000484236.1 GENCODE experimental pipeline ENST00000452412.1 GENCODE experimental pipeline ENST00000510641.1 GENCODE experimental pipeline ENST00000505788.1 GENCODE experimental pipeline ENST00000504637.1 alternative 5' UTR ENST00000512778.1 GENCODE experimental pipeline ENST00000512778.1 alternative 5' UTR ENST00000506731.1 GENCODE experimental pipeline ENST00000515468.1 GENCODE experimental pipeline ENST00000505609.1 alternative 5' UTR ENST00000513774.1 alternative 5' UTR ENST00000502280.1 alternative 5' UTR ENST00000395640.1 alternative 5' UTR ENST00000512918.1 alternative 5' UTR ENST00000515506.1 not organism-supported ENST00000503570.2 GENCODE experimental pipeline ENST00000512373.1 alternative 5' UTR ENST00000514171.1 alternative 5' UTR ENST00000508214.1 alternative 5' UTR ENST00000504452.1 alternative 5' UTR ENST00000515013.1 alternative 5' UTR ENST00000456523.3 in frame 5' stop prior to the ATG ENST00000509081.1 confirm experimentally ENST00000504863.1 GENCODE experimental pipeline ENST00000507010.1 alternative 5' UTR ENST00000503822.1 alternative 5' UTR ENST00000449862.2 NP_001073975.1 ENST00000449862.2 alternative 5' UTR ENST00000515780.1 NP_001073975.1 ENST00000508701.1 GENCODE experimental pipeline ENST00000454948.3 alternative 5' UTR ENST00000355196.2 alternative 5' UTR ENST00000515062.1 GENCODE experimental pipeline ENST00000512664.1 GENCODE experimental pipeline ENST00000514326.1 alternative 5' UTR ENST00000513323.1 alternative 5' UTR ENST00000503210.1 alternative 5' UTR ENST00000505434.1 alternative 5' UTR ENST00000506495.1 alternative 5' UTR ENST00000302236.5 in frame 5' stop codon prior to ATG, o'laps CpG island ENST00000442461.2 alternative 5' UTR ENST00000446851.2 alternative 5' UTR ENST00000505397.1 alternative 5' UTR ENST00000509093.1 GENCODE experimental pipeline ENST00000510801.1 GENCODE experimental pipeline ENST00000511653.1 GENCODE experimental pipeline ENST00000411416.2 alternative 5' UTR ENST00000509973.1 GENCODE experimental pipeline ENST00000505406.1 alternative 5' UTR ENST00000426923.2 alternative 5' UTR ENST00000515670.1 GENCODE experimental pipeline ENST00000311469.4 NP_056512.5 ENST00000405413.2 alternative 5' UTR ENST00000510985.1 GENCODE experimental pipeline ENST00000509970.1 GENCODE experimental pipeline ENST00000509970.1 alternative 3' UTR ENST00000506553.1 not organism-supported ENST00000264409.4 alternative 5' UTR ENST00000509172.1 alternative 5' UTR ENST00000502713.1 alternative 5' UTR ENST00000510449.1 GENCODE experimental pipeline ENST00000512201.1 alternative 5' UTR ENST00000395169.3 NP_620446.1 ENST00000395166.1 alternative 5' UTR ENST00000395160.3 NP_620447.1 ENST00000512017.1 alternative 5' UTR ENST00000512564.1 alternative 5' UTR ENST00000511167.1 alternative 5' UTR ENST00000511328.1 alternative 5' UTR ENST00000509464.1 alternative 5' UTR ENST00000506773.1 alternative 5' UTR ENST00000512689.1 alternative 5' UTR ENST00000502302.1 alternative 5' UTR ENST00000503911.1 alternative 5' UTR ENST00000513186.1 alternative 5' UTR ENST00000502971.1 GENCODE experimental pipeline ENST00000507902.1 alternative 5' UTR ENST00000473559.1 alternative 5' UTR ENST00000506308.1 alternative 5' UTR ENST00000504008.1 alternative 5' UTR ENST00000498875.2 GENCODE experimental pipeline ENST00000425278.2 GENCODE experimental pipeline ENST00000512111.1 alternative 5' UTR ENST00000512216.1 alternative 5' UTR ENST00000509407.1 alternative 5' UTR ENST00000434434.1 alternative 5' UTR ENST00000535835.1 alternative 5' UTR ENST00000512317.1 alternative 5' UTR ENST00000543631.1 alternative 5' UTR ENST00000458304.2 alternative 5' UTR ENST00000282478.7 PMCID: PMC153048 ENST00000282478.7 not organism-supported ENST00000497649.2 GENCODE experimental pipeline ENST00000497649.2 not organism-supported ENST00000511670.1 GENCODE experimental pipeline ENST00000508233.1 27873 ENST00000508588.1 GENCODE experimental pipeline ENST00000515655.1 alternative 5' UTR ENST00000513546.2 GENCODE experimental pipeline ENST00000431413.1 alternative 5' UTR ENST00000422770.1 alternative 5' UTR ENST00000426683.1 alternative 5' UTR ENST00000452979.1 alternative 5' UTR ENST00000264344.5 NP_055698 ENST00000394986.1 alternative 5' UTR ENST00000336904.3 alternative 5' UTR ENST00000508895.1 alternative 5' UTR ENST00000506244.1 alternative 5' UTR ENST00000506691.1 alternative 5' UTR ENST00000508372.1 GENCODE experimental pipeline ENST00000515111.1 GENCODE experimental pipeline ENST00000359052.4 alternative 5' UTR ENST00000509418.1 GENCODE experimental pipeline ENST00000504489.1 GENCODE experimental pipeline ENST00000514743.1 GENCODE experimental pipeline ENST00000510795.1 GENCODE experimental pipeline ENST00000506363.1 alternative 5' UTR ENST00000512312.1 alternative 5' UTR ENST00000264568.4 alternative 5' UTR ENST00000394931.1 alternative 5' UTR ENST00000506749.1 GENCODE experimental pipeline ENST00000514139.1 GENCODE experimental pipeline ENST00000485315.1 Exonerate match to Sw:P46778 ENST00000515287.1 alternative 5' UTR ENST00000511651.1 alternative 5' UTR ENST00000504432.1 GENCODE experimental pipeline ENST00000504472.1 GENCODE experimental pipeline ENST00000510133.1 GENCODE experimental pipeline ENST00000514051.1 GENCODE experimental pipeline ENST00000508393.1 GENCODE experimental pipeline ENST00000505590.1 alternative 5' UTR ENST00000512499.1 alternative 5' UTR ENST00000503944.1 GENCODE experimental pipeline ENST00000504581.1 GENCODE experimental pipeline ENST00000508558.1 GENCODE experimental pipeline ENST00000394877.3 alternative 5' UTR ENST00000394876.2 alternative 5' UTR ENST00000455368.2 alternative 5' UTR ENST00000514547.1 alternative 5' UTR ENST00000513404.1 non canonical TEC ENST00000505142.1 non canonical TEC ENST00000505142.1 non-canonical splice donor site between exons 1 and 2 ENST00000505142.1 alternative 5' UTR ENST00000506883.1 non canonical TEC ENST00000515141.1 alternative 5' UTR ENST00000511045.1 GENCODE experimental pipeline ENST00000493110.1 GENCODE experimental pipeline ENST00000515026.1 not organism-supported ENST00000502763.1 alternative 5' UTR ENST00000513992.1 alternative 5' UTR ENST00000525819.1 alternative 5' UTR ENST00000529296.1 alternative 5' UTR ENST00000424970.2 NP_001128619.1 ENST00000394833.2 alternative 5' UTR ENST00000511926.1 alternative 5' UTR ENST00000507079.1 alternative 5' UTR ENST00000505458.1 confirm experimentally ENST00000505458.1 rs2272676 - validation status unknown ENST00000505458.1 alternative 5' UTR ENST00000505458.1 non canonical polymorphism ENST00000509165.1 alternative 5' UTR ENST00000394801.4 alternative 5' UTR ENST00000394803.5 alternative 5' UTR ENST00000343106.5 NP_871621.1 ENST00000321805.7 alternative 5' UTR ENST00000338145.3 alternative 5' UTR ENST00000349311.8 alternative 5' UTR ENST00000504211.1 alternative 5' UTR ENST00000357194.6 NP_871622.1 ENST00000505207.1 alternative 5' UTR ENST00000502404.1 alternative 5' UTR ENST00000508476.1 alternative 5' UTR ENST00000508238.1 alternative 5' UTR ENST00000502690.1 alternative 5' UTR ENST00000508249.1 alternative 5' UTR ENST00000503643.1 GENCODE experimental pipeline ENST00000510559.1 alternative 5' UTR ENST00000362026.3 alternative 5' UTR ENST00000394785.3 NP_849155.2 ENST00000503103.1 GENCODE experimental pipeline ENST00000503818.1 alternative 5' UTR ENST00000504285.1 alternative 5' UTR ENST00000509245.1 alternative 5' UTR ENST00000514870.1 alternative 5' UTR ENST00000432483.2 NP_789842.2 ENST00000502596.1 GENCODE experimental pipeline ENST00000420470.2 The genes for FLJ20184 and FLJ43963 have been merged because there are some human and pig (Sus scrofa) readthrough ESTs, and there is a homologue gene with the identical Pfam domain organisation (FLJ41603; ENSG00000183111 in human chromosome 5; Swiss-Prot A1IGU5.2) ENST00000420470.2 FLJ43963 ENST00000506828.1 not organism-supported ENST00000508036.2 not organism-supported ENST00000394735.1 alternative 5' UTR ENST00000394735.1 not organism-supported ENST00000451321.2 DKFZp468P1223 ENST00000451321.2 alternative 5' UTR ENST00000503746.1 alternative 5' UTR ENST00000420368.2 alternative 5' UTR ENST00000416543.1 alternative 5' UTR ENST00000433009.1 alternative 5' UTR ENST00000515819.1 alternative 5' UTR ENST00000512828.1 alternative 5' UTR ENST00000394730.3 NP_079027.2 ENST00000515279.1 alternative 5' UTR ENST00000510865.1 alternative 5' UTR ENST00000509336.1 alternative 5' UTR ENST00000505640.1 non-canonical splice donor site between exons 1 and 2 ENST00000505640.1 alternative 5' UTR ENST00000504304.1 GENCODE experimental pipeline ENST00000394708.2 alternative 5' UTR ENST00000509532.1 alternative 5' UTR ENST00000509862.1 alternative 5' UTR ENST00000507696.1 alternative 5' UTR ENST00000510207.1 alternative 5' UTR ENST00000394701.4 NP_001135888.1 ENST00000359079.4 alternative 5' UTR ENST00000506993.1 alternative 5' UTR ENST00000394686.3 alternative 5' UTR ENST00000503385.1 alternative 5' UTR ENST00000508453.1 GENCODE experimental pipeline ENST00000512646.1 GENCODE experimental pipeline ENST00000510706.1 GENCODE experimental pipeline ENST00000512320.1 GENCODE experimental pipeline ENST00000399126.1 NP_115907 ENST00000505486.1 GENCODE experimental pipeline ENST00000394631.3 alternative 5' UTR ENST00000379920.2 NP_940908.2 ENST00000509793.1 NP_001171602 ENST00000509793.1 GENCODE experimental pipeline ENST00000503392.1 GENCODE experimental pipeline ENST00000503392.1 NP_001171601 ENST00000394607.3 alternative 5' UTR ENST00000302274.3 alternative 5' UTR ENST00000506625.1 alternative 5' UTR ENST00000503885.1 alternative 5' UTR ENST00000509344.1 Final 91 bp of EST evidence does not align to this, or any region of the human genome ENST00000504100.1 GENCODE experimental pipeline ENST00000513690.1 GENCODE experimental pipeline ENST00000394598.2 alternative 5' UTR ENST00000354925.2 paired-like homeodomain transcription factor 2 ENST00000354925.2 alternative 5' UTR ENST00000511837.1 alternative 5' UTR ENST00000511990.1 alternative 5' UTR ENST00000512794.1 GENCODE experimental pipeline ENST00000500655.2 alternative 5' UTR ENST00000505019.1 NP_060862.3 ENST00000505019.1 confirm experimentally ENST00000503172.1 alternative 5' UTR ENST00000508577.1 alternative 5' UTR ENST00000505034.1 alternative 5' UTR ENST00000507443.1 alternative 5' UTR ENST00000505632.1 GENCODE experimental pipeline ENST00000503423.1 not organism-supported ENST00000514246.1 GENCODE experimental pipeline ENST00000512999.1 GENCODE experimental pipeline ENST00000504415.1 GENCODE experimental pipeline ENST00000504415.1 not organism-supported ENST00000511590.1 GENCODE experimental pipeline ENST00000513645.2 GENCODE experimental pipeline ENST00000513132.1 alternative 3' UTR ENST00000503557.1 GENCODE experimental pipeline ENST00000507710.1 alternative 5' UTR ENST00000394511.3 alternative 5' UTR ENST00000508801.1 GENCODE experimental pipeline ENST00000511481.1 GENCODE experimental pipeline ENST00000503683.1 alternative 5' UTR ENST00000429713.2 NP_001122405.1 ENST00000434046.2 NP_001122406.1 ENST00000274030.5 NM_019050.2 ENST00000504110.1 NP_001001701.2 ENST00000505556.1 GENCODE experimental pipeline ENST00000506100.1 GENCODE experimental pipeline ENST00000515757.1 alternative 5' UTR ENST00000511408.1 alternative 5' UTR ENST00000507782.1 GENCODE experimental pipeline ENST00000057513.3 NP_079149.3 ENST00000394396.1 alternative 5' UTR ENST00000394394.1 alternative 5' UTR ENST00000514885.1 alternative 5' UTR ENST00000509800.1 GENCODE experimental pipeline ENST00000507814.1 alternative 3' UTR ENST00000379645.3 NP_001124170.1 ENST00000502968.1 alternative 5' UTR ENST00000449251.1 GENCODE experimental pipeline ENST00000388725.2 GENCODE experimental pipeline ENST00000264498.3 NP_001997 (caution: the non-ATG start described by Prats et al was made into an ATG start in this NP entry) ENST00000304430.5 isoform a ENST00000304430.5 Antisense to FGF2 ENST00000339154.2 Antisense to FGF2 ENST00000339154.2 isoform b ENST00000422835.2 GENCODE experimental pipeline ENST00000505319.1 alternative 5' UTR ENST00000339241.1 alternative 5' UTR ENST00000507703.1 alternative 5' UTR ENST00000508849.1 alternative 5' UTR ENST00000515641.1 GenBank: BAG58158.1 ENST00000504491.1 GENCODE experimental pipeline ENST00000508776.1 alternative 5' UTR ENST00000515069.1 GENCODE experimental pipeline ENST00000514379.1 GENCODE experimental pipeline ENST00000296468.3 MGC33302 ENST00000444616.1 non canonical conserved ENST00000480407.1 non canonical conserved ENST00000388795.5 non canonical conserved ENST00000512292.1 GENCODE experimental pipeline ENST00000520121.1 NP_006311.2 ENST00000509834.2 not organism-supported ENST00000509360.1 not organism-supported ENST00000504089.1 alternative 5' UTR ENST00000503785.1 alternative 5' UTR ENST00000514740.1 alternative 5' UTR ENST00000510308.1 alternative 5' UTR ENST00000507833.1 alternative 5' UTR ENST00000508997.1 alternative 5' UTR ENST00000503565.1 non canonical conserved ENST00000503565.1 not organism-supported ENST00000281146.4 LOC132321 ENST00000502887.1 alternative 5' UTR ENST00000508622.1 alternative 5' UTR ENST00000504357.1 GENCODE experimental pipeline ENST00000506638.1 GENCODE experimental pipeline ENST00000503009.1 GENCODE experimental pipeline ENST00000507846.1 GENCODE experimental pipeline ENST00000507846.1 alternative 5' UTR ENST00000510305.1 GENCODE experimental pipeline ENST00000510305.1 alternative 5' UTR ENST00000506420.1 GENCODE experimental pipeline ENST00000394228.1 alternative 5' UTR ENST00000505036.1 alternative 5' UTR ENST00000394223.1 alternative 5' UTR ENST00000406354.1 GENCODE experimental pipeline ENST00000338517.4 alternative 5' UTR ENST00000506322.1 alternative 5' UTR ENST00000506597.1 NP_001147024 ENST00000502535.1 alternative 5' UTR ENST00000509477.1 alternative 5' UTR ENST00000513018.1 88679 88624 ENST00000503109.2 not organism-supported ENST00000515402.1 GENCODE experimental pipeline ENST00000507667.1 alternative 5' UTR ENST00000502397.1 alternative 5' UTR ENST00000503844.1 GENCODE experimental pipeline ENST00000506101.1 GENCODE experimental pipeline ENST00000512809.1 alternative 5' UTR ENST00000503649.1 alternative 5' UTR ENST00000512738.1 alternative 5' UTR ENST00000514347.1 GENCODE experimental pipeline ENST00000296545.7 alternative 5' UTR ENST00000514653.1 NP_751915.1 ENST00000514653.1 NMD exception ENST00000514653.1 PMID:8977197 ENST00000529613.1 alternative 5' UTR ENST00000477265.1 NMD exception ENST00000477265.1 PMID:8977197 ENST00000477265.1 alternative 5' UTR ENST00000507826.1 GENCODE experimental pipeline ENST00000507486.1 GENCODE experimental pipeline ENST00000515366.1 alternative 5' UTR ENST00000509992.1 GENCODE experimental pipeline ENST00000329798.5 GENCODE experimental pipeline ENST00000437468.2 alternative 3' UTR ENST00000506982.1 non canonical TEC ENST00000504951.2 non canonical genome sequence error ENST00000510196.2 non canonical genome sequence error ENST00000507656.1 alternative 5' UTR ENST00000451299.2 alternative 5' UTR ENST00000514390.1 alternative 5' UTR ENST00000513054.1 alternative 5' UTR ENST00000504721.1 alternative 5' UTR ENST00000502847.1 alternative 5' UTR ENST00000502586.1 alternative 5' UTR ENST00000455611.2 not organism-supported ENST00000454497.2 NP_001096123.1 ENST00000509620.2 NP_059963.1 ENST00000504501.1 alternative 5' UTR ENST00000302085.4 alternative 5' UTR ENST00000502342.1 GENCODE experimental pipeline ENST00000503462.1 GENCODE experimental pipeline ENST00000511659.1 GENCODE experimental pipeline ENST00000502781.1 alternative 5' UTR ENST00000510076.1 GENCODE experimental pipeline ENST00000358102.3 alternative 5' UTR ENST00000512865.1 alternative 5' UTR ENST00000342437.4 PMID 11518808, Zennaro et al. (2001) Mol Endocrinol 9 ENST00000342437.4 NMD exception ENST00000511528.1 not organism-supported ENST00000503313.1 GENCODE experimental pipeline ENST00000514843.1 GENCODE experimental pipeline ENST00000504874.1 GENCODE experimental pipeline ENST00000510413.1 GENCODE experimental pipeline ENST00000508606.1 GENCODE experimental pipeline ENST00000502839.1 GENCODE experimental pipeline ENST00000509736.1 GENCODE experimental pipeline ENST00000508847.1 GENCODE experimental pipeline ENST00000515812.1 GENCODE experimental pipeline ENST00000513617.1 GENCODE experimental pipeline ENST00000515805.1 GENCODE experimental pipeline ENST00000510416.1 GENCODE experimental pipeline ENST00000504957.1 GENCODE experimental pipeline ENST00000504785.1 GENCODE experimental pipeline ENST00000491446.1 GENCODE experimental pipeline ENST00000441616.1 alternative 5' UTR ENST00000496978.1 GENCODE experimental pipeline ENST00000338700.5 NP_056086.2 ENST00000502281.1 GENCODE experimental pipeline ENST00000433687.1 GENCODE experimental pipeline ENST00000508731.1 GENCODE experimental pipeline ENST00000508731.1 alternative 5' UTR ENST00000504860.1 GENCODE experimental pipeline ENST00000504860.1 alternative 5' UTR ENST00000409959.3 NP_056011.3 ENST00000347063.4 non canonical TEC ENST00000509493.1 GENCODE experimental pipeline ENST00000502525.1 alternative 5' UTR ENST00000336356.3 alternative 5' UTR ENST00000510397.1 GENCODE experimental pipeline ENST00000512640.1 alternative 5' UTR ENST00000508265.1 GENCODE experimental pipeline ENST00000506455.1 alternative 5' UTR ENST00000511108.1 alternative 5' UTR ENST00000455639.2 alternative 5' UTR ENST00000509901.1 not organism-supported ENST00000296518.7 alternative 5' UTR ENST00000505154.1 alternative 5' UTR ENST00000502959.1 GENCODE experimental pipeline ENST00000505764.1 GENCODE experimental pipeline ENST00000507146.1 GENCODE experimental pipeline ENST00000503520.1 GENCODE experimental pipeline ENST00000509282.1 alternative 5' UTR ENST00000512774.1 alternative 5' UTR ENST00000507898.1 alternative 5' UTR ENST00000509417.1 alternative 5' UTR ENST00000506284.1 alternative 5' UTR ENST00000323661.6 alternative 5' UTR ENST00000505888.1 alternative 5' UTR ENST00000296530.6 alternative 5' UTR ENST00000393807.3 corf ENST00000505460.1 alternative 5' UTR ENST00000503227.1 GENCODE experimental pipeline ENST00000507101.1 GENCODE experimental pipeline ENST00000514381.1 GENCODE experimental pipeline ENST00000505049.1 alternative 5' UTR ENST00000505189.1 alternative 5' UTR ENST00000511038.1 alternative 5' UTR ENST00000508243.1 alternative 5' UTR ENST00000512481.1 alternative 5' UTR ENST00000504569.1 alternative 5' UTR ENST00000514558.1 alternative 5' UTR ENST00000503200.1 alternative 5' UTR ENST00000502698.1 alternative 5' UTR ENST00000514971.1 alternative 5' UTR ENST00000472969.1 GENCODE experimental pipeline ENST00000307765.5 NP_067647 ENST00000484785.1 GENCODE experimental pipeline ENST00000508457.1 not organism-supported ENST00000307738.5 GENCODE experimental pipeline ENST00000514565.1 GENCODE experimental pipeline ENST00000502485.1 GENCODE experimental pipeline ENST00000510253.1 GENCODE experimental pipeline ENST00000505026.1 GENCODE experimental pipeline ENST00000502846.1 GENCODE experimental pipeline ENST00000503478.1 GENCODE experimental pipeline ENST00000504790.1 alternative 5' UTR ENST00000515701.1 alternative 5' UTR ENST00000511901.1 alternative 5' UTR ENST00000506953.1 alternative 5' UTR ENST00000509657.1 GENCODE experimental pipeline ENST00000507270.1 alternative 5' UTR ENST00000507119.1 alternative 5' UTR ENST00000508504.1 alternative 5' UTR ENST00000507013.1 alternative 5' UTR ENST00000393766.2 NP_001017369.1 ENST00000505270.1 alternative 5' UTR ENST00000505863.1 GENCODE experimental pipeline ENST00000505696.1 alternative 5' UTR ENST00000514748.1 alternative 5' UTR ENST00000512371.1 alternative 5' UTR ENST00000511948.1 alternative 5' UTR ENST00000513245.1 GENCODE experimental pipeline ENST00000503457.1 GENCODE experimental pipeline ENST00000502315.1 alternative 5' UTR ENST00000510806.1 alternative 5' UTR ENST00000511633.1 alternative 5' UTR ENST00000507142.1 alternative 5' UTR ENST00000510108.1 not organism-supported ENST00000511092.1 alternative 5' UTR ENST00000512813.1 alternative 5' UTR ENST00000509956.1 GENCODE experimental pipeline ENST00000508955.1 GENCODE experimental pipeline ENST00000512698.1 alternative 5' UTR ENST00000502832.1 alternative 5' UTR ENST00000507601.1 GENCODE experimental pipeline ENST00000393702.2 GENCODE experimental pipeline ENST00000504999.1 alternative 5' UTR ENST00000506764.1 alternative 5' UTR ENST00000510306.1 alternative 5' UTR ENST00000337664.4 alternative 5' UTR ENST00000353187.2 alternative 5' UTR ENST00000510340.1 GENCODE experimental pipeline ENST00000507375.1 alternative 5' UTR ENST00000502392.1 alternative 5' UTR ENST00000504509.1 GENCODE experimental pipeline ENST00000512285.1 non=organism_supported ENST00000446922.2 alternative 5' UTR ENST00000438704.2 alternative 5' UTR ENST00000506267.1 alternative 5' UTR ENST00000504618.1 GENCODE experimental pipeline ENST00000504429.1 GENCODE experimental pipeline ENST00000515825.1 GENCODE experimental pipeline ENST00000513696.1 alternative 5' UTR ENST00000513696.1 not organism-supported ENST00000505124.1 alternative 5' UTR ENST00000396791.3 alternative 5' UTR ENST00000514712.1 alternative 5' UTR ENST00000515299.1 alternative 5' UTR ENST00000503053.1 alternative 5' UTR ENST00000503053.1 not organism-supported ENST00000508815.1 GENCODE experimental pipeline ENST00000296521.7 GENCODE experimental pipeline ENST00000422112.2 GENCODE experimental pipeline ENST00000506910.1 GENCODE experimental pipeline ENST00000507483.1 GENCODE experimental pipeline ENST00000505141.1 alternative 5' UTR ENST00000502940.1 alternative 5' UTR ENST00000502305.1 alternative 5' UTR ENST00000514159.1 alternative 5' UTR ENST00000506984.1 GENCODE experimental pipeline ENST00000280187.7 alternative 5' UTR ENST00000502754.1 alternative 5' UTR ENST00000512509.1 GENCODE experimental pipeline ENST00000512509.1 alternative 5' UTR ENST00000505375.1 alternative 5' UTR ENST00000505304.1 GENCODE experimental pipeline ENST00000503563.1 alternative 5' UTR ENST00000508596.1 GENCODE experimental pipeline ENST00000507824.1 GENCODE experimental pipeline ENST00000505894.1 GENCODE experimental pipeline ENST00000512254.1 GENCODE experimental pipeline ENST00000505299.1 alternative 5' UTR ENST00000508790.1 GENCODE experimental pipeline ENST00000507011.1 GENCODE experimental pipeline ENST00000512547.1 GENCODE experimental pipeline ENST00000510211.1 GENCODE experimental pipeline ENST00000512480.1 alternative 5' UTR ENST00000510370.1 alternative 5' UTR ENST00000503182.1 alternative 5' UTR ENST00000510307.1 alternative 5' UTR ENST00000512766.1 alternative 5' UTR ENST00000514754.1 alternative 5' UTR ENST00000503820.1 alternative 5' UTR ENST00000503988.1 alternative 5' UTR ENST00000508994.1 alternative 5' UTR ENST00000403733.3 NP_079225 ENST00000457303.3 GENCODE experimental pipeline ENST00000513034.1 GENCODE experimental pipeline ENST00000505025.1 GENCODE experimental pipeline ENST00000512353.1 GENCODE experimental pipeline ENST00000511465.1 GENCODE experimental pipeline ENST00000505067.1 GENCODE experimental pipeline ENST00000507523.1 alternative 5' UTR ENST00000510814.1 alternative 5' UTR ENST00000506230.1 alternative 5' UTR ENST00000505316.1 alternative 5' UTR ENST00000509274.1 alternative 5' UTR ENST00000504340.1 GENCODE experimental pipeline ENST00000393585.2 alternative 5' UTR ENST00000523916.1 alternative 5' UTR ENST00000517513.1 alternative 5' UTR ENST00000393588.4 alternative 5' UTR ENST00000447121.2 alternative 5' UTR ENST00000508001.1 GENCODE experimental pipeline ENST00000515030.1 alternative 5' UTR ENST00000506733.1 alternative 5' UTR ENST00000504342.1 alternative 5' UTR ENST00000513317.1 GENCODE experimental pipeline ENST00000513317.1 alternative 5' UTR ENST00000508020.1 GENCODE experimental pipeline ENST00000506479.1 GENCODE experimental pipeline ENST00000507183.1 GENCODE experimental pipeline ENST00000505053.1 GENCODE experimental pipeline ENST00000514798.1 GENCODE experimental pipeline ENST00000503223.1 alternative 5' UTR ENST00000264694.8 alternative 5' UTR ENST00000505916.1 alternative 5' UTR ENST00000511404.1 alternative 5' UTR ENST00000507753.1 alternative 5' UTR ENST00000511485.1 GENCODE experimental pipeline ENST00000501066.2 alternative 5' UTR ENST00000511138.1 alternative 5' UTR ENST00000511581.1 alternative 5' UTR ENST00000512770.1 alternative 5' UTR ENST00000510617.1 not organism-supported ENST00000487184.1 GENCODE experimental pipeline ENST00000445343.1 alternative 5' UTR ENST00000439914.1 alternative 5' UTR ENST00000444771.1 alternative 5' UTR ENST00000450341.1 alternative 5' UTR ENST00000445115.1 alternative 5' UTR ENST00000457247.1 alternative 5' UTR ENST00000456596.1 alternative 5' UTR ENST00000414724.1 alternative 5' UTR ENST00000393523.2 alternative 5' UTR ENST00000415274.1 alternative 5' UTR ENST00000456060.1 alternative 5' UTR ENST00000476878.1 GENCODE experimental pipeline ENST00000447277.1 GENCODE experimental pipeline ENST00000456728.1 GENCODE experimental pipeline ENST00000504367.1 GENCODE experimental pipeline ENST00000508051.1 GENCODE experimental pipeline ENST00000503432.1 alternative 5' UTR ENST00000508379.1 alternative 5' UTR ENST00000515078.1 alternative 5' UTR ENST00000504330.1 alternative 5' UTR ENST00000510790.1 alternative 5' UTR ENST00000513212.1 alternative 5' UTR ENST00000509574.1 alternative 5' UTR ENST00000502970.1 GENCODE experimental pipeline ENST00000511608.1 GENCODE experimental pipeline ENST00000428196.1 alternative 5' UTR ENST00000452239.1 GENCODE experimental pipeline ENST00000264691.3 GENCODE experimental pipeline ENST00000507105.1 GENCODE experimental pipeline ENST00000507662.1 GENCODE experimental pipeline ENST00000509647.1 alternative 5' UTR ENST00000503037.1 GENCODE experimental pipeline ENST00000507776.1 GENCODE experimental pipeline ENST00000503637.1 GENCODE experimental pipeline ENST00000515222.1 GENCODE experimental pipeline ENST00000509058.1 GENCODE experimental pipeline ENST00000515660.1 GENCODE experimental pipeline ENST00000514767.1 GENCODE experimental pipeline ENST00000509524.1 alternative 5' UTR ENST00000394461.2 GENCODE experimental pipeline ENST00000505178.1 GENCODE experimental pipeline ENST00000504165.1 GENCODE experimental pipeline ENST00000506276.1 GENCODE experimental pipeline ENST00000503609.1 GENCODE experimental pipeline ENST00000512035.1 GENCODE experimental pipeline ENST00000441693.2 alternative 5' UTR ENST00000512642.1 GENCODE experimental pipeline ENST00000502359.1 GENCODE experimental pipeline ENST00000511487.1 GENCODE experimental pipeline ENST00000510441.1 GENCODE experimental pipeline ENST00000508022.1 alternative 5' UTR ENST00000509294.1 GENCODE experimental pipeline ENST00000515085.1 GENCODE experimental pipeline ENST00000499639.2 GENCODE experimental pipeline ENST00000508859.2 confirm experimentally ENST00000467963.1 NP_076413.3 ENST00000513435.1 GENCODE experimental pipeline ENST00000508430.1 GENCODE experimental pipeline ENST00000507989.1 GENCODE experimental pipeline ENST00000511936.1 GENCODE experimental pipeline ENST00000264930.5 non canonical TEC ENST00000512572.1 GENCODE experimental pipeline ENST00000507195.1 \ ENST00000504989.1 GENCODE experimental pipeline ENST00000523692.1 alternative 5' UTR ENST00000503067.1 GENCODE experimental pipeline ENST00000505818.1 alternative 5' UTR ENST00000382647.6 alternative 5' UTR ENST00000508987.1 alternative 5' UTR ENST00000510999.1 alternative 5' UTR ENST00000505790.1 alternative 5' UTR ENST00000505790.1 not organism-supported ENST00000513692.1 alternative 5' UTR ENST00000511693.1 GENCODE experimental pipeline ENST00000513419.1 GENCODE experimental pipeline ENST00000511698.1 GENCODE experimental pipeline ENST00000302057.5 alternative 3' UTR ENST00000505778.1 alternative 3' UTR ENST00000515086.1 GENCODE experimental pipeline ENST00000512521.1 GENCODE experimental pipeline ENST00000513859.1 GENCODE experimental pipeline ENST00000503415.1 GENCODE experimental pipeline ENST00000513925.1 GENCODE experimental pipeline ENST00000511721.1 GENCODE experimental pipeline ENST00000511514.1 GENCODE experimental pipeline ENST00000507444.1 GENCODE experimental pipeline ENST00000506139.1 GENCODE experimental pipeline ENST00000503989.1 GENCODE experimental pipeline ENST00000514788.1 GENCODE experimental pipeline ENST00000515721.1 alternative 5' UTR ENST00000510622.1 GENCODE experimental pipeline ENST00000512746.1 GENCODE experimental pipeline ENST00000504494.1 GENCODE experimental pipeline ENST00000513219.1 GENCODE experimental pipeline ENST00000513693.1 GENCODE experimental pipeline ENST00000513693.1 not organism-supported ENST00000509627.1 GENCODE experimental pipeline ENST00000514220.1 GENCODE experimental pipeline ENST00000502550.1 alternative 5' UTR ENST00000506877.1 alternative 5' UTR ENST00000512217.1 alternative 5' UTR ENST00000506115.1 GENCODE experimental pipeline ENST00000504695.1 alternative 5' UTR ENST00000502001.2 GENCODE experimental pipeline ENST00000513968.1 alternative 5' UTR ENST00000515377.1 GENCODE experimental pipeline ENST00000504182.1 GENCODE experimental pipeline ENST00000506299.1 GENCODE experimental pipeline ENST00000509915.1 GENCODE experimental pipeline ENST00000503804.1 alternative 5' UTR ENST00000510562.1 GENCODE experimental pipeline ENST00000506021.1 GENCODE experimental pipeline ENST00000506304.1 GENCODE experimental pipeline ENST00000510546.1 GENCODE experimental pipeline ENST00000503953.1 GENCODE experimental pipeline ENST00000513598.1 alternative 5' UTR ENST00000504001.2 not organism-supported ENST00000274217.3 FLJ11127 ENST00000513825.1 novel transcript ENST00000506258.1 GENCODE experimental pipeline ENST00000506258.1 putative novel transcript ENST00000505140.1 not organism-supported ENST00000502680.1 GENCODE experimental pipeline ENST00000502834.1 GENCODE experimental pipeline ENST00000505695.1 alternative 5' UTR ENST00000507288.1 GENCODE experimental pipeline ENST00000399760.2 FLJ34047 ENST00000511182.1 GENCODE experimental pipeline ENST00000507958.1 alternative 5' UTR ENST00000515257.1 not organism-supported ENST00000504376.1 alternative 5' UTR ENST00000507674.1 GENCODE experimental pipeline ENST00000502755.1 alternative 5' UTR ENST00000510391.1 GENCODE experimental pipeline ENST00000513289.1 alternative 5' UTR ENST00000511822.1 alternative 5' UTR ENST00000519101.1 not organism-supported ENST00000510178.1 tandem repeats in the fourth exon ENST00000507438.1 alternative 5' UTR ENST00000325366.9 FLJ11193 ENST00000513910.1 alternative 5' UTR ENST00000509750.1 GENCODE experimental pipeline ENST00000506237.1 alternative 5' UTR ENST00000512913.1 alternative 5' UTR ENST00000515355.1 alternative 5' UTR ENST00000502897.1 alternative 5' UTR ENST00000510442.1 alternative 5' UTR ENST00000415167.2 NP_000899.1 ENST00000507141.1 GENCODE experimental pipeline ENST00000505339.1 GENCODE experimental pipeline ENST00000511054.1 GENCODE experimental pipeline ENST00000502553.1 alternative 5' UTR ENST00000514259.1 alternative 5' UTR ENST00000502508.1 not organism-supported ENST00000455217.2 GENCODE experimental pipeline ENST00000504582.1 not organism-supported ENST00000514195.1 non canonical TEC ENST00000502637.1 GENCODE experimental pipeline ENST00000265109.3 alternative 5' UTR ENST00000514527.1 alternative 5' UTR ENST00000513974.1 alternative 5' UTR ENST00000514873.1 alternative 5' UTR ENST00000503673.1 alternative 5' UTR ENST00000504052.1 alternative 5' UTR ENST00000512305.1 alternative 5' UTR ENST00000514036.1 alternative 5' UTR ENST00000508315.1 alternative 5' UTR ENST00000512625.1 alternative 5' UTR ENST00000341754.4 alternative 5' UTR ENST00000514206.1 alternative 5' UTR ENST00000509839.1 alternative 5' UTR ENST00000503330.1 alternative 5' UTR ENST00000504500.1 alternative 5' UTR ENST00000515839.1 alternative 5' UTR ENST00000282469.6 FLJ23577 ENST00000440995.2 GENCODE experimental pipeline ENST00000504054.1 GENCODE experimental pipeline ENST00000506526.1 alternative 5' UTR ENST00000511031.1 GENCODE experimental pipeline ENST00000515665.1 alternative 5' UTR ENST00000513623.1 alternative 5' UTR ENST00000503269.1 GENCODE experimental pipeline ENST00000507113.1 GENCODE experimental pipeline ENST00000513300.1 GENCODE experimental pipeline ENST00000515131.1 alternative 5' UTR ENST00000503535.1 Final 58 bp of EST evidence does not align to this or any region of the genome ENST00000397338.1 FLJ30596 ENST00000506945.1 GENCODE experimental pipeline ENST00000506945.1 alternative 5' UTR ENST00000511088.1 GENCODE experimental pipeline ENST00000511088.1 alternative 5' UTR ENST00000296604.3 FLJ25422 ENST00000505865.1 alternative 5' UTR ENST00000513903.1 alternative 5' UTR ENST00000506725.1 alternative 5' UTR ENST00000505202.1 alternative 5' UTR ENST00000513646.1 alternative 5' UTR ENST00000505998.1 not organism-supported ENST00000508244.1 NP_075561.3 ENST00000508244.1 not organism-supported ENST00000502533.1 not organism-supported ENST00000504564.1 GENCODE experimental pipeline ENST00000515058.1 CCDS3923.1 ENST00000502572.1 alternative 5' UTR ENST00000510177.1 alternative 5' UTR ENST00000508853.1 GENCODE experimental pipeline ENST00000506135.1 alternative 5' UTR ENST00000514476.1 alternative 5' UTR ENST00000510137.1 GENCODE experimental pipeline ENST00000453190.2 alternative 5' UTR ENST00000506990.1 alternative 5' UTR ENST00000511561.1 alternative 5' UTR ENST00000514586.1 GENCODE experimental pipeline ENST00000515010.1 alternative 5' UTR ENST00000505428.1 alternative 5' UTR ENST00000510188.1 alternative 5' UTR ENST00000512138.1 alternative 5' UTR ENST00000506557.1 alternative 5' UTR ENST00000509072.1 alternative 5' UTR ENST00000504542.1 alternative 5' UTR ENST00000511792.1 alternative 5' UTR ENST00000503513.1 alternative 5' UTR ENST00000515700.1 alternative 5' UTR ENST00000508437.1 GENCODE experimental pipeline ENST00000511787.1 GENCODE experimental pipeline ENST00000509877.1 novel protein ENST00000381677.3 GENCODE experimental pipeline ENST00000489457.1 GENCODE experimental pipeline ENST00000337836.5 alternative 5' UTR ENST00000263413.3 gomi ENST00000417809.1 GENCODE experimental pipeline ENST00000417809.1 alternative 5' UTR ENST00000433294.1 GENCODE experimental pipeline ENST00000433294.1 alternative 5' UTR ENST00000508458.1 GENCODE experimental pipeline ENST00000511224.1 alternative 5' UTR ENST00000506577.1 alternative 5' UTR ENST00000514218.1 alternative 5' UTR ENST00000510965.1 alternative 5' UTR ENST00000515626.1 alternative 5' UTR ENST00000509036.1 GENCODE experimental pipeline ENST00000506791.1 GENCODE experimental pipeline ENST00000507393.1 GENCODE experimental pipeline ENST00000515326.1 alternative 5' UTR ENST00000508259.1 alternative 5' UTR ENST00000505606.1 alternative 5' UTR ENST00000509634.1 alternative 5' UTR ENST00000509341.1 alternative 5' UTR ENST00000512796.1 alternative 5' UTR ENST00000511774.1 alternative 5' UTR ENST00000513525.1 GENCODE experimental pipeline ENST00000500337.2 alternative 5' UTR ENST00000512085.1 alternative 5' UTR ENST00000506860.1 alternative 5' UTR ENST00000503655.1 not organism-supported ENST00000509489.1 GENCODE experimental pipeline ENST00000338972.4 NP_899152.1 ENST00000338972.4 CCDS3948.1 ENST00000511321.1 alternative 5' UTR ENST00000508537.1 alternative 5' UTR ENST00000515338.1 alternative 5' UTR ENST00000515338.1 not organism-supported ENST00000506247.1 GENCODE experimental pipeline ENST00000515466.1 GENCODE experimental pipeline ENST00000505678.1 alternative 5' UTR ENST00000505678.1 not organism-supported ENST00000512422.1 alternative 5' UTR ENST00000344920.4 alternative 5' UTR ENST00000512996.1 not organism-supported ENST00000515208.1 GENCODE experimental pipeline ENST00000515208.1 alternative 5' UTR ENST00000503651.1 GENCODE experimental pipeline ENST00000513107.1 alternative 5' UTR ENST00000510758.1 GENCODE experimental pipeline ENST00000505050.1 GENCODE experimental pipeline ENST00000510987.1 GENCODE experimental pipeline ENST00000514111.1 GENCODE experimental pipeline ENST00000515166.1 not organism-supported ENST00000506534.2 GENCODE experimental pipeline ENST00000511384.1 not organism-supported ENST00000505475.2 GENCODE experimental pipeline ENST00000503810.1 not organism-supported ENST00000361377.3 alternative 3' UTR ENST00000361377.3 NMD exception ENST00000510818.1 NMD exception ENST00000510818.1 not organism-supported ENST00000450852.2 NMD exception ENST00000508922.1 NMD exception ENST00000527216.1 alternative 5' UTR ENST00000511025.1 No specific mRNA/EST support for variant. Published in PubMed: 3380788. All canonical splice sites gives object enough credence to be constructed ENST00000512618.1 GENCODE experimental pipeline ENST00000504609.2 GENCODE experimental pipeline ENST00000371487.3 GENCODE experimental pipeline ENST00000296733.1 FLJ37927 ENST00000515370.1 GENCODE experimental pipeline ENST00000396865.2 alternative 5' UTR ENST00000512595.1 GENCODE experimental pipeline ENST00000511233.1 not organism-supported ENST00000503817.1 GENCODE experimental pipeline ENST00000503891.1 alternative 5' UTR ENST00000513993.1 alternative 5' UTR ENST00000505563.1 not organism-supported ENST00000506624.1 alternative 5' UTR ENST00000507109.1 alternative 5' UTR ENST00000513275.1 akternative_5'_UTR ENST00000503129.1 not organism-supported ENST00000381293.2 GENCODE experimental pipeline ENST00000522633.2 NMD exception ENST00000504958.1 not organism-supported ENST00000504349.1 GENCODE experimental pipeline ENST00000504349.1 not organism-supported ENST00000506836.1 GENCODE experimental pipeline ENST00000511661.1 GENCODE experimental pipeline ENST00000438651.1 GENCODE experimental pipeline ENST00000431789.1 GENCODE experimental pipeline ENST00000438117.1 GENCODE experimental pipeline ENST00000423328.1 GENCODE experimental pipeline ENST00000409421.1 GENCODE experimental pipeline ENST00000502276.1 alternative 5' UTR ENST00000396776.2 FLJ33641 ENST00000511930.1 alternative 5' UTR ENST00000504333.1 GENCODE experimental pipeline ENST00000505453.1 alternative 5' UTR ENST00000505507.2 alternative 5' UTR ENST00000514552.1 alternative 5' UTR ENST00000453022.2 NP_001138680.1 ENST00000505959.1 GENCODE experimental pipeline ENST00000507047.1 alternative 5' UTR ENST00000511799.1 alternative 5' UTR ENST00000339020.3 alternative 5' UTR ENST00000503882.1 GENCODE experimental pipeline ENST00000511474.1 GENCODE experimental pipeline ENST00000381103.2 GENCODE experimental pipeline ENST00000512006.1 GENCODE experimental pipeline ENST00000514647.1 alternative 5' UTR ENST00000505902.1 alternative 5' UTR ENST00000325324.6 FLJ10834 ENST00000506200.1 alternative 5' UTR ENST00000409296.3 CCDS47217.1 ENST00000409296.3 FLJ59791 ENST00000409296.3 NP_001128251.1 ENST00000413749.1 not organism-supported ENST00000409534.1 DKFZp686E10165 ENST00000409534.1 GENCODE experimental pipeline ENST00000334994.5 CCDS47218.1 ENST00000491184.2 GENCODE experimental pipeline ENST00000506598.1 alternative 5' UTR ENST00000504296.1 alternative 5' UTR ENST00000513458.3 NP_776190.1 ENST00000508024.1 GENCODE experimental pipeline ENST00000514814.1 alternative 5' UTR ENST00000502997.1 alternative 5' UTR ENST00000508311.1 5' 69 bp of evidence does not align to this or any region of the human reference genome ENST00000506400.1 GENCODE experimental pipeline ENST00000513794.1 alternative 5' UTR ENST00000506816.1 alternative 5' UTR ENST00000511299.1 GENCODE experimental pipeline ENST00000515595.1 GENCODE experimental pipeline ENST00000521691.1 alternative 5' UTR ENST00000520953.1 not organism-supported ENST00000508486.2 GENCODE experimental pipeline ENST00000403625.1 not organism-supported ENST00000436277.1 alternative 5' UTR ENST00000451496.1 GENCODE experimental pipeline ENST00000515077.1 GENCODE experimental pipeline ENST00000507298.1 GENCODE experimental pipeline ENST00000521657.1 alternative 5' UTR ENST00000521657.1 not organism-supported ENST00000520675.1 not organism-supported ENST00000523807.1 alternative 5' UTR ENST00000515199.1 GENCODE experimental pipeline ENST00000513197.1 GENCODE experimental pipeline ENST00000511158.1 GENCODE experimental pipeline ENST00000508407.1 GENCODE experimental pipeline ENST00000514676.1 not organism-supported ENST00000508726.1 not organism-supported ENST00000383374.2 not organism-supported ENST00000502819.1 not organism-supported ENST00000380818.3 NP_001015891.1 ENST00000512561.1 not organism-supported ENST00000506736.1 alternative 5' UTR ENST00000217893.5 alternative 5' UTR ENST00000503245.1 alternative 5' UTR ENST00000503245.1 not organism-supported ENST00000509462.1 alternative 5' UTR ENST00000504109.1 alternative 5' UTR ENST00000512152.1 alternative 5' UTR ENST00000508954.1 alternative 5' UTR ENST00000361732.2 alternative 5' UTR ENST00000507927.1 alternative 5' UTR ENST00000354868.5 alternative 5' UTR ENST00000521422.1 NP_579918 ENST00000354312.3 alternative 5' UTR ENST00000345306.6 alternative 5' UTR ENST00000506564.1 alternative 5' UTR ENST00000305138.4 alternative 5' UTR ENST00000513214.1 GENCODE experimental pipeline ENST00000515844.1 alternative 5' UTR ENST00000512803.1 alternative 5' UTR ENST00000436532.2 GENCODE experimental pipeline ENST00000355237.2 alternative 5' UTR ENST00000396442.2 alternative 5' UTR ENST00000510979.1 alternative 5' UTR ENST00000380729.3 alternative 5' UTR ENST00000511162.1 alternative 5' UTR ENST00000512868.2 alternative 5' UTR ENST00000523981.1 NP_075043.1 ENST00000330280.6 alternative 5' UTR ENST00000522323.1 alternative 5' UTR ENST00000508157.3 GENCODE experimental pipeline ENST00000512218.2 GENCODE experimental pipeline ENST00000505435.3 GENCODE experimental pipeline ENST00000504492.1 GENCODE experimental pipeline ENST00000506351.2 NP_694858.1 ENST00000507345.1 not organism-supported ENST00000296776.5 MGC13034 ENST00000514505.1 not organism-supported ENST00000507081.1 GENCODE experimental pipeline ENST00000507081.1 not organism-supported ENST00000509708.1 GENCODE experimental pipeline ENST00000509708.1 not organism-supported ENST00000504641.1 GENCODE experimental pipeline ENST00000513824.1 alternative 5' UTR ENST00000509005.1 GENCODE experimental pipeline ENST00000508686.1 alternative 5' UTR ENST00000509848.1 alternative 5' UTR ENST00000506717.1 GENCODE experimental pipeline ENST00000507890.1 GENCODE experimental pipeline ENST00000512458.1 GENCODE experimental pipeline ENST00000506612.1 GENCODE experimental pipeline ENST00000510316.1 GENCODE experimental pipeline ENST00000509284.1 GENCODE experimental pipeline ENST00000508331.1 alternative 5' UTR ENST00000509127.1 alternative 5' UTR ENST00000506778.1 GENCODE experimental pipeline ENST00000514215.1 alternative 5' UTR ENST00000510496.1 GENCODE experimental pipeline ENST00000510609.1 alternative 5' UTR ENST00000513277.1 alternative 5' UTR ENST00000514200.1 alternative 5' UTR ENST00000506954.1 alternative 5' UTR ENST00000504022.1 not organism-supported ENST00000510320.1 gene fragment CTD-2006B8.2-001 and CTD-2006B8.2-003 are part of the same gene; the exact exon structure is yet to be determined ENST00000506364.1 gene fragment CTD-2006B8.2-001 and CTD-2006B8.2-003 are part of the same gene; the exact exon structure is yet to be determined ENST00000501886.2 GENCODE experimental pipeline ENST00000511206.1 alternative 5' UTR ENST00000507942.1 alternative 5' UTR ENST00000442032.2 alternative 5' UTR ENST00000509085.1 GENCODE experimental pipeline ENST00000511986.1 GENCODE experimental pipeline ENST00000357457.3 alternative 3' UTR ENST00000380494.4 NP_001123577.1 ENST00000508809.1 alternative 3' UTR ENST00000506928.1 confirm experimentally ENST00000506928.1 non canonical other ENST00000506928.1 not organism-supported ENST00000514296.1 alternative 5' UTR ENST00000504514.1 confirm experimentally ENST00000514838.1 GENCODE experimental pipeline ENST00000514838.1 not organism-supported ENST00000503835.1 alternative 5' UTR ENST00000502826.1 alternative 5' UTR ENST00000506164.1 alternative 5' UTR ENST00000503652.1 GENCODE experimental pipeline ENST00000514579.1 GENCODE experimental pipeline ENST00000504899.1 GENCODE experimental pipeline ENST00000317593.4 alternative 3' UTR ENST00000317593.4 alternative 5' UTR ENST00000511587.1 alternative 5' UTR ENST00000508401.1 GENCODE experimental pipeline ENST00000502945.1 alternative 5' UTR ENST00000515253.1 GENCODE experimental pipeline ENST00000339292.4 suspected genomic sequence error affecting CDS in exon 7 ENST00000515007.1 alternative 5' UTR ENST00000521117.1 alternative 5' UTR ENST00000511733.1 GENCODE experimental pipeline ENST00000511881.1 alternative 5' UTR ENST00000510158.1 alternative 5' UTR ENST00000505560.1 alternative 5' UTR ENST00000508916.1 alternative 5' UTR ENST00000515871.1 GENCODE experimental pipeline ENST00000505337.1 alternative 3' UTR ENST00000265081.6 non canonical conserved ENST00000511719.1 alternative 5' UTR ENST00000424301.2 alternative 5' UTR ENST00000254037.2 alternative 5' UTR ENST00000380199.5 alternative 5' UTR ENST00000438268.2 alternative 5' UTR ENST00000355178.4 alternative 5' UTR ENST00000510085.1 alternative 5' UTR ENST00000513443.1 GENCODE experimental pipeline ENST00000510019.1 GENCODE experimental pipeline ENST00000504916.1 GENCODE experimental pipeline ENST00000511450.1 not organism-supported ENST00000511817.1 alternative 5' UTR ENST00000512090.1 GENCODE experimental pipeline ENST00000503117.1 NAGNAG splice site ENST00000514416.1 not organism-supported ENST00000296591.5 alternative 5' UTR ENST00000509578.1 alternative 3' UTR ENST00000504878.1 GENCODE experimental pipeline ENST00000504287.1 GENCODE experimental pipeline ENST00000511417.1 GENCODE experimental pipeline ENST00000296595.6 MGC33214 ENST00000512429.1 GENCODE experimental pipeline ENST00000424173.2 NP_001124477.1 ENST00000437473.2 alternative 5' UTR ENST00000506554.1 GENCODE experimental pipeline ENST00000506554.1 not organism-supported ENST00000513252.1 alternative 5' UTR ENST00000506716.1 alternative 5' UTR ENST00000507984.1 alternative 5' UTR ENST00000502983.1 alternative 5' UTR ENST00000508610.1 alternative 5' UTR ENST00000502831.1 alternative 5' UTR ENST00000503075.1 alternative 5' UTR ENST00000509373.1 alternative 5' UTR ENST00000316610.6 LOC153364 ENST00000505345.1 GENCODE experimental pipeline ENST00000500869.2 GENCODE experimental pipeline ENST00000512210.1 non canonical TEC ENST00000506162.1 GENCODE experimental pipeline ENST00000395965.3 DKFZp564D172 ENST00000502784.1 NM_199185.2 ENST00000505668.1 XR_040970.1 ENST00000513200.2 non-canonical splice donor site between exons 8 and 9 ENST00000513200.2 MGC34713 ENST00000504117.1 non-canonical splice sites between exons 2 and 3 ENST00000504099.1 alternative 5' UTR ENST00000506568.3 not organism-supported ENST00000514780.1 GENCODE experimental pipeline ENST00000283357.5 non-canonical splice donor site between exons 2 and 3 ENST00000507832.1 non-canonical splice donor site between exons 1 and 2 ENST00000515176.1 not organism-supported ENST00000513823.1 alternative 5' UTR ENST00000504763.1 GENCODE experimental pipeline ENST00000511684.1 alternative 5' UTR ENST00000380005.4 CCDS47248.1 ENST00000513950.1 GENCODE experimental pipeline ENST00000513950.1 not organism-supported ENST00000502541.1 not organism-supported ENST00000504179.1 not organism-supported ENST00000508780.1 alternative 3' UTR ENST00000379979.4 alternative 3' UTR ENST00000505427.1 alternative 3' UTR ENST00000512469.2 alternative 3' UTR ENST00000357880.3 alternative 5' UTR ENST00000503091.1 GENCODE experimental pipeline ENST00000509190.1 alternative 5' UTR ENST00000509602.1 GENCODE experimental pipeline ENST00000338252.3 P20810-2.4 ENST00000508830.1 NP_001741.4 ENST00000395812.2 NP_001035905.1 ENST00000510756.1 NP_001035907.1 ENST00000309190.5 P20810-4.4 ENST00000510156.1 alternative 5' UTR ENST00000508117.1 non-canonical splice sites between exons 5 and 6 ENST00000511782.1 alternative 5' UTR ENST00000348386.3 P20810-3.4 ENST00000508579.1 GENCODE experimental pipeline ENST00000503828.1 alternative 5' UTR ENST00000502568.1 GENCODE experimental pipeline ENST00000512852.1 GENCODE experimental pipeline ENST00000514604.1 not organism-supported ENST00000507154.1 alternative 5' UTR ENST00000512856.1 GENCODE experimental pipeline ENST00000510373.1 alternative 5' UTR ENST00000508077.1 GENCODE experimental pipeline ENST00000395784.1 GENCODE experimental pipeline ENST00000509481.1 GENCODE experimental pipeline ENST00000512378.1 not organism-supported ENST00000511293.1 GENCODE experimental pipeline ENST00000504578.1 GENCODE experimental pipeline ENST00000505796.1 GENCODE experimental pipeline ENST00000308234.7 NP_001012779.2 ENST00000284049.3 NP_001261.2 ENST00000510302.1 GENCODE experimental pipeline ENST00000511468.1 GENCODE experimental pipeline ENST00000451528.2 NP_778222.1 ENST00000511588.1 alternative 3' UTR ENST00000379807.3 alternative 3' UTR ENST00000505654.1 alternative 5' UTR ENST00000512073.1 alternative 5' UTR ENST00000511839.1 alternative 5' UTR ENST00000511477.1 alternative 5' UTR ENST00000506006.1 alternative 5' UTR ENST00000509832.1 alternative 5' UTR ENST00000438793.3 NP_001170777.1 ENST00000304400.7 NP_000910.2 ENST00000379799.3 non-organism_supported ENST00000504691.1 GENCODE experimental pipeline ENST00000515845.1 alternative 5' UTR ENST00000507921.1 GENCODE experimental pipeline ENST00000319933.2 LOC90355 ENST00000515669.1 alternative 5' UTR ENST00000510890.1 alternative 5' UTR ENST00000505824.1 GENCODE experimental pipeline ENST00000509503.1 GENCODE experimental pipeline ENST00000515363.2 not organism-supported ENST00000511883.2 alternative 5' UTR ENST00000515278.2 alternative 5' UTR ENST00000503527.2 GENCODE experimental pipeline ENST00000506890.1 GENCODE experimental pipeline ENST00000513807.1 alternative 5' UTR ENST00000504098.1 alternative 5' UTR ENST00000509432.1 GENCODE experimental pipeline ENST00000513710.2 not organism-supported ENST00000508074.1 alternative 5' UTR ENST00000512453.1 alternative 5' UTR ENST00000512160.1 alternative 3' UTR ENST00000505803.1 alternative 5' UTR ENST00000514515.1 GENCODE experimental pipeline ENST00000257435.7 alternative 5' UTR ENST00000446294.2 alternative 5' UTR ENST00000395634.3 NP_001135947.1 ENST00000450761.2 alternative 5' UTR ENST00000419114.2 alternative 5' UTR ENST00000509427.1 alternative 5' UTR ENST00000453526.2 alternative 5' UTR ENST00000455559.2 alternative 5' UTR ENST00000508870.1 alternative 5' UTR ENST00000513100.1 alternative 5' UTR ENST00000508161.1 alternative 5' UTR ENST00000507032.2 alternative 5' UTR ENST00000261486.5 NP_071423.3 ENST00000509732.1 alternative 5' UTR ENST00000508376.2 alternative 5' UTR ENST00000512211.2 alternative 5' UTR ENST00000520401.1 subject to nonsense-mediated decay ENST00000503445.1 NMD likely if extended ENST00000282999.3 GENCODE experimental pipeline ENST00000512790.1 NMD likely if extended ENST00000513585.1 GENCODE experimental pipeline ENST00000515367.2 not organism-supported ENST00000515883.1 GENCODE experimental pipeline ENST00000503706.1 NP_740721.1 ENST00000510222.1 GENCODE experimental pipeline ENST00000511701.1 GENCODE experimental pipeline ENST00000512261.1 not organism-supported ENST00000513729.1 GENCODE experimental pipeline ENST00000503010.1 GENCODE experimental pipeline ENST00000357872.4 FLJ90650 ENST00000504222.1 GENCODE experimental pipeline ENST00000515539.1 GENCODE experimental pipeline ENST00000510263.1 alternative 5' UTR ENST00000515009.1 alternative 5' UTR ENST00000509665.1 alternative 5' UTR ENST00000503802.1 alternative 5' UTR ENST00000274456.6 NP_001071122.1 ENST00000503646.1 alternative 5' UTR ENST00000515320.1 GENCODE experimental pipeline ENST00000509514.1 GENCODE experimental pipeline ENST00000379551.2 NP_057728.1 ENST00000509923.1 alternative 5' UTR ENST00000504912.1 alternative 5' UTR ENST00000505843.1 alternative 5' UTR ENST00000505209.1 GENCODE experimental pipeline ENST00000514467.1 alternative 5' UTR ENST00000506272.1 alternative 5' UTR ENST00000508681.1 alternative 5' UTR ENST00000514497.1 alternative 5' UTR ENST00000261367.7 GENCODE experimental pipeline ENST00000509652.1 alternative 5' UTR ENST00000505934.1 GENCODE experimental pipeline ENST00000514949.1 GENCODE experimental pipeline ENST00000506996.1 alternative 3' UTR ENST00000506859.1 GENCODE experimental pipeline ENST00000306467.5 FLJ36090 ENST00000508442.2 GENCODE experimental pipeline ENST00000515110.1 GENCODE experimental pipeline ENST00000521364.1 NP_001026982.1 ENST00000502809.1 GENCODE experimental pipeline ENST00000503145.1 GENCODE experimental pipeline ENST00000509799.1 GENCODE experimental pipeline ENST00000509799.1 alternative 5' UTR ENST00000513986.1 GENCODE experimental pipeline ENST00000513986.1 alternative 5' UTR ENST00000409134.3 NP_001173.2 ENST00000357147.3 FLJ27505 ENST00000509185.1 GENCODE experimental pipeline ENST00000503335.2 alternative 5' UTR ENST00000508365.1 alternative 5' UTR ENST00000515002.1 GENCODE experimental pipeline ENST00000395322.3 alternative 5' UTR ENST00000507509.1 GENCODE experimental pipeline ENST00000502468.1 GENCODE experimental pipeline ENST00000395266.1 alternative 5' UTR ENST00000506176.1 alternative 5' UTR ENST00000514194.1 GENCODE experimental pipeline ENST00000502827.1 GENCODE experimental pipeline ENST00000508495.1 GENCODE experimental pipeline ENST00000503291.1 GENCODE experimental pipeline ENST00000513227.1 GENCODE experimental pipeline ENST00000307968.7 NP_001008738.2 ENST00000307954.8 GENCODE experimental pipeline ENST00000379244.1 GENCODE experimental pipeline ENST00000379240.1 GENCODE experimental pipeline ENST00000477640.1 GENCODE experimental pipeline ENST00000424244.1 GENCODE experimental pipeline ENST00000379086.1 variant 4; alternatively spliced in 5' UTR ENST00000166534.4 variant 3; alternatively spliced in 5' UTR ENST00000418373.1 GENCODE experimental pipeline ENST00000453876.1 Added 9/1/07 by jm12 ENST00000461203.1 novel transcript ENST00000407797.1 novel transcript ENST00000464024.1 GENCODE experimental pipeline ENST00000464024.1 novel transcript ENST00000454380.1 GENCODE experimental pipeline ENST00000422204.1 GENCODE experimental pipeline ENST00000443093.1 GENCODE experimental pipeline ENST00000439555.1 GENCODE experimental pipeline ENST00000416135.1 GENCODE experimental pipeline ENST00000533482.1 isoform 2 ENST00000265335.6 isoform 1 ENST00000453394.1 GENCODE experimental pipeline ENST00000423956.1 not organism-supported ENST00000434288.1 GENCODE experimental pipeline ENST00000489420.1 GENCODE experimental pipeline ENST00000435042.1 GENCODE experimental pipeline ENST00000495905.1 GENCODE experimental pipeline ENST00000450441.1 GENCODE experimental pipeline ENST00000428744.1 GENCODE experimental pipeline ENST00000378731.1 FLJ16793 ENST00000378721.4 GENCODE experimental pipeline ENST00000378706.1 GENCODE experimental pipeline ENST00000453480.1 GENCODE experimental pipeline ENST00000378676.1 GENCODE experimental pipeline ENST00000513561.1 GENCODE experimental pipeline ENST00000518887.1 alternative 5' UTR ENST00000521639.1 alternative 5' UTR ENST00000522375.1 alternative 5' UTR ENST00000378560.4 NP_963965.1 ENST00000520958.1 NP_963963 ENST00000520958.1 NP_998813 ENST00000520958.1 alternative 5' UTR ENST00000518915.1 NP_963964 ENST00000517625.1 alternative 5' UTR ENST00000522855.1 alternative 5' UTR ENST00000519321.1 alternative 5' UTR ENST00000520417.1 alternative 5' UTR ENST00000523359.1 alternative 5' UTR ENST00000521118.1 not organism-supported ENST00000503470.1 GENCODE experimental pipeline ENST00000515627.1 GENCODE experimental pipeline ENST00000512386.1 alternative 5' UTR ENST00000282605.4 alternative 5' UTR ENST00000402835.1 GENCODE experimental pipeline ENST00000402835.1 alternative 5' UTR ENST00000395003.1 alternative 5' UTR ENST00000431355.1 alternative 5' UTR ENST00000470876.1 FLJ21348 ENST00000507419.1 GENCODE experimental pipeline ENST00000439578.1 alternative 5' UTR ENST00000505758.1 alternative 5' UTR ENST00000502286.1 alternative 5' UTR ENST00000514518.1 GENCODE experimental pipeline ENST00000507392.1 non canonical TEC ENST00000452510.2 non-canonical spice between exons 19 and 20 ENST00000452510.2 non canonical conserved ENST00000338051.4 alternative 5' UTR ENST00000394976.3 FLJ37562 ENST00000504727.1 GENCODE experimental pipeline ENST00000435259.2 alternative 5' UTR ENST00000508791.1 alternative 5' UTR ENST00000506916.1 GENCODE experimental pipeline ENST00000508810.1 GENCODE experimental pipeline ENST00000506438.1 alternative 5' UTR ENST00000507253.1 alternative 5' UTR ENST00000502676.1 alternative 5' UTR ENST00000432382.3 GENCODE experimental pipeline ENST00000505663.1 GENCODE experimental pipeline ENST00000510038.1 alternative 5' UTR ENST00000508962.1 GENCODE experimental pipeline ENST00000506592.1 GENCODE experimental pipeline ENST00000425402.1 not organism-supported ENST00000433282.2 not organism-supported ENST00000510147.1 GENCODE experimental pipeline ENST00000504205.1 non-canonical acceptor splice site between exon 1 and 2 ENST00000508767.1 non-canonical acceptor splice site between exon 2 and 3 ENST00000508767.1 GENCODE experimental pipeline ENST00000503087.1 GENCODE experimental pipeline ENST00000514641.1 suspected genomic sequence error affecting CDS in exon 8 ENST00000507118.1 alternative 5' UTR ENST00000511116.1 alternative 5' UTR ENST00000509297.1 alternative 5' UTR ENST00000515005.1 alternative 5' UTR ENST00000506223.1 alternative 5' UTR ENST00000513958.1 GENCODE experimental pipeline ENST00000514282.1 GENCODE experimental pipeline ENST00000446720.2 GENCODE experimental pipeline ENST00000511165.1 GENCODE experimental pipeline ENST00000505690.1 alternative 5' UTR ENST00000505853.1 GENCODE experimental pipeline ENST00000515645.1 GENCODE experimental pipeline ENST00000508638.1 GENCODE experimental pipeline ENST00000502810.1 GENCODE experimental pipeline ENST00000290431.5 NP_055201.2 ENST00000514310.1 alternative 5' UTR ENST00000502471.1 alternative 5' UTR ENST00000509596.1 alternative 5' UTR ENST00000508403.1 alternative 5' UTR ENST00000505961.1 alternative 5' UTR ENST00000441656.1 GENCODE experimental pipeline ENST00000515014.1 not organism-supported ENST00000506167.1 not organism-supported ENST00000511898.1 GENCODE experimental pipeline ENST00000511898.1 not organism-supported ENST00000513970.1 alternative 5' UTR ENST00000503022.1 alternative 5' UTR ENST00000510119.1 GENCODE experimental pipeline ENST00000434981.2 alternative 5' UTR ENST00000505136.1 not organism-supported ENST00000504539.1 GENCODE experimental pipeline ENST00000506158.1 GENCODE experimental pipeline ENST00000512126.1 GENCODE experimental pipeline ENST00000499810.2 GENCODE experimental pipeline ENST00000503014.1 GENCODE experimental pipeline ENST00000504902.1 not organism-supported ENST00000507886.1 alternative 5' UTR ENST00000517980.1 alternative 5' UTR ENST00000522227.1 alternative 5' UTR ENST00000524127.1 alternative 5' UTR ENST00000523912.1 alternative 5' UTR ENST00000520339.1 alternative 5' UTR ENST00000519113.1 alternative 5' UTR ENST00000520158.1 alternative 5' UTR ENST00000518381.1 alternative 5' UTR ENST00000520260.1 alternative 5' UTR ENST00000523298.1 alternative 5' UTR ENST00000520865.1 alternative 5' UTR ENST00000519634.1 alternative 5' UTR ENST00000517533.1 alternative 5' UTR ENST00000523685.1 alternative 5' UTR ENST00000519768.1 alternative 5' UTR ENST00000517656.1 alternative 5' UTR ENST00000521683.1 alternative 5' UTR ENST00000521640.1 alternative 5' UTR ENST00000519116.1 alternative 5' UTR ENST00000520522.1 alternative 5' UTR ENST00000265195.5 alternative 5' UTR ENST00000509534.1 GENCODE experimental pipeline ENST00000508639.1 alternative 5' UTR ENST00000513453.1 alternative 5' UTR ENST00000505830.1 alternative 5' UTR ENST00000505353.1 alternative 5' UTR ENST00000512107.1 alternative 5' UTR ENST00000514694.1 alternative 5' UTR ENST00000504203.1 alternative 5' UTR ENST00000502929.1 non-canonical acceptor splice site between exons 4 and 5 ENST00000502929.1 alternative 5' UTR ENST00000394800.2 GENCODE experimental pipeline ENST00000509644.1 alternative 5' UTR ENST00000505016.1 alternative 5' UTR ENST00000502394.1 alternative 5' UTR ENST00000513678.1 alternative 5' UTR ENST00000504045.1 alternative 5' UTR ENST00000504045.1 not organism-supported ENST00000510056.1 GENCODE experimental pipeline ENST00000511378.1 alternative 5' UTR ENST00000508689.1 alternative 5' UTR ENST00000514488.1 alternative 5' UTR ENST00000503340.1 alternative 5' UTR ENST00000504023.1 alternative 5' UTR ENST00000507755.1 alternative 5' UTR ENST00000511381.1 not organism-supported ENST00000511706.1 GENCODE experimental pipeline ENST00000511706.1 not organism-supported ENST00000394795.2 alternative 5' UTR ENST00000510080.1 alternative 5' UTR ENST00000504513.1 GENCODE experimental pipeline ENST00000504513.1 not organism-supported ENST00000512761.1 not organism-supported ENST00000514983.1 not organism-supported ENST00000509959.1 GENCODE experimental pipeline ENST00000509959.1 not organism-supported ENST00000507779.2 not organism-supported ENST00000515559.1 GENCODE experimental pipeline ENST00000514052.1 GENCODE experimental pipeline ENST00000515581.1 alternative 5' UTR ENST00000515277.1 alternative 5' UTR ENST00000512473.1 alternative 5' UTR ENST00000510908.1 gene fragments AC142391.1-001 and AC138517.3-001 are part of the same gene; an assembly gap between them contains one or more exons ENST00000515823.1 gene fragments AC142391.1-001 and AC138517.3-001 are part of the same gene; an assembly gap between them contains one or more exons ENST00000511886.1 GENCODE experimental pipeline ENST00000510817.1 alternative 5' UTR ENST00000511725.1 alternative 5' UTR ENST00000505007.1 alternative 5' UTR ENST00000398734.4 alternative 3' UTR ENST00000505548.1 NP_862821.1 ENST00000502295.1 alternative 5' UTR ENST00000504944.1 alternative 5' UTR ENST00000507139.1 alternative 5' UTR ENST00000504844.1 alternative 5' UTR ENST00000502336.1 alternative 5' UTR ENST00000520967.1 alternative 5' UTR ENST00000511048.1 alternative 5' UTR ENST00000512816.1 alternative 5' UTR ENST00000509238.1 alternative 5' UTR ENST00000502716.1 alternative 5' UTR ENST00000503511.1 alternative 5' UTR ENST00000511457.1 alternative 5' UTR ENST00000511591.1 alternative 5' UTR ENST00000289422.7 not organism-supported ENST00000289409.4 not organism-supported ENST00000502351.1 GENCODE experimental pipeline ENST00000261811.4 ORF1-FL49 ENST00000509589.1 GENCODE experimental pipeline ENST00000507521.1 GENCODE experimental pipeline ENST00000412116.1 GENCODE experimental pipeline ENST00000462121.1 GENCODE experimental pipeline ENST00000532219.1 NP_065741.3 ENST00000437495.1 not organism-supported ENST00000511201.2 GENCODE experimental pipeline ENST00000514199.1 alternative 5' UTR ENST00000512545.1 GENCODE experimental pipeline ENST00000512088.1 GENCODE experimental pipeline ENST00000509217.2 GENCODE experimental pipeline ENST00000417647.2 non canonical conserved ENST00000507593.1 GENCODE experimental pipeline ENST00000515015.1 non canonical conserved ENST00000503873.1 alternative 5' UTR ENST00000409494.1 GENCODE experimental pipeline ENST00000517417.1 Discrepancy with CCDS34256.1 ENST00000253812.6 NP_061739 ENST00000518882.1 NP_114481 ENST00000476339.1 FLJ36945 ENST00000389054.3 AT-AC splicing between exons 11 and 12, 24 and 25 ENST00000520569.1 AT-AC splicing between exons 11 and 12, 24 and 25 ENST00000448451.1 FLJ25265 ENST00000518047.1 gomi ENST00000518047.1 AT-AC splicing between exons 11 and 12, 24 and 25 ENST00000468119.1 g/ga ag\ splicing between exons 1 and 2 ENST00000521457.1 AT-AC splicing between exons 10 and 11, 23 and 24 ENST00000508305.1 GENCODE experimental pipeline ENST00000513878.1 GENCODE experimental pipeline ENST00000503492.1 GENCODE experimental pipeline ENST00000508751.1 GENCODE experimental pipeline ENST00000510041.1 alternative 5' UTR ENST00000511961.1 alternative 5' UTR ENST00000506822.1 alternative 5' UTR ENST00000513019.1 alternative 5' UTR ENST00000394514.2 NP_899645.1 ENST00000507163.1 alternative 5' UTR ENST00000506004.1 alternative 5' UTR ENST00000507291.1 alternative 5' UTR ENST00000513454.1 GENCODE experimental pipeline ENST00000500692.2 alternative 5' UTR ENST00000503794.1 alternative 5' UTR ENST00000504139.1 GENCODE experimental pipeline ENST00000505689.1 GENCODE experimental pipeline ENST00000510194.1 alternative 5' UTR ENST00000503229.1 alternative 5' UTR ENST00000504424.1 alternative 5' UTR ENST00000407758.1 GENCODE experimental pipeline ENST00000441680.2 I have extended the 5' and 3' ends of this transcipt using Affy08248A11 ENST00000419524.2 Affy08248D11 ENST00000419524.2 encode_confirmed ENST00000419524.2 exons_1-4 ENST00000464838.1 GENCODE experimental pipeline ENST00000504572.1 alternative 5' UTR ENST00000394466.2 alternative 5' UTR ENST00000503201.1 alternative 5' UTR ENST00000510170.1 alternative 5' UTR ENST00000508760.1 alternative 5' UTR ENST00000514699.1 alternative 5' UTR ENST00000502500.1 alternative 5' UTR ENST00000289448.2 PMID: 9892612 ENST00000289448.2 non-ATG start codon ENST00000448443.2 alternative 5' UTR ENST00000519064.1 alternative 5' UTR ENST00000522203.1 alternative 5' UTR ENST00000507359.1 alternative 5' UTR ENST00000505416.1 GENCODE experimental pipeline ENST00000511217.1 alternative 3' UTR ENST00000507391.1 GENCODE experimental pipeline ENST00000549332.1 not organism-supported ENST00000508545.2 not organism-supported ENST00000394411.3 alternative 5' UTR ENST00000512639.1 GENCODE experimental pipeline ENST00000512984.1 GENCODE experimental pipeline ENST00000398523.3 GENCODE experimental pipeline ENST00000512722.1 alternative 5' UTR ENST00000265272.5 KIAA0555 ENST00000521206.1 alternative 5' UTR ENST00000398454.1 NP_001121171.1 ENST00000359874.3 NP_001121170.1 ENST00000356972.1 NP_001001325.1 ENST00000514389.1 alternative 5' UTR ENST00000514394.1 GENCODE experimental pipeline ENST00000517929.1 NP_001035262.2 ENST00000504690.1 GENCODE experimental pipeline ENST00000512049.1 GENCODE experimental pipeline ENST00000326685.7 AM393682 ENST00000506113.1 alternative 5' UTR ENST00000416916.2 GENCODE experimental pipeline ENST00000433184.1 alternative 5' UTR ENST00000503336.1 GENCODE experimental pipeline ENST00000515406.2 alternative 5' UTR ENST00000503427.1 not organism-supported ENST00000517957.1 alternative 5' UTR ENST00000510347.1 alternative 5' UTR ENST00000513538.1 GENCODE experimental pipeline ENST00000521466.1 alternative 5' UTR ENST00000312037.5 alternative 5' UTR ENST00000522491.1 alternative 5' UTR ENST00000519157.1 alternative 5' UTR ENST00000524161.1 alternative 5' UTR ENST00000518299.1 alternative 5' UTR ENST00000518346.1 alternative 5' UTR ENST00000522122.1 alternative 5' UTR ENST00000517768.1 alternative 5' UTR ENST00000447771.2 non-canonical splice donor site between exons 3 and 4 ENST00000518015.1 alternative 5' UTR ENST00000521533.1 alternative 5' UTR ENST00000394226.2 GENCODE experimental pipeline ENST00000315050.7 alternative 5' UTR ENST00000521591.1 alternative 5' UTR ENST00000518977.1 alternative 5' UTR ENST00000520695.1 alternative 5' UTR ENST00000521001.1 alternative 5' UTR ENST00000523714.1 alternative 5' UTR ENST00000519644.1 non-canonical splice donor site between exon 5 and 6 ENST00000517677.1 non-canonical splice donor site between exons 6 and 7 ENST00000521749.1 alternative 5' UTR ENST00000520378.1 not organism-supported ENST00000523164.1 alternative 5' UTR ENST00000355417.2 DKFZP434C171 ENST00000520111.1 alternative 5' UTR ENST00000520701.1 alternative 5' UTR ENST00000517945.1 alternative 5' UTR ENST00000519829.1 alternative 5' UTR ENST00000538026.1 alternative 5' UTR ENST00000539687.1 alternative 5' UTR ENST00000522348.1 alternative 5' UTR ENST00000523519.1 alternative 5' UTR ENST00000520578.1 alternative 5' UTR ENST00000356245.3 alternative 5' UTR ENST00000520006.1 alternative 5' UTR ENST00000522858.1 alternative 5' UTR ENST00000520667.1 alternative 5' UTR ENST00000522395.1 alternative 5' UTR ENST00000523705.1 alternative 5' UTR ENST00000519808.1 alternative 5' UTR ENST00000518102.1 alternative 5' UTR ENST00000522634.1 alternative 5' UTR ENST00000517605.1 alternative 5' UTR ENST00000524246.1 alternative 5' UTR ENST00000522782.1 alternative 5' UTR ENST00000439768.2 NP_001128509.1 ENST00000522177.1 alternative 5' UTR ENST00000520899.1 alternative 5' UTR ENST00000440364.2 NP_001124534.1 ENST00000426761.2 NP_001124535.1 ENST00000519931.1 alternative 5' UTR ENST00000520461.1 alternative 5' UTR ENST00000517876.1 alternative 5' UTR ENST00000520472.1 alternative 5' UTR ENST00000519211.1 alternative 5' UTR ENST00000522458.1 non-canonical splice donor site at exon 2 ENST00000522458.1 alternative 5' UTR ENST00000519903.1 alternative 5' UTR ENST00000521450.1 alternative 5' UTR ENST00000403027.2 alternative 5' UTR ENST00000517568.1 alternative 5' UTR ENST00000519430.1 alternative 5' UTR ENST00000520671.1 alternative 5' UTR ENST00000521583.1 alternative 5' UTR ENST00000518028.1 alternative 5' UTR ENST00000518775.1 alternative 5' UTR ENST00000521402.1 alternative 5' UTR ENST00000517913.1 NP_758447 ENST00000337851.4 NP_000328 ENST00000523175.1 NP_001092884 ENST00000339252.3 NP_036338 ENST00000518745.1 alternative 5' UTR ENST00000524289.1 alternative 5' UTR ENST00000520782.1 alternative 5' UTR ENST00000257527.4 NP_150377 ENST00000274542.2 FLJ31951 ENST00000424310.2 alternative 5' UTR ENST00000522793.1 alternative 5' UTR ENST00000523213.1 alternative 5' UTR ENST00000521826.1 alternative 5' UTR ENST00000519349.1 alternative 5' UTR ENST00000520664.1 alternative 5' UTR ENST00000352433.5 alternative 5' UTR ENST00000520452.1 alternative 5' UTR ENST00000523730.1 alternative 5' UTR ENST00000523217.1 not organism-supported ENST00000023897.6 alternative 5' UTR ENST00000393943.4 alternative 5' UTR ENST00000437025.2 alternative 5' UTR ENST00000519621.1 alternative 5' UTR ENST00000512163.1 confirm experimentally ENST00000511683.2 non canonical conserved ENST00000511683.2 alternative 5' UTR ENST00000510097.1 alternative 5' UTR ENST00000511490.2 alternative 5' UTR ENST00000510664.1 non canonical conserved ENST00000504553.1 confirm experimentally ENST00000416990.2 non-canonical splice donor site between exon 1 and exon 2 ENST00000522094.1 alternative 5' UTR ENST00000393915.4 SW:O75330-3 ENST00000432118.2 NP_001136029 ENST00000521838.1 non-canonical acceptor splice site between exon 1 and exon 2 ENST00000514811.1 GENCODE experimental pipeline ENST00000511447.1 GENCODE experimental pipeline ENST00000507092.1 GENCODE experimental pipeline ENST00000508470.1 GENCODE experimental pipeline ENST00000506574.1 alternative 5' UTR ENST00000515224.1 alternative 5' UTR ENST00000508247.1 alternative 5' UTR ENST00000513941.1 alternative 5' UTR ENST00000513795.1 alternative 5' UTR ENST00000521850.1 NP_001096079 ENST00000377360.4 NP_001030010 ENST00000521481.1 alternative 5' UTR ENST00000521009.1 alternative 5' UTR ENST00000519196.1 alternative 5' UTR ENST00000522868.1 alternative 5' UTR ENST00000518122.1 alternative 5' UTR ENST00000517671.1 alternative 5' UTR ENST00000393820.2 NP_001032827 ENST00000519974.1 alternative 5' UTR ENST00000521476.1 alternative 5' UTR ENST00000519239.1 alternative 5' UTR ENST00000519522.1 alternative 5' UTR ENST00000519156.1 alternative 5' UTR ENST00000517669.1 alternative 3' UTR ENST00000520420.1 alternative 5' UTR ENST00000523161.1 alternative 5' UTR ENST00000519867.1 alternative 5' UTR ENST00000521278.1 alternative 5' UTR ENST00000519717.1 alternative 5' UTR ENST00000510150.1 GENCODE experimental pipeline ENST00000507017.1 alternative 5' UTR ENST00000506963.1 alternative 5' UTR ENST00000515502.1 alternative 5' UTR ENST00000509837.1 alternative 5' UTR ENST00000393745.3 alternative 5' UTR ENST00000512824.1 alternative 5' UTR ENST00000514150.1 alternative 5' UTR ENST00000502265.1 alternative 5' UTR ENST00000515025.1 alternative 5' UTR ENST00000515094.1 alternative 5' UTR ENST00000510151.1 not best-in-genome evidence ENST00000512862.1 not best-in-genome evidence ENST00000515817.1 not best-in-genome evidence ENST00000443967.1 FLJ44216 ENST00000514128.1 non-canonical splice site between exons 1 and 2 ENST00000514128.1 non canonical TEC ENST00000298569.4 KIAA1191 ENST00000510164.1 alternative 5' UTR ENST00000506983.1 alternative 5' UTR ENST00000510123.1 GENCODE experimental pipeline ENST00000507413.1 GENCODE experimental pipeline ENST00000261944.5 alternative 5' UTR ENST00000303991.4 KIAA1893 ENST00000393693.2 alternative 5' UTR ENST00000506696.1 alternative 5' UTR ENST00000510660.1 alternative 5' UTR ENST00000504597.1 non canonical TEC ENST00000504168.1 GENCODE experimental pipeline ENST00000503045.1 GENCODE experimental pipeline ENST00000507236.1 GENCODE experimental pipeline ENST00000509580.1 GENCODE experimental pipeline ENST00000506128.1 non canonical TEC ENST00000506128.1 non-canonical splicing between exons 6 and 7 ENST00000511320.1 alternative 5' UTR ENST00000512031.1 alternative 5' UTR ENST00000510698.1 non canonical TEC ENST00000510698.1 non-canonical splice site between exons 8 and 9 ENST00000509236.1 alternative 5' UTR ENST00000507513.1 alternative 5' UTR ENST00000428382.2 alternative 5' UTR ENST00000506693.1 GENCODE experimental pipeline ENST00000503425.1 GENCODE experimental pipeline ENST00000503708.1 alternative 5' UTR ENST00000393648.2 alternative 5' UTR ENST00000514472.1 alternative 5' UTR ENST00000502906.1 alternative 5' UTR ENST00000510911.1 alternative 5' UTR ENST00000507708.1 alternative 5' UTR ENST00000513166.1 alternative 5' UTR ENST00000510954.1 alternative 5' UTR ENST00000508896.1 alternative 5' UTR ENST00000508029.1 GENCODE experimental pipeline ENST00000503056.1 GENCODE experimental pipeline ENST00000504457.1 GENCODE experimental pipeline ENST00000505395.1 GENCODE experimental pipeline ENST00000393611.2 alternative 5' UTR ENST00000504395.1 alternative 5' UTR ENST00000513063.1 alternative 5' UTR ENST00000515209.1 GENCODE experimental pipeline ENST00000504577.1 alternative 5' UTR ENST00000512593.1 GENCODE experimental pipeline ENST00000393576.3 not organism-supported ENST00000528793.1 non-canonical splice acceptor sites between exons 15 and 16 ENST00000507881.1 alternative 5' UTR ENST00000502922.1 alternative 5' UTR ENST00000510492.1 alternative 5' UTR ENST00000393565.1 Made from rat and mouse cDNAs ENST00000393565.1 GENCODE experimental pipeline ENST00000514833.1 alternative 5' UTR ENST00000506161.1 alternative 5' UTR ENST00000506537.1 alternative 5' UTR ENST00000510380.1 alternative 5' UTR ENST00000506493.1 alternative 5' UTR ENST00000502885.1 alternative 5' UTR ENST00000510898.1 alternative 5' UTR ENST00000509310.1 alternative 5' UTR ENST00000510389.1 alternative 5' UTR ENST00000514747.1 not organism-supported ENST00000507061.1 GENCODE experimental pipeline ENST00000510464.1 unitary_pseudogene ENST00000504530.1 alternative 5' UTR ENST00000313386.4 FLJ22318 ENST00000515098.1 alternative 5' UTR ENST00000502814.1 alternative 5' UTR ENST00000507457.1 alternative 5' UTR ENST00000508647.1 alternative 5' UTR ENST00000314397.4 NP_001030005 ENST00000506259.1 alternative 5' UTR ENST00000504898.1 alternative 5' UTR ENST00000308158.5 MGC15875 ENST00000476170.2 GENCODE experimental pipeline ENST00000484750.1 GENCODE experimental pipeline ENST00000520331.1 alternative 5' UTR ENST00000520377.1 alternative 5' UTR ENST00000520660.1 alternative 5' UTR ENST00000520805.1 alternative 5' UTR ENST00000520301.1 alternative 5' UTR ENST00000523286.1 alternative 5' UTR ENST00000519564.1 alternative 5' UTR ENST00000444149.2 NP_001129588 ENST00000522442.1 alternative 5' UTR ENST00000521285.1 alternative 5' UTR ENST00000393438.2 alternative 5' UTR ENST00000503514.1 GENCODE experimental pipeline ENST00000502434.1 GENCODE experimental pipeline ENST00000442819.2 alternative 5' UTR ENST00000356731.5 alternative 5' UTR ENST00000519958.1 not organism-supported ENST00000521173.1 not organism-supported ENST00000503105.1 GENCODE experimental pipeline ENST00000504779.2 alternative 5' UTR ENST00000505811.1 alternative 5' UTR ENST00000504348.1 alternative 5' UTR ENST00000513225.1 alternative 5' UTR ENST00000524180.1 not organism-supported ENST00000515158.1 alternative 5' UTR ENST00000521116.1 alternative 5' UTR ENST00000515714.1 alternative 5' UTR ENST00000503664.1 alternative 5' UTR ENST00000513230.1 alternative 5' UTR ENST00000522256.1 alternative 5' UTR ENST00000448248.2 CCDS47353.1 ENST00000514383.1 alternative 5' UTR ENST00000502296.1 alternative 5' UTR ENST00000504734.1 alternative 5' UTR ENST00000452673.2 alternative 5' UTR ENST00000502498.1 alternative 5' UTR ENST00000507307.1 alternative 5' UTR ENST00000513246.1 alternative 5' UTR ENST00000502673.1 alternative 5' UTR ENST00000509563.1 alternative 5' UTR ENST00000508787.1 GENCODE experimental pipeline ENST00000505170.1 not organism-supported ENST00000401985.3 GENCODE experimental pipeline ENST00000514093.1 alternative 5' UTR ENST00000422245.1 alternative 5' UTR ENST00000453046.1 alternative 5' UTR ENST00000510187.1 GENCODE experimental pipeline ENST00000499601.2 GENCODE experimental pipeline ENST00000524222.1 non-canonical splice donor site between exons 2 and 3 ENST00000520911.1 non-canonical splice donor site between exons 2 and 3 ENST00000522885.1 non-canonical splice donor site between exons 2 and 3 ENST00000510240.1 GENCODE experimental pipeline ENST00000393371.2 alternative 5' UTR ENST00000523583.1 alternative 5' UTR ENST00000504573.1 GENCODE experimental pipeline ENST00000502447.1 alternative 5' UTR ENST00000513535.1 GENCODE experimental pipeline ENST00000307826.4 alternative 5' UTR ENST00000446023.2 alternative 5' UTR ENST00000427865.2 alternative 5' UTR ENST00000504671.1 alternative 5' UTR ENST00000506889.1 alternative 5' UTR ENST00000514283.1 alternative 5' UTR ENST00000512695.1 alternative 5' UTR ENST00000506269.1 alternative 5' UTR ENST00000514438.1 alternative 5' UTR ENST00000502678.1 alternative 5' UTR ENST00000513431.1 alternative 5' UTR ENST00000507384.1 alternative 5' UTR ENST00000514760.1 GENCODE experimental pipeline ENST00000512080.1 GENCODE experimental pipeline ENST00000510341.1 GENCODE experimental pipeline ENST00000508702.1 GENCODE experimental pipeline ENST00000510962.1 GENCODE experimental pipeline ENST00000508090.1 GENCODE experimental pipeline ENST00000506708.1 GENCODE experimental pipeline ENST00000509921.1 GENCODE experimental pipeline ENST00000512132.1 NP_689496.4 ENST00000504225.1 alternative 5' UTR ENST00000506439.1 alternative 5' UTR ENST00000509066.1 alternative 5' UTR ENST00000511704.1 GENCODE experimental pipeline ENST00000515271.1 GENCODE experimental pipeline ENST00000508877.1 GENCODE experimental pipeline ENST00000503314.1 GENCODE experimental pipeline ENST00000511473.1 non-canonical splice donor site between exons 2 and 3 ENST00000502905.1 non-canonical splice donor site between exons 2 and 3 ENST00000511566.1 GENCODE experimental pipeline ENST00000511566.1 non-canonical splice donor site between exons 2 and 3 ENST00000509535.1 GENCODE experimental pipeline ENST00000504128.1 GENCODE experimental pipeline ENST00000508682.1 non-canonical splice donor site between exons 2 and 3 ENST00000376817.4 non canonical conserved ENST00000376817.4 non-canonical splice donor site between exons 2 and 3 ENST00000512805.1 non canonical conserved ENST00000512805.1 non-canonical splice donor site between exons 2 and 3 ENST00000504726.1 GENCODE experimental pipeline ENST00000504726.1 not organism-supported ENST00000511900.1 GENCODE experimental pipeline ENST00000511900.1 not organism-supported ENST00000512968.1 non-canonical splice donor site between exons 2 and 3 ENST00000510199.1 non-canonical splice donor site between exons 2 and 3 ENST00000502844.1 non-canonical splice donor site between exons 2 and 3 ENST00000507000.1 GENCODE experimental pipeline ENST00000507000.1 non-canonical splice donor site between exons 2 and 3 ENST00000514183.1 non-canonical splice donor site between exons 2 and 3 ENST00000502548.1 non-canonical splice donor site between exons 2 and 3 ENST00000503494.1 non-canonical splice donor site between exons 2 and 3 ENST00000513027.1 ggc splice donor site between splice sites 2 and 3 ENST00000505461.1 non canonical conserved ENST00000505461.1 non-canonical splice donor site between exons 2 and 3 ENST00000508963.1 non-canonical splice donor site between exons 2 and 3 ENST00000513146.1 GENCODE experimental pipeline ENST00000510796.1 GENCODE experimental pipeline ENST00000509252.1 GENCODE experimental pipeline ENST00000433265.3 GENCODE experimental pipeline ENST00000412295.2 GENCODE experimental pipeline ENST00000405102.1 olfactory receptor pseudogene ENST00000406017.1 novel pseudogene ENST00000458006.1 novel transcript ENST00000407941.1 novel pseudogene ENST00000441203.1 putative novel transcript ENST00000344450.5 mitogen-activated protein kinase phosphatase X (MKPX) ENST00000419235.1 mitogen-activated protein kinase phosphatase X (MKPX) ENST00000380956.4 Continued_from bA328C17.2 in Em:AL365272 ENST00000380956.4 Continued_from bA233K4.1.1 in Em:AL589962 ENST00000380956.4 interferon regulatory factor 4 variant 1 ENST00000380956.4 interferon regulatory factor 4 ENST00000468485.1 interferon regulatory factor 4 ENST00000495137.1 interferon regulatory factor 4 ENST00000493114.1 Continued_from bA328C17.2.5 in Em:AL365272 ENST00000493114.1 interferon regulatory factor 4 variant 5 ENST00000493114.1 interferon regulatory factor 4 ENST00000469834.1 interferon regulatory factor 4 ENST00000230449.4 mammalian exocyst complex subunit (Sec5)(FLJ11026) ENST00000230449.4 mammalian exocyst complex subunit (Sec5) (FLJ11026) ENST00000443083.1 mammalian exocyst complex subunit (Sec5) (FLJ11026) ENST00000475028.1 putative novel transcript ENST00000430842.1 putative novel transcript ENST00000380907.2 novel protein similar to HUS1 checkpoint homolog (S. pombe) ENST00000407035.1 serine/threonine kinase pseudogene ENST00000434292.1 putative novel transcript ENST00000259806.1 forkhead box F2 ENST00000404600.1 E74-like factor 2 (ets domain transcription factor) (ELF2) pseudogene ENST00000476972.2 GDP-mannose 4,6-dehydratase ENST00000467288.2 GDP-mannose 4,6-dehydratase ENST00000486793.1 GDP-mannose 4,6-dehydratase ENST00000380815.4 GDP-D-mannose-4,6-dehydratase ENST00000380815.4 GDP-mannose 4,6-dehydratase ENST00000380805.2 GDP-mannose 4,6-dehydratase ENST00000296847.3 novel protein (FLJ31934) ENST00000440848.1 novel transcript ENST00000274643.7 novel protein similar to myosin light chain kinase ENST00000508402.1 putative novel transcript ENST00000380773.4 werner helicase interacting protein (WHIP) (RUVBL helicase) ENST00000380771.4 werner helicase interacting protein (WHIP) (RUVBL helicase) ENST00000380769.3 werner helicase interacting protein (WHIP) (RUVBL helicase) ENST00000380764.1 werner helicase interacting protein (WHIP) (RUVBL helicase) ENST00000380739.5 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin) member 1 (EI, LEI, PI2, M/NEI, ELANH2, protease inhibitor 2 (anti-elastase) monocyte/neutrophil derived) ENST00000468511.1 this transcript variant and variant .3.4 could be part of a single alternate transcript ENST00000468511.1 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin) member 1 (EI, LEI, PI2, M/NEI, ELANH2, protease inhibitor 2 (anti-elastase) monocyte/neutrophil derived) ENST00000490094.1 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin) member 1 (EI, LEI, PI2, M/NEI, ELANH2, protease inhibitor 2 (anti-elastase) monocyte/neutrophil derived) ENST00000476896.1 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin) member 1 (EI, LEI, PI2, M/NEI, ELANH2, protease inhibitor 2 (anti-elastase) monocyte/neutrophil derived) ENST00000460260.1 this transcript variant and variants .3.5 could be part of a single alternate transcript ENST00000460260.1 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin) member 1 (EI, LEI, PI2, M/NEI, ELANH2, protease inhibitor 2 (anti-elastase) monocyte/neutrophil derived) ENST00000420981.1 putative novel transcript ENST00000420981.1 novel transcript ENST00000380698.4 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 9 (CAP3, P19, protease inhibitor 9) ENST00000437718.1 putative novel transcript ENST00000380524.1 variants .1 to .6 differ by alternate splicing in the 5' UTR ENST00000380524.1 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6 (CAP, PI6, PTI, protease inhibitor 6) ENST00000380520.1 transcript variants .1 to .6 differ by alternate splicing in the 5' UTR ENST00000380520.1 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6 (CAP, PI6, PTI, protease inhibitor 6) ENST00000335686.5 transcript variants .1 to .6 differ by alternate splicing in the 5' UTR ENST00000335686.5 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6 (CAP, PI6, PTI, protease inhibitor 6) ENST00000380529.1 transcript variants .1 to .6 differ by alternate splicing in the 5' UTR ENST00000380529.1 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6 (CAP, PI6, PTI, protease inhibitor 6) ENST00000380539.1 transcript variants .1 to .6 differ by alternate splicing in the 5' UTR ENST00000380539.1 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6 (CAP, PI6, PTI, protease inhibitor 6) ENST00000380546.3 transcript variants .1 to .6 differ by alternate splicing in the 5' UTR ENST00000380546.3 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6 (CAP, PI6, PTI, protease inhibitor 6) ENST00000380500.4 serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6 (CAP, PI6, PTI, protease inhibitor 6) ENST00000426637.1 based on chimp EST ENST00000397717.2 NAD(P)H dehydrogenase, quinone 2 (NMOR2, QR2, DHQV, NAD(P)H menadione oxidoreductase 2 dioxin-inducible, NAD(P)H menadione oxidoreductase-1 dioxin-inducible 2) ENST00000397717.2 alternative 5' UTR ENST00000338130.2 transcript variants .1, .2 and .6 differ by alternate splicing in the 5' UTR ENST00000338130.2 NAD(P)H dehydrogenase, quinone 2 (NMOR2, QR2, DHQV, NAD(P)H menadione oxidoreductase 2 dioxin-inducible, NAD(P)H menadione oxidoreductase-1 dioxin-inducible 2) ENST00000380441.1 missing exon 3; differs from transcript variant .5 by alternate splicing in the 5' UTR ENST00000380441.1 NAD(P)H dehydrogenase, quinone 2 (NMOR2, QR2, DHQV, NAD(P)H menadione oxidoreductase 2 dioxin-inducible, NAD(P)H menadione oxidoreductase-1 dioxin-inducible 2) ENST00000380455.4 transcript variants .1, .2 and .6 differ by alternate splicing in the 5' UTR ENST00000380455.4 NAD(P)H dehydrogenase, quinone 2 (NMOR2, QR2, DHQV, NAD(P)H menadione oxidoreductase 2 dioxin-inducible, NAD(P)H menadione oxidoreductase-1 dioxin-inducible 2) ENST00000380454.4 missing exon 3; differs from transcript variant .3 by alternate splicing in the 5' UTR ENST00000380454.4 NAD(P)H dehydrogenase, quinone 2 (NMOR2, QR2, DHQV, NAD(P)H menadione oxidoreductase 2 dioxin-inducible, NAD(P)H menadione oxidoreductase-1 dioxin-inducible 2) ENST00000380430.1 transcript variants .1, .2 and .6 differ by alternate splicing in the 5' UTR ENST00000380430.1 NAD(P)H dehydrogenase, quinone 2 (NMOR2, QR2, DHQV, NAD(P)H menadione oxidoreductase 2 dioxin-inducible, NAD(P)H menadione oxidoreductase-1 dioxin-inducible 2) ENST00000456189.1 putative novel transcript ENST00000429319.1 putative novel transcript ENST00000401898.1 pseudogene similar to cytoplasmic antiproteinase 2 (CAP2) (SERPINB8) ENST00000423062.1 putative novel transcript ENST00000455327.1 putative novel transcript ENST00000423429.1 putative novel transcript ENST00000433761.1 putative novel transcript ENST00000490396.1 receptor (TNFRSF)-interacting serine-threonine kinase 1 (RIP) ENST00000479389.1 receptor (TNFRSF)-interacting serine-threonine kinase 1 (RIP) ENST00000259808.3 receptor (TNFRSF)-interacting serine-threonine kinase 1 (RIP) ENST00000333628.3 novel protein similar to tubulin beta polypeptide (TUBB) ENST00000489942.1 novel transcript ENST00000404155.1 tubulin beta polypeptide (TUBB) pseudogene ENST00000435043.1 putative novel transcript ENST00000425384.1 putative novel transcript ENST00000259818.6 novel protein similar to tubulin beta polypeptide (TUBB) ENST00000473006.1 novel transcript ENST00000419065.2 NP_001122064.1 ENST00000473000.2 NP_001129222.1 ENST00000380302.4 alternative 5' UTR ENST00000380298.2 269349 268754 ENST00000443445.1 putative novel transcript ENST00000380283.4 novel protein ENST00000477592.1 novel transcript ENST00000380277.2 novel protein ENST00000485986.1 novel transcript ENST00000402155.1 novel pseudogene ENST00000454396.1 putative novel transcript ENST00000380274.1 alternative 5' UTR ENST00000445883.1 putative novel transcript ENST00000450255.1 putative novel transcript ENST00000404787.1 40S ribosomal protein S25 (RPS25) pseudogene ENST00000405321.1 high-mobility group (nonhistone chromosomal) protein 14 (HMG14) pseudogene ENST00000401555.1 pseudogene similar to CREBB/EP300 inhibitory protein 1 (CRI1) ENST00000405027.1 Thioredoxin-like (TXNL2) pseudogene ENST00000415144.1 putative novel transcript ENST00000489943.1 variants 4 through 10 could be part of the same variant ENST00000489943.1 novel transcript ENST00000490399.1 variants 4 through 10 could be part of the same variant ENST00000490399.1 novel transcript ENST00000463634.1 serine/threonine-protein kinase PRP4 homolog (PRP4),(PR4H, PRP4H, KIAA0536) ENST00000466185.1 variants 4 through 10 could be part of the same variant ENST00000466185.1 novel transcript ENST00000494674.1 variants 4 through 10 could be part of the same variant ENST00000494674.1 novel transcript ENST00000490653.1 novel transcript ENST00000490653.1 variants 4 through 10 could be part of the same variant ENST00000494530.1 variants 4 through 10 could be part of the same variant ENST00000494530.1 novel transcript ENST00000461612.1 variants 4 through 10 could be part of the same variant ENST00000461612.1 novel transcript ENST00000470599.1 novel protein similar to M. musculus RIKEN cDNA 1700026J04 gene (1700026J04Rik) ENST00000492651.1 alternative 5' UTR ENST00000380125.2 NP_006108.2 ENST00000361538.2 alternative 5' UTR ENST00000465828.1 not organism-supported ENST00000465828.1 alternative 5' UTR ENST00000427591.1 putative novel transcript ENST00000403917.1 novel pseudogene ENST00000428023.1 putative novel transcript ENST00000437430.1 putative novel protein ENST00000380106.2 putative novel transcript ENST00000405257.1 26S protease regulatory subunit 4 (PSMC1) (P26S4) pseudogene ENST00000491864.1 non-organism_supported ENST00000449732.2 alternative 5' UTR ENST00000343762.5 NP_001137442.1 ENST00000404109.1 ribosomal protein S18 (RPS18) pseudogene ENST00000380051.2 NP_006629.2 ENST00000405549.1 similar to mouse house-keeping protein 1 (HKP1) pseudogene ENST00000324331.5 phenylalanine-tRNA synthetase (FARS1) ENST00000445533.1 novel protein ENST00000402778.1 microtubule-associated protein 1A/1B light chain 3 pseudogene ENST00000404243.1 heterogeneous nuclear ribonucleoprotein A0 (HNRPA0) pseudogene ENST00000407959.1 ribosomal protein L34 pseudogene ENST00000403053.1 Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) pseudogene ENST00000454882.1 Putative novel transcript ENST00000444978.1 Putative Novel transcript ENST00000454707.2 Pyruvate kinase (PKM2) pseudogene ENST00000244766.2 Neuritin (a protein which promotes neurite outgrowth) ENST00000495850.1 Neuritin ENST00000414279.1 alternative 5' UTR ENST00000447858.1 putative novel transcript ENST00000447858.1 novel transcript ENST00000435641.1 FLJ33708 ENST00000403621.1 SNAP19 (sRNA activating protein complex 19kDa subunit) pseudogene ENST00000401596.1 acidic calponin 3 (CNN3) pseudogene ENST00000432823.1 Non-canonical splice sites between the 1st and second exon ENST00000432823.1 putative novel transcript ENST00000435429.1 Putative novel transcript ENST00000407097.1 basic transcription factor 3 (BTF3) pseudogene ENST00000422310.1 putative novel transcript ENST00000423568.1 putative novel transcript ENST00000379933.3 alternative 5' UTR ENST00000491191.1 alternative 5' UTR ENST00000471433.1 alternative 5' UTR ENST00000467782.1 alternative 5' UTR ENST00000483150.1 alternative 5' UTR ENST00000451355.1 putative novel transcript ENST00000379928.4 novel transcript ENST00000379918.4 non-canonical donor splice site between exons 4 and 5 ENST00000502583.1 non-canonical donor splice site between exons 4 and 5 ENST00000296742.7 non-canonical donor splice site between exons 3 and 4 ENST00000512086.1 non-canonical donor splice site between exons 4 and 5 ENST00000338150.4 non-canonical donor splice site between exons 4 and 5 ENST00000404326.1 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9) pseudogene 1 ENST00000407940.1 ribosomal protein S3 pseudogene ENST00000419672.1 1-aminocyclopropane-1-carboxylate synthase pseudogene ENST00000421896.1 hetergeneous riboprotein L (HNRNP L) pseudogene ENST00000405131.1 ribosomal protein S26 pseudogene ENST00000440581.1 isocitrate dehydrogenase 1 (IDH1) pseudogene ENST00000418664.2 NP_001008844.1 ENST00000342415.4 novel protein ENST00000283147.6 bone morphogenetic protein 6 ENST00000439343.2 subject to nonsense-mediated decay ENST00000429723.2 NP_001129122.1 ENST00000439891.1 novel transcript ENST00000415575.1 novel transcript ENST00000379660.4 novel protein ENST00000503668.1 Panzitt et al. 2007 (PMID: 17241883) ENST00000429060.1 novel transcript ENST00000431369.1 novel transcript ENST00000489590.1 Non canonical splice sites: acceptor site between exons 2 and 3 and donor site between exons 3 and 4 ENST00000485268.1 alternative 5' UTR ENST00000462111.1 Non canonical acceptor splice site between exons 2 and 3 ENST00000401715.1 ribosomal protein L7A (RPL7A) pseudogene ENST00000417077.1 ribosomal protein L21 (RPL21) pseudogene ENST00000405921.1 ribosomal protein L7 (RPL7) pseudogene ENST00000319516.4 NP_001035890.1 ENST00000319516.4 not organism-supported ENST00000379608.3 NP_001027451.1 ENST00000482890.1 not organism-supported ENST00000420777.1 novel transcript ENST00000443546.1 novel transcript ENST00000420389.1 novel transcript ENST00000449333.1 novel transcript ENST00000366312.2 novel transcript ENST00000431401.1 novel transcript ENST00000495262.1 NP_663624 ENST00000495262.1 alternative 5' UTR ENST00000379597.3 NP_663624 ENST00000316170.3 NP_001482 ENST00000265012.4 NP_663630 ENST00000413129.1 novel transcript ENST00000401900.1 glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) (GCNT1) pseudogene ENST00000407436.1 ribosomal protein L21 (RPL21) pseudogene ENST00000379591.3 novel protein similar to glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (GCNT2) ENST00000379591.3 could be a pseudogene ENST00000379568.3 PAK/PLC-interacting protein 1 ENST00000229563.5 novel protein similar to PTD011 ENST00000466421.1 novel transcript ENST00000467415.1 novel transcript ENST00000495549.1 alternatively spliced 5' UTR; shares translation with variant 1 ENST00000495549.1 novel transcript ENST00000495549.1 alternative 5' UTR ENST00000472062.1 alternative 5' UTR ENST00000313243.2 transcript variant 1; alternatively spliced 5' UTR ENST00000313243.2 novel serine/threonine-protein kinase (possible ortholog of rodent MAK (male germ cell-associated kinase)) ENST00000474039.1 alternatively spliced 5' UTR; shares translation with variant 1 ENST00000474039.1 alternative 5' UTR ENST00000474039.1 novel transcript ENST00000379491.4 glial cells missing (Drosophila) homolog b ENST00000436249.1 novel transcript ENST00000354666.3 elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 2 (SSC2) ENST00000376935.3 the exon 2 splice acceptor site is non-canonical ENST00000376935.3 novel transcript (FLJ25457) ENST00000416247.2 LOC221710 ENST00000504387.1 NP_001135865.1 ENST00000379433.5 NP_892011.2 ENST00000397378.3 alternative 5' UTR ENST00000419796.1 this gene fragment and fragment 2 could be part of one single gene ENST00000419796.1 novel transcript ENST00000423149.1 this gene fragment and fragment 1 could be part of one single gene ENST00000423149.1 novel transcript ENST00000405864.1 protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) (PRKRIR) pseudogene ENST00000379426.1 novel protein ENST00000414691.2 novel protein similar to hamster androgen-dependent expressed protein ENST00000229583.5 NP_001137420.1 ENST00000379415.2 novel protein similar to hamster androgen-dependent expressed protein ENST00000379415.2 alternative 5' UTR ENST00000506810.1 alternative 5' UTR ENST00000412132.1 novel transcript ENST00000299540.6 S-adenosylmethionine decarboxylase 1 (AMD1) (1EC 4.1.1.50, ADOMETDC) pseudogene ENST00000456036.1 novel transcript ENST00000437559.1 novel transcript ENST00000491710.1 alternative 5' UTR ENST00000487103.1 alternative 5' UTR ENST00000379388.2 NP_002105.2 ENST00000478545.1 alternative 5' UTR ENST00000379375.5 endothelin 1 (ET1) ENST00000405924.1 SMT3 suppressor of mif two 3 homolog 1 (yeast) (SMT3H1) pseudogene ENST00000391491.2 novel protein identical to ribosomal protein L15 (RPL15) ENST00000457945.1 novel transcript ENST00000379350.1 novel protein (KIAA1733) ENST00000379348.2 novel protein (KIAA1733) ENST00000406205.2 novel protein (KIAA1733) ENST00000482982.1 novel protein (KIAA1733) ENST00000434977.1 novel protein (KIAA1733) ENST00000415087.1 novel protein (KIAA1733) ENST00000468142.1 novel protein (KIAA1733) ENST00000489548.1 novel protein (KIAA1733) ENST00000379335.3 novel protein (KIAA1733) ENST00000379329.1 novel protein (KIAA1733) ENST00000481706.1 novel protein (KIAA1733) ENST00000356436.4 alternatively spliced 5' UTR; shares translation with variant 1 ENST00000356436.4 novel transcript ENST00000356436.4 alternative 5' UTR ENST00000379300.3 novel protein (HSPC239) ENST00000452989.1 alternatively spliced 5' UTR; shares translation with variant 2 ENST00000452989.1 novel transcript ENST00000452989.1 alternative 5' UTR ENST00000450347.1 novel protein (HSPC239) ENST00000422136.1 alternatively spliced 5' UTR; shares translation with variant 1 ENST00000422136.1 alternative 5' UTR ENST00000422136.1 novel transcript ENST00000446018.1 alternatively spliced 5' UTR; shares translation with variant 2 ENST00000446018.1 novel transcript ENST00000446018.1 alternative 5' UTR ENST00000420456.1 alternatively spliced 5' UTR; shares translation with variant 2 ENST00000420456.1 novel transcript ENST00000420456.1 alternative 5' UTR ENST00000428109.1 alternatively spliced 5' UTR; shares translation with variant 1 ENST00000428109.1 novel transcript ENST00000428109.1 alternative 5' UTR ENST00000416436.1 alternatively spliced 5' UTR; shares translation with variant 1 ENST00000416436.1 novel transcript ENST00000416436.1 alternative 5' UTR ENST00000379291.1 alternatively spliced 5' UTR; shares translation with variant 1 ENST00000379291.1 alternative 5' UTR ENST00000379291.1 novel transcript ENST00000399446.2 novel transcript ENST00000379284.1 novel protein (FLJ23357) ENST00000379287.3 novel protein (FLJ20330) ENST00000379287.3 novel protein (FLJ20330, FLJ30569) ENST00000446001.1 novel transcript ENST00000406274.1 ribosomal protein s4x (Rps4x) pseudogene ENST00000379262.4 sirtuin silent mating type information regulation 2 homolog 5 (S. cerevisiae), variant 1 (FLJ20348) ENST00000379250.4 sirtuin silent mating type information regulation 2 homolog 5 (S. cerevisiae) ENST00000451315.2 retinoic acid repressible protein (RARG-1) ENST00000420088.1 novel protein ENST00000474485.1 retinoic acid repressible protein (RARG-1) ENST00000474485.1 alternatively spliced 3' UTR; shares translation with dJ223E5.2.1 ENST00000474485.1 alternative 3' UTR ENST00000011619.3 RAN binding protein 9 (RanBPM) ENST00000469916.1 RAN binding protein 9 (RanBPM) ENST00000488770.1 FLJ20958 ENST00000488763.1 alternative 5' UTR ENST00000420478.2 alternative 5' UTR ENST00000471906.1 alternative 5' UTR ENST00000423553.2 alternative 5' UTR ENST00000404272.1 mitochondrial ribosomal protein L35 (MRPL35) pseudogene ENST00000427011.1 novel transcript ENST00000379153.3 CD83 antigen (activated B lymphocytes, immunoglobulin superfamily) ENST00000455973.1 novel transcript ENST00000427276.1 novel transcript (FLJ32264) ENST00000456440.1 novel transcript ENST00000434947.1 novel transcript ENST00000414740.1 putative novel transcript ENST00000447179.1 putative novel transcript ENST00000437648.1 novel transcript ENST00000396909.3 ribosomal protein L6 (RPL6) (TAXREB107) pseudogene ENST00000341776.2 Jumonji homologue (mouse) ENST00000341776.2 Jumonji homolog (mouse) ENST00000341776.2 protein Q92833 has a different stop codon 19 aa further downstream because it jumps frame twice, circumventing the stopcodon in this entry. This could be due to a sequence error in the cDNA sequenceAL136162 ENST00000474854.1 novel transcript ENST00000441978.1 putative novel transcript ENST00000448802.1 ARPC3 actin related protein 2/3 complex, subunit 3 (21 kD) pseudogene ENST00000451285.1 putative novel transcript ENST00000408034.1 malate dehydrogenase pseudogene ENST00000407522.1 P53-induced protein PIGPC1 pseudogene ENST00000404531.1 pseudogene similar to part of eukaryotic translation initiation factor 2 subunit 2 (EIF2S2) ENST00000403169.1 mitochondrial 28S ribosomal protein S32 (MRP-S32) pseudogene ENST00000259727.4 3' end of GMP reductase (Guanosine 5'-monophosphate oxidoreductase, EC 1.6.6.8) ENST00000259727.4 guanosine monophosphate reductase (GMPR) ENST00000259727.4 continued as dJ467D16 in em:AL009031 ENST00000354384.5 novel transcript ENST00000425446.2 NP_001137413.1 ENST00000407586.1 ESD (esterase D/formylglutathione hydrolase) pseudogene ENST00000333817.6 60S ribosomal protein L7 (RPL7) pseudogene ENST00000403109.1 pseudogene similar to SMT3H2 ENST00000259963.3 family with sequence similarity 8, member A1 ENST00000262077.2 Continued_from bA68J15.1 in Em:AL157776 ENST00000262077.2 Continues_as bA14H3.5 in Em:AL138824 ENST00000262077.2 nucleoporin 153kD ENST00000262077.2 Continues_as bA68J15.1 in Em:AL157776 ENST00000262077.2 Continued_from bA500C11.1 in Em:AL138724 ENST00000407932.1 ribosomal protein S12 (RPS12) pseudogene ENST00000309983.4 thiopurine S-methyltransferase ENST00000244776.7 NP_001128181.1 ENST00000404856.1 RNA helicase pseudogene ENST00000407347.1 IMPDH1 (IMP (inosine monophosphate) dehydrogenase 1) pseudogene ENST00000447237.1 putative novel transcript ENST00000402485.1 ribosomal protein L21 (RPL21) pseudogene ENST00000443504.1 novel transcript ENST00000403848.1 ribosomal protein L5 (RPL5) (MSTP030) pseudogene ENST00000432171.1 novel transcript ENST00000449496.1 keratin 18 (KRT18) (CK18,CYK18) pseudogene ENST00000407697.1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 (UQCRFS1) pseudogene ENST00000424083.1 this gene and gene dJ471C18.1 may be part of the same gene ENST00000424083.1 novel transcript ENST00000450310.1 novel transcript ENST00000445568.1 this gene and gene dJ471C18.2.1 may be part of the same gene ENST00000445568.1 putative novel transcript ENST00000457670.1 putative novel transcript ENST00000447250.1 putative novel transcript ENST00000378700.3 inhibitor of DNA binding 4, dominant negative helix-loop-helix protein ENST00000446953.1 ribosomal protein L29 (RPL29) (HIP, HUMRPL29) pseudogene ENST00000449143.1 putative novel transcript ENST00000406791.1 pseudogene similar to tropomysin ENST00000346618.3 E2F transcription factor 3 (E2F-3, KIAA0075) ENST00000433182.1 putative novel transcript ENST00000378610.1 novel protein (FLJ20342) ENST00000378610.1 Continued_from dJ201D7.1 in Em:AL022717 ENST00000378610.1 Continues_as bA323B13.1.1 in Em:AL451080 ENST00000378610.1 Continues_as bA370N21.1.1 in Em:AL512405 ENST00000378610.1 Continues_as dJ348I23.1 in Em:AL035090 ENST00000378610.1 Continued_from dJ52M20.1 in Em:AL513015 ENST00000378610.1 Continued_from bA370N21.1.1 in Em:AL512405 ENST00000476517.1 Continues_as bA323B13.1.2 in Em:AL451080 ENST00000421167.1 novel transcript ENST00000426374.1 putative novel transcript ENST00000447728.1 putative novel transcript ENST00000404566.1 novel pseudogene ENST00000413255.1 novel transcript ENST00000444265.1 novel transcript ENST00000403247.2 similar to mesenchymal stem cell protein DSC92 ENST00000306482.1 prolactin ENST00000427775.1 novel transcript ENST00000420572.1 putative novel transcript ENST00000404015.1 ribosomal protein L6 (RPL6) pseudogene ENST00000402635.1 ferritin pseudogene ENST00000407089.1 serine palmitoyltransferase, long chain base subunit 1 (SPTLC1) pseudogene ENST00000405827.1 exonuclease FLJ12671 pseudogene ENST00000403629.1 heterogeneous nuclear ribonucleoprotein A1 (HNRPA1) pseudogene ENST00000378491.4 vesicular membrane protein p24 (vesicular membrain protein p24) (VMP)(p24) ENST00000378491.4 vesicular membrane protein p24 ENST00000463207.1 vesicular membrane protein p24 (vesicular membrain protein p24) (VMP)(p24) ENST00000463207.1 this variant and variant fragment bA260H5A.1.2 could be part of a single variant ENST00000475830.1 vesicular membrane protein p24 ENST00000475830.1 this variant and variant fragment bA260H5A.1.2 could be part of a single variant ENST00000378477.1 vesicular membrane protein p24 (vesicular membrain protein p24) (VMP)(p24) ENST00000378477.1 vesicular membrane protein p24 ENST00000468195.1 vesicular membrane protein p24 (vesicular membrain protein p24) (VMP)(p24) ENST00000468195.1 vesicular membrane protein p24 ENST00000378475.1 vesicular membrane protein p24 (vesicular membrain protein p24) (VMP)(p24) ENST00000378475.1 this variant and either of variant fragments bA31K13.2.2 or bA31K13.2.3 could be part of a single variant ENST00000378454.3 RU2 (RU2S) ENST00000378450.3 RU2 (RU2S) ENST00000436313.1 RU2 (RU2S) ENST00000274766.1 RU2 (RU2AS) ENST00000378386.3 MRS2-like magnesium homeostasis factor (S. cerevisiae) (HPT) ENST00000378353.1 MRS2-like magnesium homeostasis factor (S. cerevisiae) (HPT) ENST00000483634.1 MRS2-like magnesium homeostasis factor (S. cerevisiae) (HPT) ENST00000465103.1 MRS2-like magnesium homeostasis factor (S. cerevisiae) (HPT) ENST00000446191.1 MRS2-like magnesium homeostasis factor (S. cerevisiae) (HPT) ENST00000492917.1 glycosylphosphatidylinositol specific phospholipase D1 (GPLD1) (GPIPLD, PIGPLD, PIGPLD1) ENST00000230036.1 glycosylphosphatidylinositol specific phospholipase D1 (GPLD1) (GPIPLD, PIGPLD, PIGPLD1) ENST00000474784.1 glycosylphosphatidylinositol specific phospholipase D1 (GPLD1) (GPIPLD, PIGPLD, PIGPLD1) ENST00000378243.4 glycosylphosphatidylinositol specific phospholipase D1 (GPLD1) (GPIPLD, PIGPLD, PIGPLD1) ENST00000486892.1 glycosylphosphatidylinositol specific phospholipase D1 (GPLD1) (GPIPLD, PIGPLD, PIGPLD1) ENST00000475417.1 glycosylphosphatidylinositol specific phospholipase D1 (GPLD1) (GPIPLD, PIGPLD, PIGPLD1) ENST00000348925.2 NP_733936.1 ENST00000378214.3 KIAA0319 gene product ENST00000406052.1 keratin 8 (KRT8) pseudogene ENST00000378198.4 TRAF and TNF receptor-associated protein (TTRAP)(EAP2, AD022, MGC9099) ENST00000341060.3 TRAF and TNF receptor-associated protein (TTRAP)(EAP2, AD022, MGC9099) ENST00000478507.1 TRAF and TNF receptor-associated protein (TTRAP)(EAP2, AD022, MGC9099) ENST00000478285.1 TRAF and TNF receptor-associated protein (TTRAP)(EAP2, AD022, MGC9099) ENST00000480495.1 TRAF and TNF receptor-associated protein (TTRAP)(EAP2, AD022, MGC9099) ENST00000230048.3 novel protein (FLJ20501) ENST00000476436.1 novel transcript ENST00000378119.4 novel protein (FLJ12619) (DKFZP564G182) ENST00000465685.1 novel transcript ENST00000378102.3 novel protein (FLJ12619) (DKFZP564G182) ENST00000423504.1 EG327502.1 ENST00000407157.1 adaptor-related protein complex 3, sigma 1 subunit (AP3S1) (CLAPS3, Sigma3A) pseudogene ENST00000356509.3 alternative 5' UTR ENST00000378054.2 lternative_5'_UTR ENST00000476555.1 alternative 5' UTR ENST00000378059.3 alternative 5' UTR ENST00000378023.4 alternative 5' UTR ENST00000402100.1 cytochrome c oxidase polypeptide II pseudogene ENST00000414949.1 peptidylprolyl isomerase A (cyclophilin A) (PPIA) pseudogene ENST00000402854.1 argininosuccinate synthetase (ASS) (ASS1 CTLN1) pseudogene ENST00000428903.1 novel transcript ENST00000416595.1 novel transcript ENST00000424868.1 novel transcript ENST00000377993.1 cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMP-N-acetylneuraminate monooxygenase) (CSAH) ENST00000377989.3 cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMP-N-acetylneuraminate monooxygenase) (CSAH) ENST00000471416.1 This variant and variants 5 6 and 7 could be part of the same variant ENST00000471416.1 novel transcript ENST00000493257.1 This variant and variants 5 and 6 could be part of the same variant ENST00000493257.1 novel transcript ENST00000490939.1 This variant and variants 5 6 and 8 could be part of the same variant ENST00000490939.1 novel transcript ENST00000493981.1 This variant and variants 5 6 and 8 could be part of the same variant ENST00000493981.1 novel transcript ENST00000399346.2 cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMP-N-acetylneuraminate monooxygenase) (CSAH) ENST00000399346.2 This variant and variants 3 4 7 and 8 could be part of the same variant ENST00000458373.1 cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMP-N-acetylneuraminate monooxygenase) (CSAH) ENST00000462823.1 novel transcript ENST00000462823.1 This variant and variants 3 4 7 and 8 could be part of the same variant ENST00000407842.1 novel pseudogene ENST00000403776.1 novel pseudogene ENST00000407885.1 ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) (UBE2D3) (UBCH5C) pseudogene ENST00000401481.1 aryl hydrocarbon receptor (AHR) pseudogene ENST00000413898.1 novel transcript ENST00000493462.1 60S Ribosomal Protein L21 pseudogene ENST00000397093.2 heterogeneous nuclear ribonucleoprotein A3 (HNRPA3) (FBRNP, D10S102) pseudogene ENST00000377961.2 secretagogin (SECRET) ENST00000407805.1 PX19 pseudogene ENST00000369177.3 H2B histone family pseudogene ENST00000406683.1 H2A histone family pseudogene ENST00000377905.4 solute carrier family 17 (sodium phosphate), member 4 ENST00000476801.1 alternative 3' UTR ENST00000481949.2 alternative 3' UTR ENST00000505420.1 alternative 3' UTR ENST00000397060.4 NP_001091956.1 ENST00000361703.6 alternative 5' UTR ENST00000449356.2 alternative 5' UTR ENST00000454426.1 H2A (histone 2A) pseudogene ENST00000360488.3 sodium phosphate solute carrier family 17 member 2 ENST00000360488.3 Em:HSU91328 : Human hereditary haemochromatosis region, histone 2A-like protein gene, hereditary haemochromatosis (HLA-H) gene, RoRet gene, and sodium phosphate transporter (NPT3) gene, complete cds. ENST00000360488.3 sodium phosphate solute carrier family 17 member 2 protein ENST00000265425.3 sodium phosphate solute carrier family 17 member 2 protein ENST00000357085.2 ring finger protein 15 ENST00000352392.4 NP_620580.1 ENST00000396984.1 H2B histone family, member L ENST00000289316.2 novel histone 2B family member ENST00000289316.2 variant 1, alternatively spliced in 3' UTR ENST00000407692.1 novel pseudogene ENST00000404269.1 H1 Histone family pseudogene ENST00000356476.2 H3 histone family, member B ENST00000341023.1 H2A histone family, member G ENST00000405418.1 40S ribosomal protein S10 pseudogene 1 ENST00000403259.1 H2A histone family pseudogene ENST00000362070.3 H2A histone family, member K pseudogene (H2A/k) ENST00000377727.1 H4 histone family, member A ENST00000404612.1 histone H3 pseudogene ENST00000530653.1 alternative 5' UTR ENST00000527422.1 alternative 5' UTR ENST00000377708.2 alternative 3' UTR ENST00000396948.1 alternative 3' UTR ENST00000352867.2 NP_853509.1 ENST00000493275.1 alternative 5' UTR ENST00000472507.1 alternative 5' UTR ENST00000482842.1 alternative 5' UTR ENST00000416795.2 alternative 5' UTR ENST00000494184.1 alternative 5' UTR ENST00000483410.1 alternative 5' UTR ENST00000450085.2 alternative 5' UTR ENST00000425234.2 NP_001138481.1 ENST00000427334.1 alternative 5' UTR ENST00000506698.1 alternative 5' UTR ENST00000414912.2 NP_001138480.1 ENST00000494393.1 alternative 5' UTR ENST00000471353.1 alternative 5' UTR ENST00000496719.1 alternative 5' UTR ENST00000429381.1 NP_510961.1 ENST00000244513.6 butyrophilin, subfamily 1, member A1 ENST00000411553.1 novel transcript ENST00000377575.1 High-mobility group (nonhistone chromosomal) protein 17-like 3 ENST00000477243.1 high-mobility group (nonhistone chromosomal) protein 17-like 3 ENST00000274849.1 basal transcriptional activator HABT1 ENST00000406914.1 vomeronasal olfactory 1 receptor, chromosome 6-5 pseudogene (hs6V1-5p) ENST00000456172.1 possibly part of gene .3 ENST00000456172.1 novel transcript ENST00000471278.1 alternative 5' UTR ENST00000480036.1 alternative 5' UTR ENST00000403778.1 vomeronasal olfactory 1 receptor, chromosome 6-3 pseudogene (hs6V1-3p) ENST00000406212.1 vomeronasal olfactory 1 receptor, chromosome 6-4 pseudogene (hs6V1-4p) ENST00000407795.1 vomeronasal olfactory 1 receptor, chromosome 6-2 pseudogene (hs6V1-2p) ENST00000339812.2 H2B histone family, member R ENST00000356950.1 novel protein identical to H2B histone family, member A (H2BFA) ENST00000310599.2 60S ribosomal protein L10 (RPL10) pseudogene ENST00000447106.1 vomeronasal olfactory 1 receptor, chromosome 6-1 pseudogene (hs6V1-1p) ENST00000416749.1 zinc finger protein pseudogene ENST00000461521.1 alternative 5' UTR ENST00000417812.1 possible CA binding protein similar to NEFA ENST00000377419.1 starts in b34I8 (AL021918) ENST00000377419.1 zinc finger protein 184 (Kruppel-like) ENST00000401954.1 heterogeneous nuclear ribonucleoprotein A1 (HNRPA1) pseudogene ENST00000405625.1 CD83 antigen (activated B lymphocytes, immunoglobulin superfamily) pseudogene ENST00000404273.1 60S ribosomal protein L8 (RPL8) pseudogene ENST00000407924.1 novel pseudogene ENST00000404972.1 60S Ribosomal protein L30 (RPL30) pseudogene ENST00000406085.1 H4 histone family, member F, pseudogene ENST00000402707.1 histone H2B family, member I, pseudogene ENST00000405092.1 hypothetical protein pseudogene ENST00000406496.1 unitary_pseudogene ENST00000401788.1 KIAA0036 pseudogene ENST00000406313.1 olfactory receptor, family 2, subfamily W, member 2 pseudogene (hs6M1-30P) ENST00000406313.1 unitary_pseudogene ENST00000429302.1 unitary_pseudogene ENST00000432841.1 olfactory receptor, family 2, subfamily B, member 8 pseudogene (hs6M1-29P) ENST00000402365.1 olfactory receptor, family 1, subfamily F, member 12 pseudogene (hs6M1-35) ENST00000377325.1 zinc finger protein 165 ENST00000407632.1 zinc finger protein pseudogene ENST00000405929.1 C2H2 type zinc finger protein pseudogene ENST00000340487.4 novel SCAN box protein (FLJ22191) ENST00000330236.5 zinc finger protein 192 (LD5-1) ENST00000440790.2 novel transcript ENST00000405613.1 zinc finger protein pseudogene ENST00000402215.1 zinc finger protein pseudogene ENST00000469761.1 TOB1 or 2 (transducer of ERBB2, 1 or 2) pseudogene ENST00000531941.1 alternative 5' UTR ENST00000531979.1 alternative 5' UTR ENST00000343684.3 novel protein ENST00000423234.1 zinc finger protein SRE-ZBP pseudogene ENST00000396838.2 alternative 5' UTR ENST00000414429.1 alternative 5' UTR ENST00000344279.6 alternative 5' UTR ENST00000435857.1 alternative 5' UTR ENST00000414431.1 alternative 5' UTR ENST00000453745.1 alternative 5' UTR ENST00000439636.1 alternative 5' UTR ENST00000447021.1 alternative 5' UTR ENST00000426756.1 alternative 5' UTR ENST00000446222.1 alternative 5' UTR ENST00000434036.1 alternative 5' UTR ENST00000444081.1 alternative 5' UTR ENST00000439628.1 alternative 5' UTR ENST00000402553.1 olfactory receptor, family 2, subfamily E, member 1 pseudogene (hs6M1-9p) ENST00000474923.1 The final residue is a stop codon not a selenocysteine ENST00000469384.1 NP_003987.2 ENST00000456103.1 putative novel transcript ENST00000440244.1 FLJ30941 ENST00000483450.1 DKFZp686I2118 ENST00000441992.1 unitary_pseudogene ENST00000421799.1 unitary_pseudogene ENST00000356293.5 unitary_pseudogene ENST00000514827.1 unitary_pseudogene ENST00000377149.1 alternative 5' UTR ENST00000377132.1 FLJ46099 ENST00000434657.1 FLJ40394 ENST00000377012.4 alternative 3' UTR ENST00000462632.1 alternative 5' UTR ENST00000431798.2 Human Swiss-Prot :Q16653-2.1 ENST00000458236.1 DKFZp762B162 ENST00000476601.1 XXbac-BPG170G13.21-002 ENST00000416822.1 A known pseudogene that does not show protein matches on the F-map ENST00000360323.6 HLA-G1 ENST00000478355.1 HLA-G5 ENST00000376818.3 HLA-G2.2 ENST00000478519.1 HLA-G2.1 ENST00000376815.3 HLA-G3 ENST00000432679.1 A known pseudogene that does not show on the F-map ENST00000376797.3 antisense to HLA-J ENST00000444051.1 DKFZp686B1842 ENST00000431012.1 DKFZp686I0445 ENST00000376785.2 alternative 5' UTR ENST00000376773.1 alternative 5' UTR ENST00000463348.1 FLJ45422 ENST00000438412.1 FLJ31598 ENST00000438412.1 FLJ25550 ENST00000412685.1 FLJ31095 ENST00000442966.2 FLJ22638 ENST00000376630.4 FLJ25568 ENST00000376621.3 FLJ22738 ENST00000376557.3 FLJ90050 ENST00000470703.1 FLJ16455 ENST00000326195.8 DKFZp762E013 ENST00000441867.1 NAGNAG splice site ENST00000472267.1 DKFZp564H0223 ENST00000376483.4 FLJ13158 ENST00000329992.8 NP_079185.2 ENST00000329992.8 DKFZp547J097 ENST00000376473.5 FLJ45657 ENST00000274853.3 FLJ39770 ENST00000274853.3 DKFZp547M1314 ENST00000274853.3 DKFZp686K2113 ENST00000274853.3 FLJ42890 ENST00000399199.3 DKFZp686M1715 ENST00000376406.3 KIAA0170 ENST00000327892.8 FLJ25906 ENST00000376389.3 FLJ20809 ENST00000376389.3 RZPDo834H1118D ENST00000399196.1 FLJ40693 ENST00000502955.1 alternative 5' UTR ENST00000505066.1 alternative 5' UTR ENST00000460944.2 alternative 5' UTR ENST00000324771.8 alternative 5' UTR ENST00000505534.1 alternative 5' UTR ENST00000503180.1 alternative 5' UTR ENST00000508317.1 alternative 5' UTR ENST00000418800.2 alternative 5' UTR ENST00000509639.1 alternative 5' UTR ENST00000412274.2 alternative 5' UTR ENST00000507901.1 alternative 5' UTR ENST00000507046.1 alternative 5' UTR ENST00000437124.2 alternative 5' UTR ENST00000396342.2 alternative 5' UTR ENST00000504651.1 alternative 5' UTR ENST00000512694.1 alternative 5' UTR ENST00000515233.1 alternative 5' UTR ENST00000515881.1 alternative 5' UTR ENST00000513043.1 alternative 5' UTR ENST00000376569.3 alternative 5' UTR ENST00000511510.1 alternative 5' UTR ENST00000504927.1 alternative 5' UTR ENST00000428153.2 alternative 5' UTR ENST00000512336.1 alternative 5' UTR ENST00000421124.2 alternative 5' UTR ENST00000512725.1 alternative 5' UTR ENST00000504679.1 alternative 5' UTR ENST00000503670.1 alternative 5' UTR ENST00000376567.2 alternative 5' UTR ENST00000417521.1 FLJ27266 ENST00000376316.2 alternative 5' UTR ENST00000469358.1 FLJ43079 ENST00000473916.1 FLJ37164 ENST00000462446.1 DKFZp6660235 ENST00000376296.3 FLJ32050 ENST00000426185.1 FLJ37114 ENST00000467107.1 DKFZp686G23132 ENST00000396268.3 -002 and -007 are able to start at an upstream Met (when compared to usual start site). However, COX haplotype variants have a stop codon between the two Mets, preventing an alternative start site ENST00000376266.5 FLJ20197 ENST00000376266.5 RZPDo834B046D ENST00000376266.5 FLJ20526 ENST00000376266.5 FLJ20210 ENST00000440185.2 non-canonical donor splice site between exons 1 and 2 ENST00000451521.2 NP_001099033.1 ENST00000507459.1 alternative 5' UTR ENST00000508683.1 alternative 5' UTR ENST00000448162.2 alternative 5' UTR ENST00000503420.1 alternative 5' UTR ENST00000515274.1 non-canonical donor splice site between exons 1 and 2 ENST00000515274.1 alternative 5' UTR ENST00000507751.1 alternative 5' UTR ENST00000455279.2 alternative 5' UTR ENST00000412245.1 alternative 5' UTR ENST00000503934.1 alternative 5' UTR ENST00000502557.1 alternative 5' UTR ENST00000507829.1 alternative 5' UTR ENST00000507226.1 alternative 5' UTR ENST00000507892.1 alternative 5' UTR ENST00000506831.1 alternative 5' UTR ENST00000383331.4 FLJ40123 ENST00000383329.3 Q95604.1 ENST00000376222.2 FLJ36918 ENST00000414046.2 DKFZp686P19215 ENST00000460889.1 FLJ36634 ENST00000458640.1 alternative 5' UTR ENST00000481456.1 FLJ45868 ENST00000483251.1 NP_612139.1 ENST00000418386.2 RZPDo834H0626D ENST00000464526.1 DKFZp781G1336 ENST00000376096.1 Human Swiss-Prot O00453-9 ENST00000376099.1 alternative 5' UTR ENST00000433492.1 alternative 5' UTR ENST00000396107.1 alternative 5' UTR ENST00000396114.2 alternative 5' UTR ENST00000376090.2 alternative 5' UTR ENST00000396117.2 alternative 5' UTR ENST00000376089.2 alternative 5' UTR ENST00000376059.3 RZPDo834F1123D ENST00000376007.4 DKFZp686D09175 ENST00000375976.4 DKFZp686L0653 ENST00000435080.1 based on mouse cDNAs ENST00000451898.1 skips exon ENST00000375920.4 alternative 5' UTR ENST00000375906.1 alternative 5' UTR ENST00000440842.1 -G/GT TGG/- haplotypic or noncanonical? ENST00000375865.2 alternative 5' UTR ENST00000375866.2 alternative 5' UTR ENST00000395952.3 FLJ13132 ENST00000395952.3 FLJ10345 ENST00000492084.1 FLJ30693 ENST00000461287.1 subject to nonsense-mediated decay ENST00000375809.3 FLJ35073 ENST00000375792.3 FLJ25805 ENST00000375784.3 FLJ26262 ENST00000375750.3 alternative 5' UTR ENST00000425703.1 alternative 5' UTR ENST00000498473.1 DKFZp434C1615 ENST00000415669.2 NP_001034740.1 ENST00000375688.4 not organism-supported ENST00000467576.1 FLJ25524 ENST00000375661.5 RZPDo834D0124D ENST00000375661.5 RZPDo834F0523D ENST00000375652.2 FLJ38698 ENST00000491768.1 not organism-supported ENST00000229729.6 FLJ14491 ENST00000229729.6 DKFZp666M124 ENST00000494816.1 FLJ35547 ENST00000465429.1 FLJ32374 ENST00000413154.1 alternative 5' UTR ENST00000484636.1 alternative 5' UTR ENST00000486124.1 DKFZp779M0311 ENST00000475617.1 alternative 5' UTR ENST00000425368.2 FLJ27023 ENST00000498317.1 157263 157321 ENST00000454913.1 alternative 5' UTR ENST00000436289.2 alternative 5' UTR ENST00000426722.1 alternative 5' UTR ENST00000375349.3 alternative 5' UTR ENST00000375356.3 alternative 5' UTR ENST00000460018.1 alternative 5' UTR ENST00000519179.1 subject to nonsense-mediated decay ENST00000458633.1 FLJ30050 ENST00000418967.2 NP_000491.2 ENST00000435122.2 NP_001122062.1 ENST00000375156.3 FLJ23466 ENST00000495191.1 FLJ41430 ENST00000361568.2 DKFZp564P1516 ENST00000428388.2 subject to nonsense-mediated decay ENST00000422437.1 subject to nonsense-mediated decay ENST00000421600.1 subject to nonsense-mediated decay ENST00000333845.6 alternative 5' UTR ENST00000466239.1 FLJ44493 ENST00000490711.1 FLJ31784 ENST00000375067.3 secreted isoform ENST00000375055.2 soluble isoform ENST00000375043.3 alternative 5' UTR ENST00000474612.1 FLJ16302 ENST00000425033.1 FLJ41895 ENST00000360004.5 NP_002115.2 ENST00000422863.1 alternative 5' UTR ENST00000395364.1 alternative 3' UTR ENST00000395363.1 alternative 3' UTR ENST00000374949.2 alternative 3' UTR ENST00000399084.1 alternative 5' UTR ENST00000435145.2 FLJ40688 ENST00000438763.2 RZPDo834G0832D ENST00000438763.2 RZPDo834G0831D ENST00000395339.3 splice variant ENST00000374881.2 RZPDo834D1127D ENST00000464863.1 DKFZp686G10229 ENST00000374859.2 RZPDo834B0927D ENST00000486332.1 FLJ41500 ENST00000354258.4 DKFZp686L1859 ENST00000374843.4 RZPD0834G061D ENST00000374825.4 KIAA9001 ENST00000496118.1 alternative 5' UTR ENST00000374831.4 DKFZp686E1432 ENST00000374831.4 alternative 5' UTR ENST00000495733.1 FLJ31942 ENST00000482914.1 DKFZp313H139 ENST00000449025.1 DKFZp686N0336 ENST00000374675.3 alternative 5' UTR ENST00000445902.2 /AT-AC\ splicing between exons 10 and 11 ENST00000395131.1 alternative 5' UTR ENST00000374610.2 alternative 5' UTR ENST00000466866.1 non-canonical splicing between exons 5 and 6 ENST00000441117.1 alternative 5' UTR ENST00000266000.6 alternative 5' UTR ENST00000446403.1 alternative 5' UTR ENST00000453407.1 alternative 5' UTR ENST00000446511.1 alternative 5' UTR ENST00000427004.1 alternative 5' UTR ENST00000487667.1 not organism-supported ENST00000428274.1 alternative 5' UTR ENST00000418600.2 NP_006763.2 ENST00000487326.1 non-canonical splicing between exons 2 and 3 looks artefactual ENST00000374467.3 BCL2-antagonist/killer 1 ENST00000374316.4 inositol 1,4,5-triphosphate receptor, type 3 ENST00000293756.4 inositol hexaphosphate kinase 3 ENST00000508327.1 NP_001137416.1 ENST00000513701.1 alternative 5' UTR ENST00000266003.5 NP_001035198.1 ENST00000374181.3 glutamate receptor, metabotropic 4 ENST00000347617.6 high-mobility group (nonhistone chromosomal) protein variants I and Y variant 2 ENST00000327014.7 high-mobility group (nonhistone chromosomal) protein variants I and Y variant 1 ENST00000357318.2 high-mobility group (nonhistone chromosomal) protein variants I and Y variant 4 ENST00000478214.1 high-mobility group (nonhistone chromosomal) protein variants I and Y variant 3 ENST00000394990.4 alternative 5' UTR ENST00000481533.1 alternative 5' UTR ENST00000413013.2 alternative 5' UTR ENST00000468145.1 alternative 5' UTR ENST00000402419.1 ribosomal protein L35 (RPL35) pseudogene ENST00000429998.1 novel transcript ENST00000419956.1 Continued_from bA513I15.6 in Em:AL354740 ENST00000419956.1 novel transcript ENST00000358797.4 Continued_from bA302L10.1 in Em:AL355855 ENST00000358797.4 nudix (nucleoside diphosphate linked moiety X)-type motif 3 ENST00000358797.4 Continues_as dJ187N21.1 in Em:Z98036 ENST00000326199.8 ribosomal protein S10 ENST00000494077.1 alternatively spliced 5' UTR, shares translation with bA375E1.1.1 ENST00000494077.1 ribosomal protein S10 ENST00000494077.1 alternative 5' UTR ENST00000467531.1 alternatively spliced 5' UTR, shares translation with bA375E1.1.1 ENST00000467531.1 ribosomal protein S10 ENST00000467531.1 alternative 5' UTR ENST00000464218.1 alternatively spliced 5' UTR, shares translation with bA375E1.1.1 ENST00000464218.1 ribosomal protein S10 ENST00000464218.1 alternative 5' UTR ENST00000344700.3 ribosomal protein S10 ENST00000480942.1 ribosomal protein S10 ENST00000244458.2 protein kinase C and casein kinase substrate in neurons 1, variant 1 (KIAA1379) ENST00000374043.1 protein kinase C and casein kinase substrate in neurons 1 ENST00000493633.1 protein kinase C and casein kinase substrate in neurons 1 ENST00000486120.1 protein kinase C and casein kinase substrate in neurons 1 ENST00000487760.1 protein kinase C and casein kinase substrate in neurons 1 ENST00000339867.4 interferon induced transmembrane protein 2 (1-8D) or 3 (1-8U) (IFITM2, IFITM3) pseudogene ENST00000374023.3 novel protein ENST00000374023.3 novel protein (FLJ32402) ENST00000374026.3 novel protein (FLJ32402) ENST00000374021.1 novel protein (FLJ32402) ENST00000404151.1 ribosomal protein L7 (RPL7) pseudogene ENST00000404133.1 ribosomal protein L44 (RPL44) pseudogene ENST00000334441.4 ATPase, H+ transporting, lysosomal (vacuolar proton pump) 14kD (ATP6S14) pseudogene ENST00000408001.1 ribosomal protein S10 (RPS10) pseudogene ENST00000244520.5 small nuclear ribonucleoprotein polypeptide C ENST00000374018.1 small nuclear ribonucleoprotein polypeptide C ENST00000374017.3 small nuclear ribonucleoprotein polypeptide C ENST00000474635.1 small nuclear ribonucleoprotein polypeptide C ENST00000192788.5 novel protein (FLJ20302) ENST00000361288.4 TAF11 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 28 kD ENST00000360359.3 novel Ank, SAM (Sterile alpha motif) and Phosphotyrosine interaction (PTB/PID) domain containing protein (KIAA0229) ENST00000360359.3 continueas as bA527B17.1 in Em:AL591002 ENST00000470698.1 novel transcript ENST00000339579.4 heat shock 10kD protein 1 (chaperonin 10) (HSPE1) pseudogene ENST00000311875.5 NP_001087197.1 ENST00000505911.1 90002 ENST00000492680.2 alternative 5' UTR ENST00000507706.1 alternative 5' UTR ENST00000505400.1 alternative 5' UTR ENST00000274938.7 novel EGF-like and CUB domain protein similar to mouse signal peptide, CUB domain, EGF-like 1 (Scube1) and mouse and human CEGP1 ENST00000469195.1 alternative 5' UTR ENST00000402490.1 ribosomal protein L35A (RPL35A) pseudogene ENST00000316637.5 differentially expressed in FDCP 6 homolog (mouse) ENST00000444278.1 differentially expressed in FDCP 6 homolog (mouse) ENST00000468102.1 differentially expressed in FDCP 6 homolog (mouse) ENST00000311565.4 peroxisome proliferative activated receptor, delta ENST00000337400.2 peroxisome proliferative activated receptor, delta ENST00000436521.1 makorin, ring finger protein, pseudogene 2 ENST00000229769.2 Fanconi anemia, complementation group E ENST00000322203.6 ribosomal protein RPL10a ENST00000467020.1 ribosomal protein RPL10a ENST00000464112.1 ribosomal protein RPL10a ENST00000490335.1 ribosomal protein RPL10a ENST00000478340.1 ribosomal protein RPL10a ENST00000450618.1 novel transcript ENST00000403958.1 ribosomal protein S15A (RPS15A) pseudogene ENST00000337746.3 FK506 binding protein 5 (FKBP51) ENST00000337746.3 alternatively spliced 5' UTR; shares translation with dJ340B19.4 ENST00000337746.3 FK506 binding protein 5 (FKBP51), variants 1 and 2 ENST00000337746.3 alternative 5' UTR ENST00000407266.1 ribosomal protein L36 (RPL36) pseudogene ENST00000452048.1 novel transcript ENST00000373869.3 FLJ25390 ENST00000403727.1 UMP-CMP (uridine monophosphate - cytidine monophosphate) kinase pseudogene ENST00000403376.3 NP_997292 ENST00000467122.1 novel transcript ENST00000259938.2 colipase, pancreatic ENST00000373853.1 novel protein ENST00000496656.1 novel transcript ENST00000423325.2 non-canonical acceptor splice site between exons 2 and 3 ENST00000512445.1 non-canonical acceptor splice site between exons 3 and 4 ENST00000355574.2 alternative 5' UTR ENST00000472333.1 alternative 5' UTR ENST00000453556.1 nudix (nucleoside diphosphate linked moiety X) type 5 motif (nudt5) pseudogene ENST00000476951.1 mitogen-activated protein kinase 13, (PRKM13, SAPK4, P38DELTA) ENST00000373761.5 mitogen-activated protein kinase 13, (PRKM13, SAPK4, P38DELTA) ENST00000211287.4 mitogen-activated protein kinase 13, (PRKM13, SAPK4, P38DELTA) ENST00000373759.1 mitogen-activated protein kinase 13, (PRKM13, SAPK4, P38DELTA) ENST00000490334.1 mitogen-activated protein kinase 13, (PRKM13, SAPK4, P38DELTA) ENST00000526611.1 non-canonical splice donor site between exons 1 and 2 ENST00000499560.2 non-canonical splice donor site between exons 1 and 2 ENST00000446974.1 alternative 5' UTR ENST00000454960.1 alternative 5' UTR ENST00000532330.1 alternative 3' UTR ENST00000532330.1 not organism-supported ENST00000534400.1 not organism-supported ENST00000340181.4 ETS transcription factor TEL-2a (TEL-2) ENST00000373737.4 ETS transcription factor TEL-2a (TEL-2) ENST00000411643.1 putative novel transcript ENST00000459696.1 alternative 3' UTR ENST00000483557.1 alternative 5' UTR ENST00000498267.1 alternative 5' UTR ENST00000229812.7 serine/threonine kinase 38 (NDR) ENST00000373674.3 novel SCP-like extracellular protein ENST00000491324.1 novel transcript ENST00000373715.5 splicing factor, arginine/serine-rich 3 (SRP20) ENST00000477442.1 splicing factor, arginine/serine-rich 3 (SRP20) ENST00000454686.1 leucine aminopeptidase pseudogene ENST00000459970.1 cyclin-dependent kinase inhibitor 1A (p21, Cip1) ENST00000244741.5 cyclin-dependent kinase inhibitor 1A (p21, Cip1) ENST00000373711.1 cyclin-dependent kinase inhibitor 1A (p21, Cip1) ENST00000478800.1 cyclin-dependent kinase inhibitor 1A (p21, Cip1) ENST00000462537.1 cyclin-dependent kinase inhibitor 1A (p21, Cip1) ENST00000229824.6 novel ras family protein ENST00000494644.1 galanin receptor pseudogene ENST00000459703.1 novel transcript ENST00000244751.2 novel copine-like protein (KIAA1599) ENST00000493411.1 novel transcript ENST00000373699.5 peptidylprolyl isomerase (cyclophilin)-like 1 (CYPL1, CGI-124) ENST00000373699.5 peptidylprolyl isomerase (cyclophilin) like protein (CGI-124) ENST00000483552.1 peptidylprolyl isomerase (cyclophilin) like protein (CGI-124) ENST00000359359.2 novel protein (FLJ25357) ENST00000480824.1 novel protein (FLJ25357) ENST00000480824.1 alternative 5' UTR ENST00000480824.1 alternatively spliced in 5' UTR, shares CDS with dJ90K10.2.3 ENST00000355190.3 novel protein (FLJ25357) ENST00000373685.1 novel protein (FLJ25357) ENST00000416621.1 novel protein (FLJ25357) ENST00000426535.1 novel pseudogene ENST00000427609.1 putative novel transcript ENST00000373616.5 mitochondrial carrier homolog 1 (MTCH1) (CGI-64) ENST00000490662.1 novel transcript ENST00000373627.5 mitochondrial carrier homolog 1 (MTCH1) (CGI-64) ENST00000373550.3 mitochondrial carrier homolog 1 (MTCH1) (CGI-64) ENST00000471737.1 novel transcript ENST00000418541.2 mitochondrial carrier homolog 1 (MTCH1) (CGI-64) ENST00000492754.1 novel transcript ENST00000423336.1 possible pseudogene ENST00000423336.1 novel protein similar to cytochrome c oxidase subunit VIa polypeptide 1 (COX6A1) (COX6A, COX6AL) ENST00000373509.5 pim-1 oncogene (PIM) ENST00000468243.1 novel transcript ENST00000479509.1 novel transcript ENST00000488617.1 putative novel transcript ENST00000469731.1 NP_898901.1 ENST00000471097.1 novel transcript ENST00000373451.4 novel protein (containing KIAA0082 and FLJ22156) ENST00000455891.1 This variant and variants 1.4 1.5 1.6 and 1.7 could be part of the same variant ENST00000455891.1 novel protein (FLJ20341) ENST00000477843.1 This variant and variants 1.3 1.4 1.5 1.6 and 1.7 could be part of the same variant ENST00000477843.1 novel transcript ENST00000493656.1 This variant and variants 1.4 1.5 1.6 and 1.7 could be part of the same variant ENST00000493656.1 putative novel transcript ENST00000491004.1 This variant and variants 1.2 1.3 and 1.8 could be part of the same variant ENST00000491004.1 novel transcript ENST00000475364.1 novel protein ENST00000475364.1 This variant and variants 1.2 1.3 and 1.8 could be part of the same variant ENST00000457419.1 novel protein ENST00000457419.1 This variant and variants 1.2 1.3 and 1.8 could be part of the same variant ENST00000452299.1 novel protein ENST00000452299.1 This variant and variants 1.2 1.3 and 1.8 could be part of the same variant ENST00000373408.3 novel protein ENST00000411755.1 novel protein ENST00000445172.1 novel transcript ENST00000434901.1 novel transcript ENST00000414875.1 putative novel transcript ENST00000508399.1 alternative 5' UTR ENST00000415890.1 novel transcript ENST00000405398.1 pseudogene similar to an integrin Alpha-E precursor fragment ENST00000448738.1 putative novel transcript ENST00000314100.6 NP_689946.2 ENST00000497373.1 alternative 5' UTR ENST00000498633.1 alternative 5' UTR ENST00000413235.1 putative novel transcript ENST00000412822.1 putative novel transcript ENST00000404701.1 TRK-fused gene (TFG) pseudogene ENST00000470973.1 glyoxalase I (GLY1, lactoylglutathione lyase, lactoyl glutathione lyase) ENST00000373365.3 glyoxalase I (GLY1, lactoylglutathione lyase, lactoyl glutathione lyase) ENST00000439844.1 putative novel transcript ENST00000449981.2 dynein, axonemal, heavy polypeptide 8 (HDHC9) ENST00000449981.2 dynein, axonemal, heavy polypeptide 8, (HDHC9) ENST00000449981.2 not organism-supported ENST00000327475.6 not organism-supported ENST00000359357.3 dynein, axonemal, heavy polypeptide 8 (HDHC9) ENST00000359357.3 5' UTR ENST00000359357.3 dynein, axonemal, heavy polypeptide 8, (HDHC9) ENST00000394393.3 dynein, axonemal, heavy polypeptide 8 (HDHC9) (fragment) ENST00000404462.1 novel pseudogene similar to zuotin related factor-1 (ZRF1) (MPP11; MPHOSPH11) ENST00000418399.1 novel transcript ENST00000416948.1 novel transcript ENST00000453417.1 novel transcript ENST00000407768.1 pseudogene similar to part of 40S Ribosomal protein S2 (RPS2) ENST00000490892.1 RPS2 (40S ribosomal protein S2) pseudogene ENST00000373256.4 glucagon-like peptide 1 receptor ENST00000373249.1 novel protein (DKFZP434H012) ENST00000229903.4 novel protein (FLJ11101) ENST00000481599.1 novel transcript ENST00000405487.1 pseudogene similar to part of breast cancer antigen NY-BR-1 ENST00000359534.3 potassium channel, subfamily K, member 5 (TASK-2) ENST00000453413.2 NP_001128583.1 ENST00000425054.2 NP_001128577.1 ENST00000373227.4 NP_001128579.1 ENST00000437525.2 NP_001128578.1 ENST00000305491.5 novel pseudogene ENST00000398904.2 alternative 5' UTR ENST00000437947.1 novel transcript ENST00000373186.4 molybdenum cofactor synthesis 1 (molybdenum cofactor deficiency type A, MOCOD), variant 2 (MOCS1A, splice type I) ENST00000373186.4 This transcript has been described as bicistronic (Reiss et al. (1998) Nat. Genet. 20: 51-53) because a second ORF for a putative MOCS1B protein exists at 5697-4948. This second CDS has not been annotated because there is insufficent experimental evidence to support the translation of this region as a separate entity ENST00000373188.2 molybdenum cofactor synthesis 1 (molybdenum cofactor deficiency type A, MOCOD) ENST00000373188.2 This transcript is potentially bicistronic because a second ORF for a putative MOCS1B protein exists at 5697-4948. This second CDS has not been annotated because there is insufficent experimental evidence to support the translation of this region as a separate entity ENST00000373195.3 molybdenum cofactor synthesis 1 (molybdenum cofactor deficiency type A, MOCOD), variant 3 (MOCS1A-MOCS1B, splice type III) ENST00000425303.2 Based on human synthetic BC140421.1 ENST00000325612.5 pseudogene similar to 60S ribosomal protein L23 (RPL23) (L17) ENST00000405234.1 pseudogene similar to tubulin beta polypeptide (TUBB) ENST00000444731.1 putative novel transcript ENST00000448433.1 putative novel transcript ENST00000373170.2 putative novel transcript ENST00000451810.1 putative novel transcript ENST00000448559.1 putative novel transcript ENST00000373171.2 putative novel transcript ENST00000447315.1 putative novel transcript ENST00000338305.6 novel protein (KIAA1246) ENST00000338305.6 5' UTR ENST00000414505.1 putative novel transcript ENST00000442781.1 putative novel transcript ENST00000438818.1 novel transcript ENST00000373164.1 novel protein ENST00000470102.1 novel protein ENST00000463088.1 alternative 5' UTR ENST00000424266.2 alternative 5' UTR ENST00000480585.1 alternative 5' UTR ENST00000464633.1 alternative 5' UTR ENST00000468811.1 alternative 5' UTR ENST00000488238.1 alternative 5' UTR ENST00000469104.1 alternative 5' UTR ENST00000470917.1 alternative 5' UTR ENST00000244669.2 apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 2 ENST00000341376.6 nuclear transcription factor Y, alpha (CCAAT-Binding transcription factor subunit B, CBF-B, CAAT-Box DNA binding protein subunit A) ENST00000353205.5 nuclear transcription factor Y, alpha (CCAAT-Binding transcription factor subunit B, CBF-B, CAAT-Box DNA binding protein subunit A) ENST00000407855.1 soluble adenylyl cyclase (SAC) pseudogene ENST00000457653.2 soluble adenylyl cyclase (SAC) pseudogene ENST00000440573.1 putative novel transcript ENST00000435541.1 putative novel transcript ENST00000432833.1 putative novel transcript ENST00000373127.3 novel protein ENST00000373113.3 triggering receptor expressed on myeloid cells 2 (TREM2) ENST00000338469.3 triggering receptor expressed on myeloid cells 2 (TREM2) ENST00000457327.1 NKP44 pseudogene ENST00000448827.2 alternative 5' UTR ENST00000407513.1 TREM1 pseudogene ENST00000244709.3 triggering receptor expressed on myeloid cells 1 ENST00000422246.1 ribosomal protein L32 pseudogene ENST00000511642.1 NP_001129489.1 ENST00000372988.4 alternative 5' UTR ENST00000415497.2 NP_001129598.1 ENST00000414200.2 NP_001129597.1 ENST00000508143.1 alternative 5' UTR ENST00000505064.1 alternative 5' UTR ENST00000502771.1 alternative 5' UTR ENST00000514588.1 alternative 5' UTR ENST00000412701.1 putative novel transcript ENST00000494547.1 alternative 3' UTR ENST00000418175.1 alternative 5' UTR ENST00000053469.4 novel transcript ENST00000394237.1 FLJ43792 ENST00000394237.1 alternative 5' UTR ENST00000372958.1 guanylate cyclase activator 1A (retina) ENST00000372963.1 novel protein ENST00000230361.3 guanylate cyclase activator 1B (retina) ENST00000053468.3 mitochondrial ribosomal protein S10 (MRPS10) ENST00000372922.4 zinc finger transcription regulating protein TReP-132 ENST00000340840.2 zinc finger transcription regulating protein TReP-132 (RAPA-2) ENST00000354325.2 zinc finger transcription regulating protein TReP-132 (RAPA-1) ENST00000372899.1 KIAA0349 protein ENST00000230381.5 retinal degeneration, slow (retinitis pigmentosa 7) ENST00000417255.1 similar to ATP6C (nATPase, H+ transporting, lysosomal (vacuolar proton pump) 16kD) ENST00000372876.1 tubulin-specific chaperone c variant 1 ENST00000490059.1 tubulin-specific chaperone c variant 2 ENST00000440880.1 putative novel transcript ENST00000304734.5 alternative 3' UTR ENST00000450671.1 novel transcript ENST00000372808.3 glycine N-methyltransferase ENST00000304611.8 peroxisomal biogenesis factor 6 ENST00000394110.3 Non canonical donor splice site between exons 3 and 4 ENST00000432243.1 alternative 5' UTR ENST00000265348.3 Continued_from bA387M24.1.1 in Em:AL355385 ENST00000265348.3 novel protein (KIAA0076 KIAA0708) ENST00000265348.3 Continues_as dJ20C7.5.1 in Em:AL136304 ENST00000478630.1 novel transcript ENST00000259708.3 NP_958931.1 ENST00000479388.1 alternative 5' UTR ENST00000472792.1 alternative 5' UTR ENST00000460283.1 alternative 5' UTR ENST00000394056.2 alternative 5' UTR ENST00000481888.1 alternative 5' UTR ENST00000265354.4 serum response factor (c-fos serum response element-binding transcription factor) ENST00000265354.4 Continues_as dJ330M21.1 in Em:AL133375 ENST00000265354.4 Continued_from bA387M24.5 in Em:AL355385 ENST00000393987.2 NP_954653.1 ENST00000480882.1 solute carrier family 22 (organic anion transporter), member 7 (NLT, OAT2) ENST00000487175.1 solute carrier family 22 (organic anion transporter), member 7 (NLT, OAT2) ENST00000451757.1 solute carrier family 22 (organic anion transporter), member 7 (NLT, OAT2) ENST00000498232.1 solute carrier family 22 (organic anion transporter), member 7 (NLT, OAT2), variant 2 (isoform b) ENST00000449231.1 solute carrier family 22 (organic anion transporter), member 7 (NLT, OAT2) ENST00000372589.3 solute carrier family 22 (organic anion transporter), member 7 (NLT, OAT2), variant 1 (isoform a) ENST00000372585.5 solute carrier family 22 (organic anion transporter), member 7 (NLT, OAT2) ENST00000372574.3 solute carrier family 22 (organic anion transporter), member 7 (NLT, OAT2) ENST00000436107.1 solute carrier family 22 (organic anion transporter), member 7 (NLT, OAT2) ENST00000416431.1 novel protein ENST00000372569.3 novel protein similar to M. musculus thymus LIM protein TLP-A (LOC168153) ENST00000451294.1 novel protein ENST00000406185.1 ribosomal protein L12 (RPL12) pseudogene ENST00000406943.1 ribosomal protein L34 (RPL34) pseudogene ENST00000314255.4 ribosomal protein S2 (RPS2) pseudogene ENST00000428602.1 ribosomal protein S2 pseudogene ENST00000430324.1 novel protein ENST00000372485.1 novel protein ENST00000372488.3 alternatively spliced 5' UTR; shares CDS with dJ895C5.2.1 ENST00000372488.3 novel protein ENST00000372488.3 alternative 5' UTR ENST00000372496.1 novel protein ENST00000357338.3 alternatively spliced 5' UTR; shares CDS with dJ895C5.2.3 ENST00000357338.3 alternative 5' UTR ENST00000357338.3 novel protein (FLJ30818) similar to delta-like ENST00000442878.2 alternative 5' UTR ENST00000259751.1 novel protein, variant 1 (FLJ14207, FLJ23661) ENST00000259751.1 alternatively spliced 5' UTR; shares CDS with dJ337H4.1.2, dJ337H4.1.6 and dJ337H4.1.3 ENST00000259751.1 novel protein, variant 1 (FLJ14207) ENST00000259751.1 alternative 5' UTR ENST00000372454.1 novel protein ENST00000372454.1 alternatively spliced 5' UTR; shares CDS with dJ337H4.1.1, dJ337H4.1.3 and dJ337H4.1.6 ENST00000372454.1 alternative 5' UTR ENST00000372452.1 alternatively spliced 5' UTR; shares CDS with dJ337H4.1.1, dJ337H4.1.2 and dJ337H4.1.6 ENST00000372452.1 novel protein ENST00000372452.1 alternative 5' UTR ENST00000372449.1 alternatively spliced 5' UTR; shares CDS with dJ337H4.1.5 ENST00000372449.1 novel protein ENST00000372449.1 alternative 5' UTR ENST00000483640.1 novel transcript ENST00000478173.1 novel transcript ENST00000459851.1 novel transcript ENST00000490050.1 this variant fragment and variant fragments .1.8 could be part of a single variant ENST00000490050.1 novel transcript ENST00000454762.1 novel protein (DKFZp434D111) ENST00000468319.1 novel transcript ENST00000372441.1 novel protein ENST00000402069.1 40S ribosomal protein S2 (RPS2) pseudogene ENST00000372236.4 DNA directed polymerase eta (XP-V, RAD30A) ENST00000372226.1 DNA directed polymerase eta (XP-V, RAD30A) ENST00000443535.1 DNA directed polymerase eta (XP-V, RAD30A) ENST00000417591.1 putative novel transcript ENST00000496137.1 GTP binding protein 2 ENST00000476510.1 GTP binding protein 2 ENST00000478872.1 GTP binding protein 2 (FLJ20423) ENST00000419497.1 GTP binding protein 2 ENST00000432918.1 GTP binding protein 2 ENST00000484748.1 GTP binding protein 2 ENST00000307126.5 GTP binding protein 2 ENST00000459959.1 GTP binding protein 2 ENST00000442748.1 GTP binding protein 2 ENST00000480263.1 GTP binding protein 2 (GTPBP2) ENST00000452781.1 GTP binding protein 2 ENST00000451025.2 NP_001003690.1 ENST00000372165.4 novel protein (FLJ30845) ENST00000372163.4 novel protein ENST00000417236.1 novel protein ENST00000372133.3 mitochondrial ribosomal protein S18A (S18bmt, FLJ10548, MRPS18-3, HumanS18b, MRP-S18-3, mitochondrial ribosomal protein S18-3) ENST00000372116.1 mitochondrial ribosomal protein S18A (S18bmt, FLJ10548, MRPS18-3, HumanS18b, MRP-S18-3, mitochondrial ribosomal protein S18-3) ENST00000427312.1 mitochondrial ribosomal protein S18A (S18bmt, FLJ10548, MRPS18-3, HumanS18b, MRP-S18-3, mitochondrial ribosomal protein S18-3) ENST00000406079.1 novel pseudogene similar to OPA-interacting protein (OIP21) ENST00000424283.1 novel transcript ENST00000372067.3 non-ATG start codon ENST00000372067.3 NP_001020539.2 ENST00000324450.6 non-ATG start codon ENST00000324450.6 NP_001165093.1 ENST00000417285.2 non-ATG start codon ENST00000417285.2 NP_001020540.2 ENST00000413642.3 non-ATG start codon ENST00000413642.3 NP_001020538.2 ENST00000372055.4 non-ATG start codon ENST00000372055.4 NP_001020537.2 ENST00000482630.2 NP_001028928.1 ENST00000482630.2 non-ATG start codon ENST00000425836.2 NP_003367.4 ENST00000425836.2 non-ATG start codon ENST00000372064.4 non-ATG start codon ENST00000372064.4 NP_001020541.2 ENST00000372077.4 NP_001165099.1 ENST00000520948.1 NP_001165095.1 ENST00000523873.1 NP_001165094.1 ENST00000523950.1 NP_001165097.1 ENST00000457104.2 NP_001165101.1 ENST00000518689.1 NP_001165096.1 ENST00000523125.1 NP_001165098.1 ENST00000518824.1 NP_001165100.1 ENST00000451910.1 putative novel transcript ENST00000422059.1 novel transcript ENST00000455005.1 novel transcript ENST00000331979.5 ribosomal protein L29 (RPL29) pseudogene ENST00000372014.3 novel protein similar to ribosomal protein L14 (L14p/L23e) ENST00000372014.3 5' UTR ENST00000532634.1 alternative 5' UTR ENST00000427851.2 equilibrative nucleoside transporter 1 (solute carrier family 29, ENT1) ENST00000427851.2 alternatively spliced 5' UTR; shares CDS with variants dJ302G2.1.2 to dJ302G2.1.7 ENST00000427851.2 alternative 5' UTR ENST00000371755.3 equilibrative nucleoside transporter 1 (solute carrier family 29, ENT1) ENST00000371755.3 alternatively spliced 5' UTR; shares CDS with variants dJ302G2.1.1 and dJ302G2.1.3 to dJ302G2.1.7 ENST00000371755.3 alternative 5' UTR ENST00000371740.5 alternatively spliced 5' UTR; shares CDS with variants dJ302G2.1.1, dJ302G2.1.2 and dJ302G2.1.4 to dJ302G2.1.7 ENST00000371740.5 equilibrative nucleoside transporter 1 (solute carrier family 29, ENT1) ENST00000371740.5 alternative 5' UTR ENST00000371731.1 equilibrative nucleoside transporter 1 (solute carrier family 29, ENT1) ENST00000371731.1 alternatively spliced 5' UTR; shares CDS with variants dJ302G2.1.1 to dJ302G2.1.4, dJ302G2.1.6 and dJ302G2.1.7 ENST00000371731.1 alternative 5' UTR ENST00000371724.1 equilibrative nucleoside transporter 1 (solute carrier family 29, ENT1) ENST00000371724.1 alternatively spliced 5' UTR; shares CDS with variants dJ302G2.1.1 to dJ302G2.1.5 and dJ302G2.1.7 ENST00000371724.1 alternative 5' UTR ENST00000371713.1 equilibrative nucleoside transporter 1 (solute carrier family 29, ENT1) ENST00000371713.1 alternatively spliced 5' UTR; shares CDS with variants dJ302G2.1.1 to dJ302G2.1.6 ENST00000371713.1 alternative 5' UTR ENST00000371708.1 equilibrative nucleoside transporter 1 (solute carrier family 29, ENT1) ENST00000371708.1 alternatively spliced 5' UTR; shares CDS with variants dJ302G2.1.1 to dJ302G2.1.3 and dJ302G2.1.5 to dJ302G2.1.7 ENST00000371708.1 alternative 5' UTR ENST00000472176.1 equilibrative nucleoside transporter 1 (solute carrier family 29, ENT1) ENST00000371646.5 heat-shock 90 kDa protein 1, beta (HSPC2, D6S182, HSP90-BETA) ENST00000371646.5 alternatively spliced 5' UTR; shares CDS with dJ302G2.2.2 and dJ302G2.2.3 ENST00000371646.5 alternative 5' UTR ENST00000353801.3 heat-shock 90 kDa protein 1, beta (HSPC2, D6S182, HSP90-BETA) ENST00000353801.3 alternatively spliced 5' UTR; shares CDS with dJ302G2.2.1 and dJ302G2.2.3 ENST00000353801.3 alternative 5' UTR ENST00000441736.1 heat-shock 90 kDa protein 1, beta (HSPC2, D6S182, HSP90-BETA) ENST00000371554.1 heat-shock 90 kDa protein 1, beta (HSPC2, D6S182, HSP90-BETA) ENST00000371554.1 alternatively spliced 5' UTR; shares CDS with dJ302G2.2.1 and dJ302G2.2.2 ENST00000371554.1 alternative 5' UTR ENST00000435812.1 non-canonical splice acceptor site between exons 2 and 3 ENST00000435812.1 heat-shock 90 kDa protein 1, beta (HSPC2, D6S182, HSP90-BETA) ENST00000415133.1 heat-shock 90 kDa protein 1, beta (HSPC2, D6S182, HSP90-BETA) ENST00000428822.1 heat-shock 90 kDa protein 1, beta (HSPC2, D6S182, HSP90-BETA) ENST00000275015.4 nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon (IKBE) ENST00000477930.1 nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon (IKBE) ENST00000443607.1 nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon (IKBE) ENST00000443607.1 alternative 3' UTR ENST00000371505.4 novel protein (possible ortholog of mouse TCTE1) ENST00000371504.1 novel protein ENST00000244571.4 KIAA1270 ENST00000491573.1 novel transcript ENST00000371477.3 novel protein (possible ortholog of rodent CDC5-like protein) ENST00000371477.3 3' end of a novel protein (possible ortholog of rodent CDC5-like protein) ENST00000371477.3 continued as dJ319D22.1 in Em:AL133262 ENST00000436113.1 novel transcript ENST00000475057.1 suppressor of Ty 3 homolog (S. cerevisiae) ENST00000371458.1 suppressor of Ty 3 homolog (S. cerevisiae) ENST00000459689.1 suppressor of Ty 3 homolog (S. cerevisiae) ENST00000403227.1 novel pseudogene ENST00000405824.1 pseudogene similar to part of poly(rC) binding protein 3 (PCBP3) ENST00000448320.1 putative novel transcript ENST00000483243.1 runt-related transcription factor 2 ENST00000465038.1 NM_001024630 ENST00000371438.1 alternative 5' UTR ENST00000371436.6 NP_001015051.3 ENST00000473041.1 runt-related transcription factor 2 ENST00000487396.1 chloride intracellular channel 5 ENST00000487396.1 this variant and variants .3 or .4 could be part of the same variant ENST00000185206.6 chloride intracellular channel 5 ENST00000339561.6 chloride intracellular channel 5 ENST00000484572.1 chloride intracellular channel 5 ENST00000484572.1 this variant and variant .5 could be part of the same variant ENST00000486570.1 chloride intracellular channel 5 ENST00000486570.1 this variant and variant .5 could be part of the same variant ENST00000476852.1 chloride intracellular channel 5 ENST00000464137.1 chloride intracellular channel 5 ENST00000407577.1 novel pseudogene ENST00000444038.1 novel transcript ENST00000437249.1 novel transcript ENST00000371401.1 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative function) (NPP4, KIAA0879) ENST00000371383.1 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) ENST00000230565.3 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative function) ENST00000230565.3 alternatively spliced in 5' UTR, shares CDS with dJ8B1.3.1 ENST00000230565.3 alternative 5' UTR ENST00000492313.1 putative novel transcript ENST00000457622.1 actin, gamma pseudogene 9 ENST00000330430.6 Down syndrome critical region gene 1-like 1 (MCIP2 ZAKI-4) ENST00000371374.1 Down syndrome critical region gene 1-like 1 (MCIP2 ZAKI-4) ENST00000306764.7 Down syndrome critical region gene 1-like 1 (MCIP2 ZAKI-4) ENST00000415787.1 novel transcript ENST00000275016.2 cytochrome P450, subfamily XXXIX (oxysterol 7 alpha-hydroxylase), polypeptide 1 ENST00000489657.1 cytochrome P450, subfamily XXXIX (oxysterol 7 alpha-hydroxylase), polypeptide 1 ENST00000489657.1 This variant and variant .2 could be part of the same variant ENST00000476076.1 cytochrome P450, subfamily XXXIX (oxysterol 7 alpha-hydroxylase), polypeptide 1 ENST00000476076.1 This variant and variant .2 could be part of the same variant ENST00000480804.1 This variant and variants .5 and .4 could be part of the same variant ENST00000480804.1 cytochrome P450, subfamily XXXIX (oxysterol 7 alpha-hydroxylase), polypeptide 1 ENST00000418138.1 putative novel transcript ENST00000371347.3 uncoupling protein 4 (UCP4) ENST00000425120.1 this variant and variant 6 could be part of the same variant ENST00000425120.1 uncoupling protein 4 (UCP4) ENST00000498445.1 7 ENST00000498445.1 novel transcript ENST00000437459.1 uncoupling protein 4 (UCP4) ENST00000444329.1 uncoupling protein 4 (UCP4) ENST00000417490.1 uncoupling protein 4 (UCP4) ENST00000465620.1 this variant and variant 2 could be part of the same variant ENST00000465620.1 putative novel transcript ENST00000422284.1 novel transcript ENST00000434329.1 novel transcript ENST00000316081.6 novel tudor domain containing protein ENST00000450697.1 novel protein ENST00000274793.7 phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) (PAFAH, LDL-PLA2). ENST00000445060.1 novel transcript (FLJ33075) ENST00000438738.1 putative novel transcript ENST00000230588.4 meprin A, alpha (PABA peptide hydrolase) (PPHA) ENST00000265417.6 novel protein similar to KIAA0758 ENST00000498632.1 novel transcript ENST00000478711.1 novel transcript ENST00000451135.1 novel transcript ENST00000477858.1 novel transcript ENST00000296861.2 Tumor necrosis factor receptor superfamily member 21 (DR6) ENST00000479857.1 CD2-associated protein ENST00000412489.1 putative novel transcript ENST00000407698.1 40S ribosomal protein S12 (RPS12) pseudogene ENST00000507065.1 confirm experimentally ENST00000296862.1 confirm experimentally ENST00000467205.2 confirm experimentally ENST00000446733.1 putative novel transcript ENST00000403255.1 ribosomal protein L27A (RPL27A) pseudogene ENST00000427514.1 heterogeneous nuclear ribonucleoprotein pseudogene ENST00000408004.1 RNA binding motif protein, X chromosome pseudogene 1 ENST00000404962.1 pseudogene similar to part of myotubularin related protein 9 MTMR9 ENST00000402892.1 zinc finger pseudogene (ZNF216) ENST00000406701.1 eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) pseudogene ENST00000274813.3 methylmalonyl Coenzyme A mutase ENST00000371200.1 Continued_from bA463L20.2 in Em:AL590668 ENST00000371200.1 novel protein ENST00000545705.1 alternative 5' UTR ENST00000407830.1 cytochrome P450 pseudogene ENST00000371175.4 Continues_as bA28H17.5 in Em:AL590244 ENST00000371175.4 Rhesus blood group-associated glycoprotein (RH50A) ENST00000371175.4 Continued_from dJ442L6.1 in Em:AL121950 ENST00000263045.4 NP_006052.2 ENST00000423040.1 Continued_from bA719J20.1 in Em:AL359458 ENST00000423040.1 novel transcript ENST00000437859.1 novel transcript ENST00000430821.1 Continues_as dJ417L20.3 in Em:AL121974 ENST00000430821.1 novel transcript ENST00000505118.1 alternative 5' UTR ENST00000415106.1 novel transcript ENST00000426547.1 putative novel transcript ENST00000454135.1 novel transcript ENST00000431394.1 novel transcript ENST00000008391.3 novel protein similar to transcription factor AP-2 ENST00000492804.1 novel transcript ENST00000393655.2 transcription factor AP-2 beta (activating enhancer-binding protein 2 beta) ENST00000344788.3 transcription factor AP-2 beta (activating enhancer-binding protein 2 beta) ENST00000489228.1 transcription factor AP-2 beta (activating enhancer-binding protein 2 beta) ENST00000402760.2 pseudogene similar to part of nuclear transport receptor MTR10A ENST00000425761.1 FTH1 (ferritin, heavy polypeptide 1) (FTHL6) pseudogene ENST00000416077.1 Wilms' tumour 1-associating protein (WTAP) (KIAA0105) pseudogene ENST00000398713.2 ribosomal protein S15a (RPS15A) pseudogene ENST00000454361.1 putative novel transcript ENST00000371117.3 polycystic kidney and hepatic disease 1 (autosomal recessive) (TIG multiple domains-1) (PKHD1)(FCYT, ARPKD) ENST00000340994.4 polycystic kidney and hepatic disease 1 (autosomal recessive) (TIG multiple domains-1) (PKHD1)(FCYT, ARPKD) ENST00000418518.1 novel transcript ENST00000340057.1 interleukin 17 (cytotoxic T-lymphocyte-associated serine esterase 8) (CTLA8) ENST00000336123.4 Human Swiss-Prot Q96PD4.3 ENST00000336123.4 NP_443104.1 ENST00000408043.1 CACT (carnitine/acylcarnitine translocase) pseudogene ENST00000229854.5 MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) ENST00000421471.1 MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) ENST00000476448.1 this variant and variant 2 could be part of the same variant ENST00000476448.1 novel transcript ENST00000462365.1 this variant and variant 3 could be part of the same variant ENST00000462365.1 novel transcript ENST00000512121.1 alternative 5' UTR ENST00000360726.3 alternative 5' UTR ENST00000449181.1 novel transcript ENST00000371068.4 novel protein (FLJ10466) ENST00000371068.4 novel protein with possible Calmodulin like calcium-binding domains ENST00000480623.1 novel protein ENST00000480623.1 novel transcript ENST00000491749.1 novel transcript ENST00000481466.1 novel transcript ENST00000182527.3 TRAM-like protein (KIAA0057) ENST00000453216.1 novel transcript ENST00000406724.1 HNRNP A/B related protein pseudogene ENST00000211314.4 PTD011 protein ENST00000404253.1 glutathione S-transferase pseudogene ENST00000438425.1 Glutathione S-transferase Alpha 1 (GSTA1) pseudogene ENST00000493422.1 glutathione S-transferase A2 ENST00000402398.1 glutathione S-transferase pseudogene ENST00000334575.5 glutathione S-transferase A1 ENST00000493331.1 glutathione S-transferase A1 ENST00000476213.1 glutathione S-transferase A1 ENST00000424144.1 glutathione S-transferase A (GSTA) family pseudogene ENST00000370989.1 novel glutathione S-transferase A (GSTA) family member ENST00000475052.1 novel glutathione S-transferase A (GSTA) family member ENST00000452866.1 glutathione S-transferase A (GSTA) family pseudogene ENST00000412182.1 glutathione S-transferase A (GSTA) family pseudogene ENST00000370968.1 glutathione S-transferase A3 ENST00000489165.1 glutathione S-transferase A3 ENST00000211122.3 glutathione S-transferase A3 ENST00000431899.1 glutathione S-transferase A3 ENST00000431899.1 non canonical splice donor and acceptor sites between exons 3 and 4 ENST00000448991.1 putative novel transcript ENST00000406231.1 glutathione S-transferase A family pseudogene ENST00000370963.4 Continued_from dJ132F22.1 in Em:AL162581 ENST00000370963.4 glutathione S-transferase A4 ENST00000477599.1 glutathione S-transferase A4 ENST00000486559.1 glutathione S-transferase A4 ENST00000370960.1 glutathione S-transferase A4 ENST00000370959.1 glutathione S-transferase A4 ENST00000457564.1 glutathione S-transferase A4 ENST00000350082.5 MAK-related kinase (KIAA0936) ENST00000350082.5 Continued_from dJ341E18.1 in Em:AL031178 ENST00000350082.5 KIAA0936 (MAK-related kinase) ENST00000350082.5 Continues_as dJ132F22.2 in Em:AL162581 ENST00000498744.1 alternative 5' UTR ENST00000323557.7 F-box only protein 9 (FBX9,NY-REN-57) ENST00000473337.1 alternative 5' UTR ENST00000244426.6 F-box only protein 9 (FBX9,NY-REN-57) ENST00000259803.7 glial cells missing homolog (Drosophila) ENST00000407803.1 superoxide dismutase (SOD) pseudogene ENST00000394808.2 CHC1 pseudogene ENST00000402555.1 high mobility group protein pseudogene ENST00000304434.6 homolog of yeast long chain polyunsaturated fatty acid elongation enzyme 2 (HELO1) ENST00000485336.1 novel transcript ENST00000465983.1 novel transcript ENST00000486973.1 novel transcript ENST00000370913.5 novel protein ENST00000406501.1 40S Ribosomal protein S16 (RPS16) pseudogene ENST00000406329.1 60S Ribosomal protein L31 (RPL31) pseudogene ENST00000407447.1 60S ribosomal protein L31 (RPL31) pseudogene ENST00000402839.1 replication protein A3 (RPA3) pseudogene ENST00000457637.1 novel transcript ENST00000505197.1 alternative 5' UTR ENST00000448327.1 novel transcript ENST00000407079.1 novel protein with BTB/POZ (broad complex Tramtrack bric-a-brac/Pox virus and zinc finger) domain ENST00000453790.1 novel transcript ENST00000429053.1 novel transcript ENST00000460844.2 alternative 5' UTR ENST00000441845.1 novel transcript ENST00000402323.1 enhancer of rudimentary homolog (Drosophila)(ERH) pseudogene ENST00000434196.1 putative novel transcript ENST00000486436.1 novel transcript ENST00000370869.3 tubulointerstitial nephritis antigen ENST00000259782.4 tubulointerstitial nephritis antigen ENST00000370865.1 tubulointerstitial nephritis antigen ENST00000370864.3 tubulointerstitial nephritis antigen ENST00000421465.1 putative novel transcript ENST00000435954.2 similar to CLNS1B (chloride channel, nucleotide-sensitive, 1B) ENST00000403509.1 RPL10 (ribosomal protein L10) pseudogene ENST00000406712.1 LAMR1 (laminin receptor 1, ribosomal protein SA) pseudogene ENST00000407852.2 part of the transforming protein P21A (K-RAS) (C-K-RAS) pseudogene ENST00000407852.2 Transforming protein P21A (K-RAS) (C-K-RAS) pseudogene ENST00000425089.1 putative novel transcript ENST00000306858.7 novel protein ENST00000405336.1 NIFU-like protein pseudogene ENST00000370830.3 bone morphogenetic protein 5 ENST00000415681.1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1)(B23, NPM) pseudogene ENST00000488912.1 non-canonical splice donor at exon 1 ENST00000244728.5 non-canonical splice donor at exon 14 ENST00000370819.1 non-canonical splice donor at exon 13 ENST00000467045.1 collagen, type XXI, alpha 1 ENST00000467216.1 non canonical TEC ENST00000467216.1 collagen, type XXI, alpha 1 ENST00000461489.1 collagen, type XXI, alpha 1 ENST00000484987.1 collagen, type XXI, alpha 1 ENST00000469682.1 collagen, type XXI, alpha 1 ENST00000456983.1 collagen, type XXI, alpha 1 ENST00000370817.3 alternative 5' UTR ENST00000401776.1 pseudogene similar to part of dihydrofolate reductase (DHFR) ENST00000415663.1 putative novel transcript ENST00000405832.1 KIAA1470 pseudogene ENST00000426453.1 novel transcript ENST00000407033.1 ribosomal protein L17 (RPL17) pseudogene ENST00000495359.1 non-canonical splice acceptor site at exon 6 ENST00000495359.1 novel protein, variant 1 (FLJ30162) ENST00000370746.3 novel protein ENST00000370745.1 novel protein ENST00000484701.1 novel transcript ENST00000407493.1 novel pseudogene ENST00000406984.1 ferritin, heavy polypeptide 1 (FTH1) pseudogene ENST00000370733.4 novel protein ENST00000488682.1 novel transcript ENST00000370711.5 Non canonical donor splice site between exons 4 and 5 ENST00000509071.1 Non canonical donor splice site between exons 3 and 4 ENST00000416069.1 novel transcript ENST00000370693.4 BCL2-associated athanogene 2 ENST00000438730.1 BCL2-associated athanogene 2 ENST00000344445.4 member RAS oncogene family variant 2 ENST00000468148.1 member RAS oncogene family variant 1 ENST00000370687.2 alternative 5' UTR ENST00000421261.1 sense intronic ENST00000429582.2 glyceraldehyde-3-phosphate dehydrogenase (GAPD) pseudogene ENST00000456887.1 novel transcript ENST00000399980.2 retinoblastoma binding protein 4 (RBBP4) pseudogene ENST00000440989.1 novel transcript ENST00000423899.1 glucuronidase, beta (GUSB) pseudogene ENST00000406100.1 novel pseudogene ENST00000420759.1 novel transcript ENST00000398586.2 glyceraldehyde-3-phosphate dehydrogenase (GAPD) pseudogene ENST00000404226.1 KIAA0797 pseudogene ENST00000398588.2 retinoblastoma binding protein 4 (RBBP4) pseudogene ENST00000457561.1 putative novel transcript ENST00000405826.1 proteasome subunit alpha type 4 (PROS29) pseudogene ENST00000511849.1 could be a splice variant of dJ240B8.1 ENST00000511849.1 novel transcript ENST00000281156.3 KH domain containing, RNA binding, signal transduction associated 2 ENST00000406944.1 dihydrofolate reductase (DHFR) pseudogene ENST00000405686.1 ribosomal protein S17 (RPS17) pseudogene ENST00000403497.1 pseudogene similar to part of keratin 8 (KRT8) ENST00000370659.1 novel protein similar to FK506-binding protein (FKBP-12) (Peptidyl-prolyl cis-trans isomerase)(PPiase) (Rotamase) ENST00000403408.1 pseudogene similar to part of serine palmitoyltransferase long chain base subunit 1(SPTLC1) ENST00000495602.1 novel pseudogene ENST00000485906.1 lengsin (EC 6.3.1.2) (LGS) ENST00000485906.1 alternative 3' UTR ENST00000485906.1 alternatively spliced 3' UTR, shares CDS with bA298M2.2.2 ENST00000370657.4 lengsin (EC 6.3.1.2) (LGS) ENST00000406684.1 novel pseudogene ENST00000403446.1 pseudogene similar to part of hypothetical protein FLJ22757 ENST00000402043.1 hypothetical protein PRO1855 pseudogene ENST00000444820.1 eukaryotic translation elongation factor 1 beta 2 pseudogene ENST00000470661.1 novel transcript ENST00000370651.2 protein tyrosine phosphatase type IVA member 1 ENST00000473334.1 novel transcript ENST00000370644.1 protein tyrosine phosphatase type IVA member 1 ENST00000416120.1 ribosomal protein L7A (RPL7A) pseudogene ENST00000439124.1 60S ribosomal protein L9 (RPL9) pseudogene ENST00000262043.3 PHD finger protein 3 ENST00000494284.2 novel transcript ENST00000406535.1 pseudogene similar to part of platelet-activating factor acetylhydrolase variant I alpha subunit (45kD) (PAFAH1B1)(LIS1, MDCR, PAFAHb) ENST00000429530.1 putative novel transcript ENST00000404096.1 pseudogene similar to part of glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) (GCNT1)(G6NT, C2GNT, NACGT2, NAGCT2, C2GNT-L) ENST00000424274.1 novel transcript ENST00000406475.1 pseudogene similar to part of an heterogeneous nuclear ribonucleoprotein family protein ENST00000421170.1 putative novel transcript ENST00000433531.1 putative novel transcript ENST00000402154.1 DKFZP564K1964 protein pseudogene ENST00000398578.2 KIAA0663 pseudogene ENST00000450674.1 putative novel transcript ENST00000468432.1 novel pseudogene ENST00000402902.1 nuclear fragile X mental retardation protein interacting protein 1 (NUFIP1) pseudogene ENST00000449928.1 putative novel transcript ENST00000445346.1 putative novel transcript ENST00000406616.1 C2H2 zinc finger protein pseudogene ENST00000419979.1 novel transcript ENST00000370598.1 brain-specific angiogenesis inhibitor 3 ENST00000370577.3 novel protein (CD001, BM-021, FLJ11240) ENST00000370577.3 novel protein, variant 1 (FLJ11240, MSTP044) ENST00000370570.1 novel protein, variant 3 (BM-021) ENST00000472827.1 novel protein ENST00000403105.1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1) pseudogene ENST00000406848.1 glyceraldehyde-3-phosphate dehydrogenase (GAPD) pseudogene ENST00000322773.4 NP_001849 ENST00000404509.1 ribosomal protein L37 (RPL37) pseudogene ENST00000357250.6 NP_001842.3 ENST00000418403.1 novel transcript ENST00000515323.1 alternative 5' UTR ENST00000515280.1 alternative 5' UTR ENST00000507085.1 alternative 5' UTR ENST00000370474.3 novel protein ENST00000468640.1 novel transcript ENST00000454078.1 spermine synthase (SMS) pseudogene ENST00000404247.1 solute carrier family 25, mitochondrial carrier, adenine nucleotide translocator, member 6 (SLC25A6) pseudogene ENST00000370452.3 novel protein, variant 4 (FLJ13159) ENST00000316999.5 stromal membrane-associated protein (SMAP1), variant 5 (B) ENST00000370455.3 stromal membrane-associated protein (SMAP1), variant 1 (A) ENST00000370455.3 stromal membrane-associated protein (SMAP1, variant 1 (A) ENST00000445046.1 novel protein ENST00000439432.1 novel protein ENST00000404262.1 NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex 1, (8kD, SDAP) (NDUFAB1) pseudogene ENST00000230053.6 beta-1,3-glucuronyltransferase 2 (glucuronosyltransferase S) (GLCATS, KIAA1963) ENST00000407947.1 beclin 1 (BECN1) pseudogene ENST00000402650.1 lysophospholipase I (LYPLA1) pseudogene ENST00000370435.3 novel protein similar to opioid growth factor receptor ENST00000467503.1 novel transcript ENST00000456795.1 putative novel transcript ENST00000413945.1 putative novel transcript ENST00000421704.1 novel transcript ENST00000441570.1 novel transcript ENST00000436803.1 novel transcript ENST00000426635.1 FLJ13189 ENST00000431997.1 novel transcript ENST00000403583.1 mesenchymal stem cell protein DSC92 pseudogene ENST00000405746.1 keratin 19 (KRT19) pseudogene ENST00000406139.1 forkhead box H1 (FOXH1) pseudogene ENST00000405153.1 pseudogene similar to part of polymerase (DNA directed), delta 1, catalytic subunit (POLD1) ENST00000428697.1 novel pseudogene ENST00000445310.1 novel transcript ENST00000445020.1 pseudogene similar to hypothetical proteins from various model organisms ENST00000423730.2 subject to nonsense-mediated decay ENST00000415954.2 NP_001116698.1 ENST00000309268.6 variant 9; alternatively spliced in 5' UTR ENST00000331523.2 variant 4; alternatively spliced in 5' UTR ENST00000495333.1 eukaryotic translation elongation factor 1 alpha 1 ENST00000455918.1 eukaryotic translation elongation factor 1 alpha 1 ENST00000355773.5 solute carrier family 17 (anion/sugar transporter), member 5 ENST00000481996.1 solute carrier family 17 (anion/sugar transporter), member 5 ENST00000402023.1 ribosomal S27 protein pseudogene ENST00000428865.1 putative novel transcript ENST00000287097.4 CD109 ENST00000474094.1 novel transcript ENST00000406296.1 thioredoxin (TXN) pseudogene ENST00000435946.1 novel transcript ENST00000404728.1 novel FLJ14668 containing pseudogene ENST00000432484.1 novel transcript ENST00000436672.1 putative novel transcript ENST00000401875.1 pseudogene similar to part of ubiquinol-cytochrome c reductase core protein II (UQCRC2) ENST00000421318.1 putative novel transcript ENST00000406203.1 nucleoporin 50kD (NUP50) (NPAP60, NPAP60L) pseudogene ENST00000370081.2 NP_001856.2 ENST00000370089.2 alternative 5' UTR ENST00000518161.1 alternative 5' UTR ENST00000438676.1 novel transcript ENST00000237172.7 novel protein (5730485H21Rik) ENST00000237172.7 novel protein (KIAA1275)(contains FLJ10708 and FLJ14799) ENST00000237172.7 novel transcript ENST00000498523.1 novel protein (KIAA1275)(contains FLJ10708 and FLJ14799) ENST00000370020.1 novel protein (KIAA1275)(contains FLJ10708 and FLJ14799) ENST00000370020.1 novel protein (KIAA1275) ENST00000366304.3 high-mobility group (nonhistone chromosomal) protein 1 (HMG1)(HMG3, HMGB1) pseudogene ENST00000419709.1 novel transcript ENST00000415457.1 putative novel transcript ENST00000440220.1 novel transcript ENST00000455530.1 novel transcript ENST00000407776.1 ubiquitin-conjugating enzyme E2 family pseudogene ENST00000403318.1 60S ribosomal protein L26 pseudogene ENST00000402607.1 H3 histone, family 3A (H3F3A)(H3F3, H3.3A) pseudogene ENST00000369985.3 myosin VI (DFNA22, KIAA0389) ENST00000369977.3 myosin VI (DFNA22, KIAA0389) ENST00000369975.1 myosin VI (DFNA22, KIAA0389) ENST00000462633.1 Myosin VI ENST00000462633.1 this variant and variant 5 could be part of the same variant ENST00000430435.1 Myosin VI ENST00000430435.1 this variant and variant 4 could be part of the same variant ENST00000369950.3 Interphotoreceptor matrix proteoglycan 1 ENST00000369952.3 Interphotoreceptor matrix proteoglycan 1 ENST00000440811.1 Novel pseudogene ENST00000406279.1 ribosomal protein S6 (RPS6) pseudogene ENST00000449463.1 putative novel transcript ENST00000430931.1 novel transcript ENST00000369940.1 novel protein (likely ortholog of mouse putative IKK regulator SIMPL) ENST00000275034.3 Continues_as bA173D14.2.1 in Em:AL450327 ENST00000275034.3 similar to WD40 repeat domain 11 protein (WDR11) ENST00000275034.3 Continued_from bA477E3.1.1 in Em:AL356776 ENST00000479165.1 Continues_as bA173D14.2.2 in Em:AL450327 ENST00000479165.1 similar to WD40 repeat domain 11 protein (WDR11) ENST00000479165.1 Continued_from bA477E3.1.2 in Em:AL356776 ENST00000406574.1 nucleoporin pseudogene ENST00000344726.5 thyroid hormone receptor interactor 7 ENST00000275036.7 thyroid hormone receptor interactor 7 ENST00000435151.1 putative novel transcript ENST00000406706.1 ribosomal protein S18 (RPS18) pseudogene ENST00000405542.1 A heat shock protein (DNAJ) pseudogene ENST00000444542.1 high-mobility group (nonhistone chromosomal) protein (HMG17) pseudogene ENST00000429444.1 novel transcript ENST00000401435.1 diazepam binding inhibitor (DBI) pseudogene ENST00000369838.4 SH3 domain binding glutamic acid-rich protein like 2 ENST00000438797.1 novel transcript ENST00000403623.1 novel pseudogene ENST00000436418.1 putative novel transcript ENST00000369816.4 elongation of very long chain fatty acids (FEN1/ELo2, SUR4/ELo3, yeast)-like 4 (ADMD, STGD3, STGD2) ENST00000405405.2 GAPD (glyceraldehyde-3-phosphate dehydrogenase) pseudogene ENST00000404414.1 RPL35A (60S ribosomal protein L35A) pseudogene ENST00000509894.1 alternative 5' UTR ENST00000502580.1 alternative 5' UTR ENST00000511260.1 alternative 5' UTR ENST00000504040.1 alternative 5' UTR ENST00000401578.1 RhoGAP and PH domain-containing KIAA1424 pseudogene ENST00000404520.1 adenylate kinase 3 (AK3) pseudogene ENST00000369760.4 branched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease) ENST00000320393.5 alternatively spliced 3' UTR; shares CDS with dJ279A18.1.2 ENST00000320393.5 alternative 3' UTR ENST00000320393.5 branched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease) ENST00000356489.5 alternative 3' UTR ENST00000356489.5 branched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease) ENST00000356489.5 alternatively spliced 3' UTR; shares CDS with dJ279A18.1.1 ENST00000486968.1 branched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease) ENST00000468520.1 3 ENST00000468520.1 branched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease) ENST00000491328.1 branched chain keto acid dehydrogenase E1, beta polypeptide (maple syrup urine disease) ENST00000404330.1 60S ribosomal protein L17 (RPL17) (rpL23) pseudogene ENST00000452402.1 novel transcript ENST00000427048.1 non-canonical splice acceptor site at exon 2 ENST00000427048.1 novel transcript ENST00000443221.1 non-canoncal splice acceptor site at exon 2 ENST00000443221.1 novel transcript ENST00000407020.1 laminin receptor 1 (67kD) (LAMR1) (Hs.75362, RPSA, LRP, p40, 37LRP) pseudogene ENST00000326971.2 pituitary tumor-transforming 1 (PTTG1) pseudogene ENST00000403828.1 citrate synthase (CS) pseudogene ENST00000412306.1 novel protein ENST00000369754.3 novel protein, variant 1 (FLJ31495) ENST00000320172.6 novel protein, variant 2 (FLJ20037) ENST00000369756.3 novel protein ENST00000423467.1 novel protein ENST00000435858.1 novel transcript ENST00000457116.1 novel transcript ENST00000402075.1 ribosomal protein L10 (RPL10) pseudogene ENST00000441949.1 novel transcript ENST00000418567.1 novel transcript ENST00000401636.1 single stranded DNA binding protein pseudogene ENST00000369750.3 trophoblast glycoprotein (5T4-AG) ENST00000369746.2 non-canonical acceptor splice site between exons 4 snd 5 ENST00000403648.1 leucine aminopeptidase pseudogene ENST00000451856.1 putative novel transcript ENST00000369739.2 novel protein similar to C21ORF5 (KIAA0933) ENST00000510258.1 alternative 5' UTR ENST00000507554.1 alternative 5' UTR ENST00000508748.1 alternative 5' UTR ENST00000503094.1 alternative 5' UTR ENST00000369724.3 novel protein ENST00000369705.3 malic enzyme 1 (NADP(+)-dependent, cytosolic) ENST00000403475.2 glyceraldehyde-3-phosphate dehydrogenase (GAPD) pseudogene ENST00000439399.2 alternative 5' UTR ENST00000195649.6 alternative 5' UTR ENST00000521743.1 alternative 5' UTR ENST00000519779.1 alternative 5' UTR ENST00000518309.1 alternative 5' UTR ENST00000369690.2 alternative 5' UTR ENST00000523484.1 alternative 5' UTR ENST00000519825.1 alternative 5' UTR ENST00000443471.1 novel transcript ENST00000369689.1 novel protein ENST00000369687.1 novel protein ENST00000479164.1 novel transcript ENST00000420766.1 novel transcript ENST00000444796.1 novel transcript ENST00000257776.4 novel protein ENST00000257766.4 KIAA1009 ENST00000461137.1 FLJ13551 ENST00000403245.3 NP_055710 ENST00000454981.1 novel transcript ENST00000428896.1 novel transcript ENST00000454172.1 novel transcript ENST00000442896.1 SWI/SNF related, matrix associated, actindependent regulator of chromatin, subfamily e, member 1 (SMARCE1) (BAF57) pseudogene. ENST00000330469.4 putative novel transcript ENST00000369663.4 T-box 18 ENST00000405071.1 pseudogene similar to part of cytochrome c oxidase subunit VIIa polypeptide 1 (muscle) (COX7A1) (COX7A COX7AM) ENST00000423086.1 putative novel transcript ENST00000441863.1 putative novel transcript ENST00000401925.1 novel pseudogene ENST00000403057.1 pseudogene similar to part of hormonally upregulated Neu-associated kinase (HUNK) ENST00000403365.1 ribosomal protein L31 (RPL31) pseudogene ENST00000402742.1 karyopherin alpha 5 (importin alpha 6) (KPNA5) pseudogene ENST00000434946.1 keratin 18 (KRT18) pseudogene ENST00000455071.1 novel transcript (FLJ21345) ENST00000406790.1 pseudogene similar to dUTP pyrophosphatase (DUT) ENST00000458298.1 tumor protein, translationally-controlled 1 (TPT1) pseudogene ENST00000257770.3 5'-nucleotidase, ecto (CD73) ENST00000369646.3 5'-nucleotidase, ecto (CD73) ENST00000416334.1 5'-nucleotidase, ecto (CD73) ENST00000437581.1 5'-nucleotidase, ecto (CD73) ENST00000444272.1 alternative 5' UTR ENST00000429706.1 novel transcript ENST00000421594.1 novel transcript ENST00000405497.1 ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) pseudogene ENST00000453754.1 novel transcript ENST00000406187.1 pseudogene similar to part of heat shock 90kD protein 1, beta (HSPCB) ENST00000407987.1 ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein Rac3) pseudogene ENST00000403775.1 60S Ribosomal Protein L7 (RPL7) pseudogene ENST00000401856.1 RAB1A, member RAS oncogene family (RAB1A) pseudogene ENST00000472609.1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5 (13kD, B13) (NDUFA5) (B13, NUFM, UQOR13, FLJ12147, CI-13KD-B pseudogene ENST00000404100.1 novel pseudogene ENST00000407695.1 ribososmal protein L29 (RPL29) pseudogene ENST00000402173.1 novel pseudogene ENST00000369584.1 5-hydroxytryptamine (serotonin) receptor 1E ENST00000437151.1 Similar to 60S ribosomal protein L7 ENST00000402666.1 60S ribosomal protein L21 (RPL21) pseudogene ENST00000369582.2 glycoprotein hormones, alpha polypeptide ENST00000400413.2 reticulocalbin 1, EF-hand calcium binding domain (RCN1) pseudogene ENST00000369577.3 NP_055836.1 ENST00000402374.1 novel pseudogene ENST00000404829.1 HSP60 (TCP-1/cpn60 chaperonin family) pseudogene ENST00000369574.1 novel protein ENST00000448282.1 novel transcript ENST00000369572.1 novel protein ENST00000480123.2 alternative 5' UTR ENST00000403708.1 TAF13 RNA polymerase II, TATA box binding protei (TBP)-associated factor, 18kDa (TAF13) (TAF2K) pseudogene ENST00000406493.1 S-adenosylmethionine decarboxylase 1 (AMD1) pseudogene ENST00000401760.1 suppression of tumorigenicity 13 (colon carcinoma) (Hsp70-interacting protein) (ST13) (HIP) pseudogene ENST00000464978.1 solute carrier family 35 (CMP-sialic acid transporter), member 1 ENST00000369552.4 solute carrier family 35 (CMP-sialic acid transporter), member 1 ENST00000369536.5 novel protein similar to arginyl-tRNA synthetase (arginine-tRNA ligase, EC 6.1.1.19) ENST00000493269.1 novel transcript ENST00000497828.1 novel transcript ENST00000451155.1 novel protein similar to arginyl-tRNA synthetase (arginine-tRNA ligase, EC 6.1.1.19) ENST00000257789.4 Splice acceptor of exon 15 differs by 3 nt from that of variant 1 ENST00000468486.1 origin recognition complex, subunit 3-like (yeast) ENST00000478028.1 origin recognition complex, subunit 3-like (yeast) ENST00000508875.1 putative novel transcript ENST00000257787.5 novel protein ENST00000420494.1 putative novel transcript ENST00000237201.1 sperm acrosome associated 1 (SAMP32) ENST00000462690.1 sperm acrosome associated 1 (SAMP32) ENST00000462227.1 sperm acrosome associated 1 (SAMP32) ENST00000369499.2 alternative 5' UTR ENST00000369499.2 not organism-supported ENST00000549890.1 cannabinoid receptor 1 (brain) (CNR, Hs.75110) (variant a) ENST00000549890.1 alternative 5' UTR ENST00000428600.2 alternative 5' UTR ENST00000551417.1 alternative 5' UTR ENST00000404250.1 ribosomal protein S14 (RPS14) (EMTB, emetine resistance) pseudogene ENST00000403258.1 actin, beta (ACTB) pseudogene ENST00000429137.1 putative novel transcript ENST00000369485.4 RNA guanylyltransferase and 5'-phosphatase (mRNA capping enzyme, CAP1A) ENST00000369475.3 RNA guanylyltransferase and 5'-phosphatase (mRNA capping enzyme, CAP1A) ENST00000401460.1 novel pseudogene ENST00000403367.1 adaptor-related (clathrin-associated) protein complex 4, sigma 1 subunit (AP4A1) pseudogene ENST00000369472.1 proline rich 2 (proline-rich protein with nuclear targeting signal) ENST00000336032.3 proline rich 2 (proline-rich protein with nuclear targeting signal) ENST00000354922.2 proline rich 2 (proline-rich protein with nuclear targeting signal) ENST00000452027.2 AT/AT splice site ENST00000452027.2 non-canonical splice sites between exons 2 and 3 ENST00000275072.4 novel protein similar to putative aminohydrolase ENST00000454853.2 NP_002033.2 ENST00000402938.3 gamma-aminobutyric acid (GABA) receptor rho 2 ENST00000405796.1 tubulin beta polypeptide (TUBB) pseudogene ENST00000435041.2 non-canonical ubiquitin conjugating enzyme 1 ENST00000369415.4 novel protein similar to rag C protein (GTR2) ENST00000359203.2 novel protein similar to rag C protein (GTR2) ENST00000492783.1 novel transcript ENST00000407371.1 NACA (nascent-polypeptide-associated complex alpha polypeptide) pseudogene ENST00000369408.5 KIAA0957 ENST00000447838.2 CCDS47460.1 ENST00000520458.1 alternative 5' UTR ENST00000465722.2 alternative 5' UTR ENST00000523798.1 alternative 5' UTR ENST00000522441.1 alternative 5' UTR ENST00000522705.1 alternative 5' UTR ENST00000479572.1 ankyrin repeat domain 6 (KIAA0957) ENST00000523793.1 novel transcript ENST00000523377.1 novel transcript ENST00000439638.1 midasin homolog (yeast)(KIAA0301) ENST00000439638.1 fragments dJ122O8.3, dJ122O8.4, dJ122O8.5 and dJ122O8.6 belong to the same gene; intervening exon structure yet to be determined ENST00000438877.1 putative novel transcript ENST00000401853.1 pseudogene similar to part of a novel protein (similar to 1810055D05RIK) ENST00000405081.1 novel pseudogene ENST00000552401.1 alternative 5' UTR ENST00000419040.2 alternative 5' UTR ENST00000547893.1 alternative 5' UTR ENST00000237177.6 suspected genomic sequencing error affecting CDS between exons 9 and 10 ENST00000548224.1 suspected genomic sequencing error affecting CDS between exons 7 and 8 ENST00000407054.1 ribosomal protein L22 (RPL22) pseudogene ENST00000407031.1 novel pseudogene similar to G protein pathway suppressor 1 (GPS1) (COPS1) ENST00000369352.1 connexin 62 (CX62) ENST00000458201.1 novel transcript ENST00000257749.4 5' UTR ENST00000257749.4 BTB and CNC homology 1, basic leucine zipper transcription factor 2 ENST00000343122.3 5' UTR ENST00000343122.3 BTB and CNC homology 1, basic leucine zipper transcription factor 2 ENST00000481150.1 BTB and CNC homology 1, basic leucine zipper transcription factor 2 ENST00000406998.2 5' UTR ENST00000406998.2 BTB and CNC homology 1, basic leucine zipper transcription factor 2 ENST00000453877.1 5' UTR ENST00000453877.1 BTB and CNC homology 1, basic leucine zipper transcription factor 2 ENST00000470301.1 5' UTR ENST00000470301.1 BTB and CNC homology 1, basic leucine zipper transcription factor 2 ENST00000493201.1 5' UTR ENST00000493201.1 BTB and CNC homology 1, basic leucine zipper transcription factor 2 ENST00000472023.1 5' UTR ENST00000472023.1 BTB and CNC homology 1, basic leucine zipper transcription factor 2 ENST00000494747.1 5' UTR ENST00000494747.1 BTB and CNC homology 1, basic leucine zipper transcription factor 2 ENST00000445838.1 putative novel transcript ENST00000413986.1 putative novel transcript ENST00000404861.1 pseudogene similar to part of chromosome 11 open reading frame 17 (C11orf17) ENST00000369332.3 mitogen-activated protein kinase kinase kinase 7 (TGF-beta activated kinase 1a (TAK1)), variant 1 (1a) ENST00000369332.3 mitogen-activated protein kinase kinase kinase 7 (TGF-beta activated kinase 1 (TAK1)), variant 1 (1a) ENST00000369329.3 mitogen-activated protein kinase kinase kinase 7 (TGF-beta activated kinase 1b (TAK1)), variant 2 (1b) ENST00000369325.3 mitogen-activated protein kinase kinase kinase 7 (TGF-beta activated kinase 1c (TAK1)), variant 3 (1c) ENST00000369327.3 mitogen-activated protein kinase kinase kinase 7 (TGF-beta activated kinase 1d (TAK1)), variant 4 (1d) ENST00000479630.1 mitogen-activated protein kinase kinase kinase 7 ENST00000369320.1 mitogen-activated protein kinase kinase kinase 7 ENST00000434493.1 novel transcript ENST00000437768.1 novel transcript ENST00000403051.1 pseudogene similar to part of NADH dehydrogenase 4L (MTND4L) ENST00000401674.1 pseudogene similar to part of mitochondrial cytochrome C oxidase I ENST00000406314.1 ras homologue gene family pseudogene ENST00000404228.1 ribosomal protein L5 (RPL5) pseudogene ENST00000404689.2 novel transcript ENST00000406040.1 activating transcription factor 1 (ATF1) pseudogene ENST00000452624.1 novel transcript ENST00000415778.1 26S proteasome-associated PAD1 homolog POH1 pseudogene ENST00000369303.4 ephrin receptor A7 ENST00000369297.1 ephrin receptor A7 ENST00000424678.1 putative novel transcript ENST00000424506.1 putative novel transcript ENST00000404458.1 ribosomal protein (RPL7A) pseudogene ENST00000404146.1 cytochrome B pseudogene ENST00000407870.1 cytochrome c (HCS) pseudogene ENST00000358812.4 mandaselin (FLJ12838) ENST00000369293.1 mandaselin ENST00000474553.1 novel transcript ENST00000401718.1 pseudogene similar to part of achalsia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A) (AAAS) ENST00000404337.1 keratin pseudogene ENST00000302103.4 fucosyltransferase 9 (alpha (1,3) fucosyltransferase) ENST00000483933.1 fucosyltransferase 9 (alpha (1,3) fucosyltransferase) ENST00000430796.1 novel transcript ENST00000461673.1 novel transcript ENST00000369278.4 novel protein, variant 1 (KIAA0776) ENST00000326771.2 LIM domains containing protein (activator of CREM in testis) ENST00000450218.1 probably only alternatively spliced 5' UTR; shares translation with dJ393D12.2.1 ENST00000450218.1 LIM domains containing protein (activator of CREM in testis) ENST00000418311.1 ribosomal protein S7 (RPS7) pseudogene ENST00000407851.1 thymidylate synthetase (TYMS) pseudogene ENST00000407101.1 protein phosphatase 1, catalytic subunit (PPP1C) pseudogene ENST00000402309.1 eukaryotic translation elongation factor 1 gamma (EEF1G) pseudogene ENST00000442184.1 novel transcript ENST00000369268.1 G protein-coupled receptor 63 (PSP24) ENST00000369261.4 novel protein (KIAA1900) ENST00000369254.1 novel protein (KIAA1900) ENST00000447886.1 novel protein (KIAA1900) ENST00000457513.1 novel transcript ENST00000433637.1 novel transcript ENST00000417315.1 novel transcript ENST00000432438.1 novel transcript ENST00000403144.1 eukaryotic translation initiation factor 4E binding protein pseudogene ENST00000418652.1 putative novel transcript ENST00000439279.1 novel transcript ENST00000424521.1 novel protein ENST00000369244.1 F-box and leucine-rich repeat protein 4 ENST00000413107.1 Dehydrogenase/reductase (SDR family) member 6 (DHRS6) pseudogene ENST00000254759.3 3' end of CDS has different residues to published sequence Sw:Q9NZJ6 ENST00000254759.3 hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (COQ3) ENST00000369240.1 hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (COQ3) ENST00000479163.1 hexaprenyldihydroxybenzoate methyltransferase, mitochondrial precursor (COQ3) ENST00000369239.5 SR rich protein (FLJ14992) ENST00000481229.1 novel transcript ENST00000460600.1 novel transcript ENST00000478777.1 SR rich protein (FLJ14992) ENST00000476159.1 novel transcript ENST00000463021.1 novel transcript ENST00000492294.1 novel transcript ENST00000498075.1 novel transcript ENST00000466057.1 novel transcript ENST00000418945.1 putative novel transcript ENST00000500704.2 alternative 5' UTR ENST00000472914.2 alternative 5' UTR ENST00000508908.1 alternative 5' UTR ENST00000452647.1 novel protein ENST00000520371.1 alternative 3' UTR ENST00000523799.1 alternative 5' UTR ENST00000523985.1 NP_001013417.1 ENST00000518714.1 alternative 3' UTR ENST00000524049.1 alternative 5' UTR ENST00000407121.1 40S ribososmal protein 3 (RPS3) pseudogene ENST00000369215.4 NP_067633 ENST00000369214.1 non-canonical splice sites between exons 1 and 2 (gtc) and start of exon 2 (ttg) ENST00000369212.1 G protein-coupled receptor slt (melanin-concentrating hormone 2) (SLT) ENST00000451220.1 novel transcript ENST00000430122.1 novel transcript ENST00000443234.1 novel transcript ENST00000452482.1 novel transcript ENST00000403835.1 nucleophosmin (NPM1) pseudogene ENST00000447134.1 peroxiredoxin 2 (thiol-specific antioxidant 1, natural killer-enhancing factor B, thioredoxin-dependent peroxide reductase 1, thiol-specific antioxidant 1, natural killer-enhancing factor)(PRDX2)(PRP, TSA, NKEFB, TDPX1) pseudogene ENST00000404225.1 arginase, type II (ARG2) pseudogene ENST00000411442.1 putative novel transcript ENST00000369162.2 RNA helicase family (RNAH) ENST00000324723.6 alternative 5' UTR ENST00000369143.2 RNA helicase family (RNAH) ENST00000369143.2 NP_071374.1 ENST00000406773.1 RP42 homolog (RP42) (SCRO) pseudogene ENST00000401561.2 novel actin pseudogene ENST00000405705.1 laminin receptor 1 (67kD, ribosomal protein SA) (LAMR1) pseudogene ENST00000405705.1 Em:AP002530 : Homo sapiens genomic DNA, chromosome 6q21, anti-oncogene region, section 3/4. ENST00000407792.1 pseudogene similar to part of heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kD) (HNRPD) (P37, AUF1, AUF1A, hnRNP D0) ENST00000407015.1 ClpX caseinolytic protease X homolog (E. coli) pseudogene ENST00000401880.1 novel pseudogene ENST00000398310.2 nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1) (B23, NPM) pseudogene ENST00000406305.1 novel pseudogene ENST00000422930.1 putative novel transcript ENST00000345080.4 novel protein similar to FLJ12457,contains 'Cold-shock' DNA-binding domain ENST00000345080.4 novel protein similar to FLJ12457 ENST00000314641.5 alternative 5' UTR ENST00000336775.5 blood vessel epicardial substance (POP1, HBVES) ENST00000446408.2 alternative 5' UTR ENST00000369122.3 novel protein (DKFZp434F2226) ENST00000369120.1 novel protein (DKFZp434F2226) ENST00000254765.3 popeye protein 3 (POP3) ENST00000489134.1 popeye protein 3 (POP3) ENST00000489134.1 popeye protein 3 (POP3), variant 3; alternatively spliced in 5'UTR ENST00000474760.1 popeye protein 3 (POP3) ENST00000429112.1 popeye protein 3 (POP3) ENST00000369110.3 prolyl endopeptidase (PEP) ENST00000448705.1 prolyl endopeptidase (PEP) ENST00000452363.1 novel transcript (FLJ32396) ENST00000404904.1 ribosomal protein L7 (RPL7) pseudogene ENST00000403133.1 ribosomal protein L35 (RPL35) pseudogene ENST00000423489.1 novel transcript ENST00000404930.1 chromatin assembly factor 1, p60 subunit B (CHAF1B) pseudogene ENST00000424894.1 alternative 5' UTR ENST00000343245.3 alternatively spliced 5' UTR; shares CDS with dJ354M18.1.1 ENST00000343245.3 alternative 5' UTR ENST00000449180.1 putative novel transcript ENST00000369066.3 absent in melanoma 1 ENST00000457437.1 absent in melanoma 1 ENST00000487681.1 absent in melanoma 1 ENST00000369063.3 reticulon 4 interacting protein 1 (NIMP) ENST00000498091.1 reticulon 4 interacting protein 1 (NIMP) ENST00000493619.1 reticulon 4 interacting protein 1 (NIMP) ENST00000369046.4 novel protein similar to bacterial and Drosophila glutamyl-tRNA(GLN) amidotransferase subunit A ENST00000467262.1 novel transcript ENST00000369044.1 novel protein similar to bacterial and Drosophila glutamyl-tRNA(GLN) amidotransferase subunit A ENST00000406094.1 ribosomal protein L21 (RPL21) pseudogene ENST00000424162.1 novel transcript ENST00000415714.1 novel transcript ENST00000433965.1 novel transcript ENST00000428750.1 novel transcript ENST00000436659.1 novel transcript, variant 6 (FLJ22314) ENST00000418134.1 novel transcript ENST00000430094.1 novel transcript ENST00000427903.1 novel transcript ENST00000311381.5 novel protein, variant 1 (HSPC230) ENST00000489790.1 novel transcript ENST00000369042.1 novel protein (KIAA1553) ENST00000402084.1 ribosomal protein S24 (RPS24) pseudogene ENST00000494935.1 novel transcript ENST00000441532.1 novel transcript ENST00000437040.1 novel transcript ENST00000473515.1 FLJ00197 ENST00000368979.2 sorting nexin 3 ENST00000407656.1 zinc finger protein pseudogene ENST00000392644.4 NP_115507 ENST00000237512.4 alternative 5' UTR ENST00000405722.1 ribosomal protein S12 (RPS12) pseudogene ENST00000426737.1 putative novel transcript ENST00000436639.2 p53 regulated PA26 nuclear protein (PA26-T1) ENST00000302071.2 p53 regulated PA26 nuclear protein (PA26-T3) ENST00000356644.7 p53 regulated PA26 nuclear protein (PA26-T2) ENST00000519286.1 alternative 5' UTR ENST00000518329.1 alternative 5' UTR ENST00000522461.1 alternative 5' UTR ENST00000518853.1 alternative 5' UTR ENST00000521522.1 not organism-supported ENST00000524064.1 alternative 5' UTR ENST00000522608.1 alternative 5' UTR ENST00000521503.1 alternative 5' UTR ENST00000522490.1 alternative 5' UTR ENST00000523209.1 alternative 5' UTR ENST00000368970.2 not organism-supported ENST00000520883.1 not organism-supported ENST00000417143.1 novel protein ENST00000453496.1 No translation as would be subject to NMD ENST00000453496.1 Non-canonical acceptor splice site at final exon ENST00000403073.1 novel pseudogene ENST00000437739.1 ribosomal L7 (RPL7) pseudogene ENST00000439615.1 sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase) ENST00000431946.1 alternative 5' UTR ENST00000423747.1 novel transcript ENST00000466992.1 FLJ42177 ENST00000532976.1 alternative 5' UTR ENST00000458693.1 may connect with dJ249I4.1 ENST00000458693.1 putative novel transcript ENST00000392586.1 WAS protein family, member 1 (WASP family Verprolin-homologous protein, WAVE, SCAR1, WAVE1, KIAA0269), variant 1; alternatively spliced in 5' UTR ENST00000392586.1 WAS protein family, member 1 (WASP family Verprolin-homologous protein, WAVE, SCAR1, WAVE1, KIAA0269) ENST00000392587.2 WAS protein family, member 1 (WASP family Verprolin-homologous protein, WAVE, SCAR1, WAVE1), variant 4; alternatively spliced in 5' UTR ENST00000392587.2 WAS protein family, member 1 (WASP family Verprolin-homologous protein, WAVE, SCAR1, WAVE1) ENST00000444391.1 WAS protein family, member 1 (WASP family Verprolin-homologous protein, WAVE, SCAR1, WAVE1), variant 5; alternatively spliced in 5' UTR. ENST00000444391.1 WAS protein family, member 1 (WASP family Verprolin-homologous protein, WAVE, SCAR1, WAVE1) ENST00000265601.3 WAS protein family, member 1 (WASP family Verprolin-homologous protein, WAVE, SCAR1, WAVE1), variant 2; alternatively spliced in 5' UTR. ENST00000265601.3 WAS protein family, member 1 (WASP family Verprolin-homologous protein, WAVE, SCAR1, WAVE1) ENST00000368938.1 WAS protein family, member 1 (WASP family Verprolin-homologous protein, WAVE, SCAR1, WAVE1), variant 7; alternatively spliced in 5' UTR ENST00000368938.1 WAS protein family, member 1 (WASP family Verprolin-homologous protein, WAVE, SCAR1, WAVE1) ENST00000419252.1 WAS protein family, member 1 (WASP family Verprolin-homologous protein, WAVE, SCAR1, WAVE1), variant 3; alternatively spliced in 5' UTR. ENST00000419252.1 WAS protein family, member 1 (WASP family Verprolin-homologous protein, WAVE, SCAR1, WAVE1) ENST00000447287.1 WAS protein family, member 1 (WASP family Verprolin-homologous protein, WAVE, SCAR1, WAVE1), variant 6; alternatively spliced in 5' UTR. ENST00000447287.1 WAS protein family, member 1 (WASP family Verprolin-homologous protein, WAVE, SCAR1, WAVE1) ENST00000368932.1 pre-mRNA splicing factor 17 (PRP17, EH binding protein 3, EHB3, CDC40) ENST00000368930.1 pre-mRNA splicing factor 17 (PRP17, EH binding protein 3, EHB3, CDC40) ENST00000368930.1 pre-mRNA splicing factor 17 (PRP17, EHB3, EH-binding protein 3, CDC40) ENST00000453107.1 pre-mRNA splicing factor 17 (PRP17, EH binding protein 3, EHB3, CDC40) ENST00000431461.1 pre-mRNA splicing factor 17 (PRP17, EH binding protein 3, EHB3, CDC40) ENST00000445340.1 putative novel transcript ENST00000490043.1 novel transcript ENST00000368924.3 D-aspartate oxidase ENST00000368923.3 D-aspartate oxidase ENST00000479373.1 D-aspartate oxidase ENST00000368925.1 D-aspartate oxidase ENST00000451557.1 organic cation transporter OKB1 ENST00000460159.1 this variant and one or more of the other non-overlapping variant fragments could be part of a single variant ENST00000460159.1 alternative 3' UTR ENST00000460159.1 organic cation transporter OKB1 ENST00000460159.1 alternatively spliced 3' UTR; shares partial CDS with dJ261K5.1.2 ENST00000434949.1 organic cation transporter OKB1 ENST00000437378.1 organic cation transporter OKB1 ENST00000424139.1 alternatively spliced 5' UTR; shares partial CDS with AC002464.1.5 ENST00000424139.1 organic cation transporter OKB1 ENST00000424139.1 alternative 5' UTR ENST00000461487.1 organic cation transporter OKB1 ENST00000405355.1 pseudogene similar to ribosomal protein S19 (RPS19) ENST00000368911.3 novel protein kinase (KIAA1028) ENST00000323817.3 novel protein ENST00000323817.3 alternative 5' UTR ENST00000323817.3 alternatively spliced 5' UTR; shares CDS with dJ418A9.1.3 ENST00000457688.1 alternatively spliced 5' UTR; shares CDS with dJ418A9.1.2 ENST00000457688.1 novel protein ENST00000457688.1 alternative 5' UTR ENST00000463016.1 novel protein ENST00000460913.1 novel transcript ENST00000497709.1 novel transcript ENST00000468997.1 novel transcript ENST00000392575.2 putative phosphatase pseudogene ENST00000406786.1 ribosomal protein S20 (RPS20) pseudogene ENST00000401964.1 pseudogene similar to part of ribosomal protein L21 (RPL21) ENST00000417134.1 pseudogene similar to calponin proteins ENST00000368885.3 S-adenosylmethionine decarboxylase 1 (ADOMETDC) ENST00000368882.3 S-adenosylmethionine decarboxylase 1 (ADOMETDC) ENST00000368876.1 S-adenosylmethionine decarboxylase 1 (ADOMETDC) ENST00000465404.1 S-adenosylmethionine decarboxylase 1 (ADOMETDC) ENST00000402967.1 PDGFA associated protein 1 (PDGFA) pseudogene ENST00000329970.7 novel protein (FLJ25248) ENST00000480191.1 novel transcript ENST00000441448.2 novel protein (FLJ21087) ENST00000368864.4 novel protein ENST00000425871.1 novel protein ENST00000405166.1 glutathione S-transferase M2 (muscle) (GSTM2) pseudogene ENST00000368851.4 solute carrier family 16 (monocarboxylic acid transporters), member 10 (TAT1, PRO0813, T-type amino acid transporter 1) ENST00000419619.1 solute carrier family 16 (monocarboxylic acid transporters), member 10 (TAT1, PRO0813, T-type amino acid transporter 1) ENST00000439288.1 solute carrier family 16 (monocarboxylic acid transporters), member 10 (TAT1, PRO0813, T-type amino acid transporter 1) ENST00000465319.1 solute carrier family 16 (monocarboxylic acid transporters), member 10 (TAT1, PRO0813, T-type amino acid transporter 1) ENST00000368850.1 solute carrier family 16 (monocarboxylic acid transporters), member 10 (TAT1, PRO0813, T-type amino acid transporter 1) ENST00000425364.1 novel transcript ENST00000368847.4 novel protein (KIAA1919) ENST00000444259.1 putative novel transcript ENST00000462119.1 DKFZp566H033 ENST00000368802.3 alternative 5' UTR ENST00000368805.1 alternative 5' UTR ENST00000406490.1 pseudogene similar to part of CGI-35 protein (LOC51077) ENST00000406170.1 bromodomain containing protein pseudogene ENST00000368667.2 alternative 5' UTR ENST00000368678.4 not organism-supported ENST00000368678.4 alternative 5' UTR ENST00000462856.2 alternative 5' UTR ENST00000520518.1 alternative 5' UTR ENST00000517419.1 alternative 5' UTR ENST00000518295.1 alternative 5' UTR ENST00000523238.1 alternative 5' UTR ENST00000524310.1 alternative 5' UTR ENST00000523574.1 alternative 5' UTR ENST00000462598.2 alternative 5' UTR ENST00000518630.1 alternative 5' UTR ENST00000523570.1 alternative 5' UTR ENST00000484067.2 alternative 5' UTR ENST00000521062.1 alternative 5' UTR ENST00000487824.2 alternative 5' UTR ENST00000449069.1 putative novel transcript ENST00000368662.5 tubulin, epsilon ENST00000441191.1 tubulin, epsilon ENST00000368657.3 tubulin, epsilon ENST00000389463.4 alternative 5' UTR ENST00000424408.2 alternative 5' UTR ENST00000424408.2 not organism-supported ENST00000521398.1 not organism-supported ENST00000521398.1 alternative 5' UTR ENST00000519932.1 alternative 5' UTR ENST00000243219.3 alternative 5' UTR ENST00000521690.1 alternative 5' UTR ENST00000368638.4 NP_001098678.1 ENST00000453937.2 alternative 5' UTR ENST00000455073.1 alternative 5' UTR ENST00000425503.1 novel transcript ENST00000433684.1 novel transcript ENST00000404237.1 hepatocellular carcinoma-related putative tumor suppressor (LPTS) pseudogene ENST00000401872.1 laminin receptor 1 (67kD, ribosomal protein SA) (LAMR1)(RPSA) pseudogene ENST00000439811.1 keratin 18 (KRT18) pseudogene ENST00000403722.1 fem-1 homolog a (C. elegans) (FEM1A) pseudogene ENST00000446322.1 novel transcript ENST00000418595.1 proliferation-associated 2G4, 38kD (PA2G4) pseudogene ENST00000407590.1 CGI-35 pseudogene ENST00000405179.1 cytokine inducible SH2-containing protein 6 (CISH6) pseudogene ENST00000402732.1 likely ortholog of mouse suppressors of cytokine signalling 5 (SOCS5, CIS6, CISH6, KIAA0671) pseudogene ENST00000445974.1 novel transcript ENST00000430728.1 putative novel transcript ENST00000421737.1 putative novel transcript ENST00000415883.1 putative novel transcript ENST00000402798.1 ubiquitin/ ribosomal protein S27A (RPS27A) fusion protein pseudogene ENST00000427157.1 putative novel transcript ENST00000452675.1 putative novel transcript ENST00000456424.1 putative novel transcript ENST00000480085.1 ribosomal protein L30 (RPL30) pseudogene ENST00000368635.4 myristoylated alanine-rich protein kinase C substrate (phosphomyristin, MACS, 80K-L, PKCSL, MRACKS) (contains FLJ14368 and DKFZp564P1664 in 3' UTR) ENST00000434296.1 putative novel transcript ENST00000314481.3 No translation as would be subject to NMD ENST00000519065.1 histone deacetylase 2 (human transcriptional regulator homolog RPD3, YAF1) ENST00000519108.1 alternative 5' UTR ENST00000425835.2 histone deacetylase 2 (human transcriptional regulator homolog RPD3, YAF1) ENST00000523628.1 alternative 5' UTR ENST00000521610.1 alternative 5' UTR ENST00000522371.1 alternative 5' UTR ENST00000518690.1 alternative 5' UTR ENST00000523240.1 alternative 5' UTR ENST00000520895.1 alternative 5' UTR ENST00000524334.1 alternative 5' UTR ENST00000451843.1 putative novel transcript ENST00000404698.1 pseudogene similar to mouse D7Rp2e (DNA segment, Chr7, Roswell Park 2 complex, expressed) ENST00000402237.1 laminin receptor 1 (LAMR1) pseudogene ENST00000406473.1 HSJ2 (heat shock protein, DNAJ-like 2 (HDJ2)) pseudogene ENST00000438522.1 putative novel transcript ENST00000446358.1 putative novel transcript ENST00000435802.1 putative novel transcript ENST00000404881.1 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit g (ATP5L) pseudogene ENST00000446525.1 putative novel transcript ENST00000401765.1 pseudogene similar to part of KIAA1925 ENST00000368626.3 fyn-related kinase ENST00000368626.3 fyn-related kinase (GTK, RAK) ENST00000335020.2 TPI1 (triosephosphate isomerase 1) pseudogene ENST00000319550.3 novel protein ENST00000419791.1 novel protein ENST00000417846.1 novel protein ENST00000460749.1 novel protein ENST00000327673.4 collagen, type X, alpha 1 (Schmid metaphyseal chondrodysplasia) ENST00000327673.4 NP_000484 ENST00000452729.1 collagen, type X, alpha 1 (Schmid metaphyseal chondrodysplasia) ENST00000452729.1 alternative 5' UTR ENST00000418500.1 collagen, type X, alpha 1 (Schmid metaphyseal chondrodysplasia) ENST00000418500.1 alternative 5' UTR ENST00000404319.1 pseudogene similar to various (hypothetical) genes ENST00000457319.1 putative novel transcript ENST00000448740.1 putative novel transcript ENST00000435100.1 RPS5 (40S Ribosomal Protein S5) pseudogene ENST00000368608.3 start codon is derived from GENSCAN and FGENES predictions ENST00000368608.3 TSPY-like (testis specific protein, Y-linked like) ENST00000402326.1 chromobox homolog 3 (HP1 gamma homolog, Drosophila) (CBX3) pseudogene ENST00000420595.1 putative novel transcript ENST00000356128.4 novel protein (FLJ11180) (contains BET3 homology) ENST00000437098.1 novel protein (contains BET3 homology) ENST00000368599.3 novel protein ENST00000466444.2 PTD013 protein (CGI-24) ENST00000368590.5 PTD013 protein (CGI-24) ENST00000368590.5 alternative 5' UTR ENST00000487832.2 PTD013 protein (CGI-24) ENST00000487832.2 NP_057188.2 ENST00000518117.1 alternative 5' UTR ENST00000468204.2 PTD013 protein (CGI-24) ENST00000468204.2 alternative 5' UTR ENST00000229554.5 novel protein similar to murine radial spokehead-like 1 (Rshl1) ENST00000368580.4 novel protein similar to murine radial spokehead-like 1 (Rshl1) ENST00000485498.1 this variant and variant fragment dJ412I7.3.3 could be part of one single variant ENST00000485498.1 novel transcript ENST00000368576.3 novel protein (FLJ30020) ENST00000368573.1 novel protein ENST00000471919.1 this variant and variant fragment dJ412I7.3.4 could be part of one single variant ENST00000471919.1 novel transcript ENST00000368564.1 karyopherin alpha 5 (importin alpha 6) ENST00000413340.1 this variant and variant dJ412I7.2.3 could be part of one single variant ENST00000413340.1 karyopherin alpha 5 (importin alpha 6) ENST00000392517.2 3' UTR ENST00000392517.2 this variant and variant dJ412I7.2.2 could be part of one single variant ENST00000392517.2 continued as bA86F4.2 in Em:AL354716 ENST00000392517.2 karyopherin alpha 5 (importin alpha 6) ENST00000368557.4 novel protein ENST00000487683.1 novel RFX DNA binding domain containing protein ENST00000487683.1 non_organism_supported ENST00000332958.2 NP_775831 ENST00000471966.1 novel transcript ENST00000402041.1 ribosomal protein S29 (RPS29) pseudogene ENST00000352536.3 novel protein (LOC245806) ENST00000368508.3 v-ros UR2 sarcoma virus oncogene homolog 1 (avian) (MCF3, proto-oncogene tyrosine-protein kinase ROS, transmembrane tyrosine-specific protein kinase) ENST00000368507.3 v-ros UR2 sarcoma virus oncogene homolog 1 (avian) (MCF3, proto-oncogene tyrosine-protein kinase ROS, transmembrane tyrosine-specific protein kinase) ENST00000403284.2 v-ros UR2 sarcoma virus oncogene homolog 1 (avian) (MCF3, proto-oncogene tyrosine-protein kinase ROS, transmembrane tyrosine-specific protein kinase) ENST00000467125.1 possible fusion transcript ENST00000467125.1 novel transcript ENST00000407180.1 RAP1A, member of RAS oncogene family (RAP1A) pseudogene ENST00000415736.1 putative novel transcript ENST00000481630.1 novel transcript ENST00000404786.1 novel pseudogene ENST00000407450.1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24 (DDX24) pseudogene ENST00000419517.2 NP_996804.2 ENST00000469424.1 bromodomain-containing 7 (BRD7) pseudogene ENST00000357525.5 phospholamban (PLB) ENST00000402595.1 synovial sarcoma, X breakpoint, gene pseudogene ENST00000425154.2 alternative 5' UTR ENST00000505446.1 alternative 5' UTR ENST00000521043.1 not organism-supported ENST00000338891.7 novel protein (contains FLJ13942) ENST00000475529.2 not organism-supported ENST00000352896.5 NP_001093881.1 ENST00000521531.1 confirm experimentally ENST00000402519.1 Cytochrome C Oxidase Polypeptide I (EC 1.9.3.1) pseudogene ENST00000368468.3 mannosidase, alpha, class 1A, member 1 (Man9-mannosidase) (MAN9, HUMM9) ENST00000368468.3 mannosidase, alpha, class 1A, member 1 (Man9-mannosidase (MAN9), HUMM9) ENST00000406333.1 pseudogene similar to 60S Ribosomal Protein L13A (RPL13) ENST00000275159.6 confirm experimentally ENST00000398212.2 confirm experimentally ENST00000422369.1 alternative 5' UTR ENST00000407291.1 ribosomal protein S15 (RPS15) pseudogene ENST00000450059.1 putative novel transcript ENST00000282561.3 gap junction protein, alpha 1, 43 kD (connexin 43) (CX43) ENST00000406666.1 transcription factor A, mitochondrial (TFAM), pseudogene ENST00000401679.1 cytochrome c oxidase subunit VIc (COX6C) pseudogene ENST00000406156.1 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 (SLC25A5), pseudogene ENST00000406913.1 ribosomal protein L23A (RPL23A) pseudogene ENST00000403062.1 pseudogene similar to Pleurodeles waltlii RAP55 protein and hypothetical proteins ENST00000406327.1 high mobility group protein pseudogene ENST00000368455.4 heat shock transcription factor 2 ENST00000368455.4 Continued_from dJ506O9.1 in Em:AL121954 ENST00000368455.4 Continues_as dJ425C14.1 in Em:Z99129 ENST00000465214.1 heat shock transcription factor 2 ENST00000368454.1 KIAA1253 protein (similar to tumor differentially expressed TDE1) ENST00000368452.2 protein kinase (cAMP-dependent, catalytic) inhibitor beta (protein kinase, cAMP-dependent, catalytic, inhibitor 2 (PRKACN2)) (similar to FLJ23817) ENST00000368448.1 protein kinase (cAMP-dependent, catalytic) inhibitor beta (protein kinase, cAMP-dependent, catalytic, inhibitor 2 (PRKACN2)) ENST00000258014.3 protein kinase (cAMP-dependent, catalytic) inhibitor beta (protein kinase, cAMP-dependent, catalytic, inhibitor 2 (PRKACN2)), variant 3 (similar to FLJ23817) ENST00000354275.2 protein kinase (cAMP-dependent, catalytic) inhibitor beta (protein kinase, cAMP-dependent, catalytic, inhibitor 2 (PRKACN2)) ENST00000368446.1 protein kinase (cAMP-dependent, catalytic) inhibitor beta (protein kinase, cAMP-dependent, catalytic, inhibitor 2 (PRKACN2)) (similar to FLJ23817) ENST00000392074.2 putative novel transcript ENST00000368444.3 fatty acid binding protein 7, brain (B-FABP) ENST00000356535.4 fatty acid binding protein 7, brain (B-FABP), variant 2 (DKFZp547J2313) ENST00000368440.4 acid sphingomyelinase-like phosphodiesterase 3a (ASML3A) ENST00000487215.1 novel transcript ENST00000440646.1 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit g (ATP5L) pseudogene ENST00000426074.1 novel transcript (FLJ31143) ENST00000426074.1 this object may be part of same locus as .3 ENST00000451729.1 this object may be part of same locus as .2 ENST00000451729.1 putative novel transcript ENST00000334268.4 triadin (TDN, TRIADIN) ENST00000361029.4 triadin (TDN, TRIADIN) ENST00000361029.4 includes protein sequence similar to hypothetical protein from macaque ENST00000359698.4 triadin (TDN, TRIADIN) ENST00000422596.1 triadin (TDN, TRIADIN) ENST00000434768.1 novel transcript ENST00000427828.1 novel transcript ENST00000418467.1 novel transcript ENST00000368416.1 T-cell lymphoma breakpoint associated target 1 ENST00000368417.1 Continued_from bA414G18.1.2 in Em:AL356605 ENST00000368417.1 T-cell lymphoma breakpoint associated target 1 ENST00000476571.1 T-cell lymphoma breakpoint associated target 1 ENST00000441521.1 novel transcript ENST00000407141.1 FLJ00254 pseudogene ENST00000439075.1 novel transcript ENST00000519799.1 alternative 5' UTR ENST00000431104.1 novel transcript ENST00000534368.1 alternative 5' UTR ENST00000532429.1 NP_001003395.1 ENST00000534199.1 alternative 5' UTR ENST00000524679.1 alternative 5' UTR ENST00000318787.8 CGI-130 protein ENST00000318787.8 in position 122237 one basepair is missing compared to the homologous cDNA AF151888 ENST00000318787.8 second exon lacks correct 3' splice site ENST00000422227.1 novel transcript ENST00000430672.1 novel transcript ENST00000451660.1 novel transcript ENST00000427852.1 novel transcript ENST00000432121.1 novel transcript ENST00000423208.1 novel transcript ENST00000368365.1 hairy/enhancer-of-split related with YRPW motif 2 (GRL, HERP1, gridlock, HES-related repressor protein 1, CHF1) ENST00000368364.3 hairy/enhancer-of-split related with YRPW motif 2 (GRL, HERP1, gridlock, HES-related repressor protein 1, CHF1) ENST00000368357.3 endoplasmic reticulum associated protein 140 kDa (ERAP140) (similar to nucleolar protein C7B) ENST00000453302.1 endoplasmic reticulum associated protein 140 kDa (ERAP140) (similar to nucleolar protein C7B) ENST00000453302.1 alternatively spliced 5' UTR; shares partial CDS with dJ293L8.4.1 and dJ185N19.1.1 ENST00000453302.1 alternative 5' UTR ENST00000417494.1 endoplasmic reticulum associated protein 140 kDa (ERAP140) (similar to nucleolar protein C7B) ENST00000417494.1 alternatively spliced 5' UTR; shares partial CDS with dJ293L8.4.1 and dJ185N19.1.1 ENST00000417494.1 alternative 5' UTR ENST00000428318.1 endoplasmic reticulum associated protein 140 kDa (ERAP140) (similar to nucleolar protein C7B) ENST00000428318.1 alternatively spliced 5' UTR; shares partial CDS with dJ293L8.4.1 and dJ185N19.1.1 ENST00000428318.1 alternative 5' UTR ENST00000487635.1 novel transcript ENST00000419660.1 endoplasmic reticulum associated protein 140 kDa (ERAP140) (similar to nucleolar protein C7B) ENST00000419660.1 alternatively spliced 5' UTR; shares partial CDS with dJ293L8.4.1 and dJ185N19.1.1 ENST00000419660.1 alternative 5' UTR ENST00000413085.1 novel protein ENST00000433571.1 novel protein ENST00000448104.1 novel protein ENST00000438495.1 novel protein ENST00000444128.1 novel protein ENST00000429007.1 novel transcript ENST00000229633.5 novel protein (FLJ32296) similar to protein kinase C inhibitors ENST00000461129.1 novel transcript ENST00000479748.1 MDS024 protein ENST00000368332.3 MDS024 protein ENST00000481529.1 MDS024 protein ENST00000468097.1 novel transcript ENST00000473273.1 whether or not two of the non-overlapping partial variants are actually part of one multiple alternatively splice transcript is yet to be determined ENST00000473273.1 novel transcript ENST00000444121.1 whether or not two of the non-overlapping partial variants are actually part of one multiple alternatively splice transcript is yet to be determined ENST00000444121.1 MDS024 protein (fragment) ENST00000446681.1 whether or not two of the non-overlapping partial variants are actually part of one multiple alternatively splice transcript is yet to be determined ENST00000446681.1 MDS024 protein (fragment) ENST00000489934.1 whether or not two of the non-overlapping partial variants are actually part of one multiple alternatively splice transcript is yet to be determined ENST00000489934.1 novel transcript ENST00000453993.1 MDS024 protein, (fragment) ENST00000453993.1 whether or not two of the non-overlapping partial variants are actually part of one multiple alternatively splice transcript is yet to be determined ENST00000453993.1 non-canonical splice donor site between exons 4 and 5 ENST00000466316.1 whether or not two of the non-overlapping partial variants are actually part of one multiple alternatively splice transcript is yet to be determined ENST00000466316.1 non-canonical splice donor site between exons 4 and 5 ENST00000466316.1 novel transcript ENST00000444229.1 putative novel transcript ENST00000440334.1 protein phosphatase 1, regulatory (inhibitor) subunit 14A (PPP1R14A) pseudogene ENST00000368326.1 novel protein ENST00000368325.1 novel protein ENST00000368328.4 novel protein ENST00000402383.1 vimentin (VIM) pseudogene ENST00000403549.1 px19-like protein (PX19, PRELI, CGI-106) pseudogene ENST00000405151.1 ribosomal protein S4, X-linked (cell cycle gene 2, single-copy abundant mRNA, ribosomal protein S4X variant, 40S ribosomal protein S4, X variant) (RPS4X)(CCG2, SCAR, SCR10, DXS306) pseudogene ENST00000356698.4 thrombospondin (FLJ14440) ENST00000368317.3 thrombospondin (FLJ14440) ENST00000485757.1 thrombospondin (FLJ14440) ENST00000368314.1 dactilydin (DKFZP434O1427)(FLJ14870, FLJ14530) ENST00000476956.1 dactilydin (DKFZP434O1427)(FLJ14870, FLJ14530) ENST00000356799.2 dactilydin (DKFZP434O1427)(FLJ14870, FLJ14530) ENST00000495188.1 dactilydin (DKFZP434O1427)(FLJ14870, FLJ14530) ENST00000477776.1 dactilydin (DKFZP434O1427)(FLJ14870, FLJ14530) ENST00000489534.1 dactilydin (DKFZP434O1427)(FLJ14870, FLJ14530) ENST00000480444.1 dactilydin (DKFZP434O1427)(FLJ14870, FLJ14530) ENST00000454859.3 novel enoyl-CoA hydratase/isomerase family protein similar to uncharacterised hypothalamus protein HCDASE ENST00000454859.3 alternative 5' UTR ENST00000531967.1 novel enoyl-CoA hydratase/isomerase family protein similar to uncharacterised hypothalamus protein HCDASE ENST00000474289.2 novel enoyl-CoA hydratase/isomerase family protein similar to uncharacterised hypothalamus protein HCDASE ENST00000474289.2 alternative 5' UTR ENST00000454591.2 NP_001099014.1 ENST00000454591.2 novel enoyl-CoA hydratase/isomerase family protein similar to uncharacterised hypothalamus protein HCDASE ENST00000479525.2 novel enoyl-CoA hydratase/isomerase family protein similar to uncharacterised hypothalamus protein HCDASE ENST00000368291.2 novel enoyl-CoA hydratase/isomerase family protein similar to uncharacterised hypothalamus protein HCDASE ENST00000368291.2 alternative 5' UTR ENST00000475319.1 novel enoyl-CoA hydratase/isomerase family protein similar to uncharacterised hypothalamus protein HCDASE ENST00000430841.2 novel enoyl-CoA hydratase/isomerase family protein similar to uncharacterised hypothalamus protein HCDASE ENST00000430841.2 alternative 5' UTR ENST00000368289.2 NP_060949.2 ENST00000368289.2 novel enoyl-CoA hydratase/isomerase family protein similar to uncharacterised hypothalamus protein HCDASE ENST00000368292.6 novel enoyl-CoA hydratase/isomerase family protein similar to uncharacterised hypothalamus protein HCDASE ENST00000488087.1 novel enoyl-CoA hydratase/isomerase family protein similar to uncharacterised hypothalamus protein HCDASE ENST00000436638.1 novel enoyl-CoA hydratase/isomerase family protein similar to uncharacterised hypothalamus protein HCDASE ENST00000460558.1 novel enoyl-CoA hydratase/isomerase family protein similar to uncharacterised hypothalamus protein HCDASE ENST00000461239.2 novel enoyl-CoA hydratase/isomerase family protein similar to uncharacterised hypothalamus protein HCDASE ENST00000534442.1 alternative 5' UTR ENST00000474240.1 novel enoyl-CoA hydratase/isomerase family protein similar to uncharacterised hypothalamus protein HCDASE ENST00000531582.1 alternative 5' UTR ENST00000368287.1 novel enoyl-CoA hydratase/isomerase family protein similar to uncharacterised hypothalamus protein HCDASE ENST00000392459.2 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation) (YWHAZ)(14-3-3 zeta) pseudogene ENST00000406671.1 60S ribosomal protein L5 (RPL5) pseudogene ENST00000406554.1 HSPC163 protein (HSPC163) pseudogene ENST00000404780.1 60S Ribosomal protein L23 (RPL23) pseudogene ENST00000481848.2 subject to nonsense-mediated decay ENST00000473298.2 subject to nonsense-mediated decay ENST00000464495.2 subject to nonsense-mediated decay ENST00000464495.2 alternative 3' UTR ENST00000464495.2 not organism-supported ENST00000525778.1 not organism-supported ENST00000465909.2 not organism-supported ENST00000467753.1 alternative 5' UTR ENST00000465254.2 novel protein (KIAA0408) ENST00000483725.2 confirm experimentally ENST00000483725.2 novel protein (KIAA0408) ENST00000487331.2 novel protein (KIAA0408) ENST00000498112.1 novel protein (LOC135121) ENST00000329722.7 novel protein (LOC135121) ENST00000403830.1 novel pseudogene similar to a hypothetical mouse protein ENST00000405809.1 novel pseudogene similar to hypothetical protein DC42 ENST00000407841.1 pseudogene similar to part of transducin (beta)-like 1X-linked TBL1X ENST00000434358.1 novel protein similar to hypothetical macaque protein ENST00000434358.1 novel protein ENST00000368226.4 protein tyrosine phosphatase, receptor type, K (R-PTP-KAPPA) ENST00000368213.5 NP_001129120.1 ENST00000368210.3 protein tyrosine phosphatase, receptor type, K (R-PTP-KAPPA) ENST00000368210.3 not organism-supported ENST00000368215.3 protein tyrosine phosphatase, receptor type, K (R-PTP-KAPPA) ENST00000368207.3 not organism-supported ENST00000415046.2 protein tyrosine phosphatase, receptor type, K (R-PTP-KAPPA) ENST00000415055.2 protein tyrosine phosphatase, receptor type, K (R-PTP-KAPPA) ENST00000434424.1 may connect with other variants of this gene ENST00000434424.1 protein tyrosine phosphatase, receptor type, K (R-PTP-KAPPA) ENST00000524534.1 not organism-supported ENST00000368205.3 protein tyrosine phosphatase, receptor type, K (R-PTP-KAPPA) ENST00000490332.2 not organism-supported ENST00000498284.1 protein tyrosine phosphatase, receptor type, K (R-PTP-KAPPA) ENST00000495748.1 protein tyrosine phosphatase, receptor type, K (R-PTP-KAPPA) ENST00000429595.1 protein tyrosine phosphatase, receptor type, K (R-PTP-KAPPA) ENST00000392449.4 protein tyrosine phosphatase, receptor type, K (R-PTP-KAPPA) ENST00000368202.4 protein tyrosine phosphatase, receptor type, K (R-PTP-KAPPA) ENST00000417390.1 novel transcript ENST00000417390.1 continues as bA103C16.2 in Em:AL590006 ENST00000434560.1 novel transcript (FLJ21543) ENST00000450483.1 novel transcript (FLJ12077) ENST00000458367.1 putative novel transcript ENST00000411489.1 putative novel transcript ENST00000431410.1 eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein) (EEF1D) pseudogene ENST00000406055.1 ribosomal protein L21 (RPL21) pseudogene ENST00000421865.2 laminin, alpha 2 (merosin, congenital muscular dystrophy) (LAMM) ENST00000466230.1 novel transcript ENST00000498257.1 novel transcript ENST00000494137.1 novel transcript ENST00000404287.1 mesoderm specific transcript homolog (mouse) (MEST) (PEG1) pseudogene ENST00000403332.1 bone morphogenetic protein receptor, type IA (BMPR1B) pseudogene ENST00000442449.1 putative novel transcript ENST00000430296.1 novel transcript ENST00000419061.1 novel transcript ENST00000368149.1 MacGAP protein ENST00000483367.1 novel transcript ENST00000463225.1 novel transcript ENST00000404620.1 ribosomal protein L5 (RPL5) pseudogene ENST00000403074.1 ubiquitin-like 1 (sentrin) (UBL1) pseudogene ENST00000404344.1 novel pseudogene ENST00000406097.1 pyridoxal (pyridoxine, vitamin B6) kinase (PDXK) pseudogene ENST00000368143.1 novel protein ENST00000529410.1 novel transcript (KIAA1798) ENST00000529410.1 KIAA1798 protein ENST00000528385.1 alternative 5' UTR ENST00000368139.2 alternative 5' UTR ENST00000368139.2 not organism-supported ENST00000526019.1 not organism-supported ENST00000526019.1 alternative 5' UTR ENST00000415964.1 putative novel transcript ENST00000439090.2 alternative 5' UTR ENST00000437477.2 alternative 5' UTR ENST00000463253.2 not organism-supported ENST00000532763.1 not organism-supported ENST00000531544.1 alternative 5' UTR ENST00000296978.3 KIAA1913 protein ENST00000454262.1 putative novel transcript ENST00000531410.1 not organism-supported ENST00000528282.1 alternative 5' UTR ENST00000445890.2 not organism-supported ENST00000368128.2 alternative 5' UTR ENST00000527411.1 not organism-supported ENST00000527411.1 alternative 5' UTR ENST00000525271.1 NP_001129027.1 ENST00000525193.1 not organism-supported ENST00000527659.1 not organism-supported ENST00000529208.1 not organism-supported ENST00000533912.1 not organism-supported ENST00000525198.1 not organism-supported ENST00000529709.1 alternative 5' UTR ENST00000532499.1 alternative 5' UTR ENST00000526983.1 alternative 5' UTR ENST00000531356.1 alternative 5' UTR ENST00000530707.1 alternative 5' UTR ENST00000541650.1 NAGNAG splice site ENST00000541650.1 not organism-supported ENST00000263050.3 not organism-supported ENST00000407765.1 zinc finger pseudogene ENST00000402896.1 ribosomal protein L21 pseudogene ENST00000368087.3 arginase, liver (ARG1) ENST00000469293.1 arginase, liver (ARG1) ENST00000356962.2 arginase, liver (ARG1) ENST00000476845.1 arginase, liver (ARG1) ENST00000275196.5 arginase, liver (ARG1) ENST00000489091.1 arginase, liver (ARG1) ENST00000498260.1 arginase, liver (ARG1) ENST00000492505.1 arginase, liver (ARG1) ENST00000473794.1 arginase, liver (ARG1) ENST00000484820.1 arginase, liver (ARG1) ENST00000354577.4 cofactor required for Sp1 transcriptional activation, subunit 3 (130kD) (CRSP130, CRSP133, DRIP130, SUR2, KIAA1216) ENST00000368068.3 cofactor required for Sp1 transcriptional activation, subunit 3 (130kD) (CRSP130, CRSP133, DRIP130, SUR2, KIAA1216) ENST00000479213.1 cofactor required for Sp1 transcriptional activation, subunit 3 (130kD) (CRSP130, CRSP133, DRIP130, SUR2, KIAA1216) ENST00000368060.3 cofactor required for Sp1 transcriptional activation, subunit 3 (130kD) (CRSP130, CRSP133, DRIP130, SUR2, KIAA1216) ENST00000368058.1 cofactor required for Sp1 transcriptional activation, subunit 3 (130kD) (CRSP130, CRSP133, DRIP130, SUR2, KIAA1216) ENST00000484885.1 cofactor required for Sp1 transcriptional activation, subunit 3 (130kD) (CRSP130, CRSP133, DRIP130, SUR2, KIAA1216) ENST00000368053.4 cofactor required for Sp1 transcriptional activation, subunit 3 (130kD) (CRSP130, CRSP133, DRIP130, SUR2, KIAA1216) ENST00000489888.1 cofactor required for Sp1 transcriptional activation, subunit 3 (130kD) (CRSP130, CRSP133, DRIP130, SUR2, KIAA1216) ENST00000414305.1 ectonucleotide pyrophosphatase/phosphodiesterase 3 (FLJ21246, B10, NPP3, PDNP3, CD203c, PD-IBETA) ENST00000423831.1 ectonucleotide pyrophosphatase/phosphodiesterase 3 (B10, NPP3, PDNP3, CD203c, PD-IBETA) ENST00000470930.1 ectonucleotide pyrophosphatase/phosphodiesterase 3 (B10, NPP3, PDNP3, CD203c, PD-IBETA) ENST00000494023.1 ectonucleotide pyrophosphatase/phosphodiesterase 3 (B10, NPP3, PDNP3, CD203c, PD-IBETA) ENST00000401879.1 ribosomal protein L15 (RPL15) pseudogene ENST00000407837.1 novel pseudogene ENST00000436112.1 putative novel transcript ENST00000447481.1 putative novel transcript ENST00000367941.1 syntaxin 7 ENST00000448348.2 alternatively spliced 5' UTR, shares CDS with bA560I21.2.1. ENST00000448348.2 syntaxin 7 ENST00000448348.2 alternative 5' UTR ENST00000448348.2 alternatively spliced 5' UTR, shares CDS with bA80A23.1.1 ENST00000367937.4 syntaxin 7 ENST00000475879.1 syntaxin 7 ENST00000426566.1 ribosomal protein L21 (RPL21) pseudogene ENST00000434551.1 trace amine receptor 3 (TAR3) pseudogene ENST00000275200.1 G protein-coupled receptor 102 (TA5, TAR5) ENST00000275198.1 trace amine receptor 4 (TA4) ENST00000454843.1 trace amine receptor pseudogene ENST00000275191.2 Also used as evidence: mRNA AF112460 (1041bb, see PMID 10684976) ENST00000275191.2 G protein-coupled receptor 58 ENST00000275191.2 Isoform also known as: Small; ENST00000367931.1 G protein-coupled receptor 58 ENST00000367931.1 Isoform also known as: Long; ENST00000275216.1 trace amine receptor 1 (TA1) (Tar1) ENST00000367928.4 vanin 1 ENST00000406783.1 cyclin G1 (CCNG1) pseudogene ENST00000367927.4 NMD exception ENST00000425515.1 NMD exception ENST00000414302.2 NMD exception ENST00000423615.2 NMD exception ENST00000427187.2 NMD exception ENST00000275223.3 NMD exception ENST00000519686.2 NMD exception ENST00000392393.3 NMD exception ENST00000450865.2 NMD exception ENST00000544102.1 NMD exception ENST00000418593.2 102894 102809 ENST00000326499.6 vanin 2 ENST00000422400.2 102976 102809 ENST00000525270.1 NP_511043.1 ENST00000524919.1 alternative 5' UTR ENST00000530536.1 alternative 5' UTR ENST00000532012.1 alternative 5' UTR ENST00000430895.1 putative novel transcript ENST00000275227.4 novel protein ENST00000367918.1 novel protein ENST00000460518.1 novel protein ENST00000230050.3 ribosomal protein S12 ENST00000406019.1 high-mobility group (nonhistone chromosomal) protein 1-like 10 (HMG1L10) pseudogene ENST00000438548.1 ribosomal L23a (RPL23A) pseudogene ENST00000434443.1 novel transcript ENST00000401524.1 cytochrome b (MTCYB) pseudogene ENST00000367895.5 eyes absent homolog 4 (Drosophila) (Deafness, autosomal nonsyndromic sensorineural, 10 (DFNA10)) ENST00000367895.5 eyes absent homolog 4 (Drosophila) (Deafness, autosomal nonsyndromic sensorineural, 10 (DFNA10)), ENST00000525849.1 not organism-supported ENST00000431403.2 confirm experimentally ENST00000421413.2 eyes absent homolog 4 (Drosophila) (Deafness, autosomal nonsyndromic sensorineural, 10 (DFNA10)) ENST00000412954.1 putative novel transcript ENST00000457081.1 novel transcript ENST00000451017.1 novel transcript ENST00000438283.1 heat shock 10kDa protein 1 (chaperonin 10) (HSPE1) pseudogene ENST00000419627.1 novel transcript ENST00000456347.1 novel transcript ENST00000412745.1 novel transcript ENST00000367882.4 transcription factor 21 (POD1, transcription factor-21 (epicardin; podocyte-expressed 1)) ENST00000237316.3 alternative 3' UTR; shares CDS with bA373A10.1.1 ENST00000237316.3 alternative 3' UTR ENST00000237316.3 transcription factor 21 (POD1, transcription factor-21 (epicardin; podocyte-expressed 1)) ENST00000416965.1 TBP-like 1 (TLF, TLP, STUD, TRF2) ENST00000416965.1 alternatively spliced 5' UTR; shares partial CDS with dJ73H22.1.1 ENST00000416965.1 alternative 5' UTR ENST00000457715.1 TBP-like 1 (TLF, TLP, STUD, TRF2) ENST00000457715.1 alternatively spliced 5' UTR; shares partial CDS with dJ73H22.1.1 ENST00000457715.1 alternative 5' UTR ENST00000367871.1 TBP-like 1 (TLF, TLP, STUD, TRF2) ENST00000237264.3 TBP-like 1 (TLF, TLP, STUD, TRF2) ENST00000367869.1 TBP-like 1 (TLF, TLP, STUD, TRF2) ENST00000367869.1 alternatively spliced 5' UTR; shares partial CDS with dJ73H22.1.1 ENST00000367869.1 alternative 5' UTR ENST00000477527.1 TBP-like 1 (TLF, TLP, STUD, TRF2) ENST00000481694.1 TBP-like 1 (TLF, TLP, STUD, TRF2) ENST00000275230.5 solute carrier family 2 (facilitated glucose transporter), member 12 (GLUT12, FLJ31992) ENST00000406908.1 high-mobility group (nonhistone chromosomal) protein variants I and Y (HMGIY) pseudogene ENST00000367858.5 serum/glucocorticoid regulated kinase, variant 4 (FLJ30515) ENST00000474427.2 serum/glucocorticoid regulated kinase ENST00000474427.2 this variant fragment and one or more of the other non-overlapping variant fragments could be part of a single variant ENST00000413996.3 serum/glucocorticoid regulated kinase ENST00000477460.2 serum/glucocorticoid regulated kinase ENST00000477460.2 this variant fragment and one or more of the other non-overlapping variant fragments could be part of a single variant ENST00000237305.7 serum/glucocorticoid regulated kinase ENST00000367857.5 serum/glucocorticoid regulated kinase ENST00000473704.1 serum/glucocorticoid regulated kinase ENST00000473704.1 this variant fragment and one or more of the other non-overlapping variant fragments could be part of a single variant ENST00000489458.2 serum/glucocorticoid regulated kinase ENST00000489458.2 this variant fragment and one or more of the other non-overlapping variant fragments could be part of a single variant ENST00000475882.2 serum/glucocorticoid regulated kinase ENST00000475882.2 this variant fragment and one or more of the other non-overlapping variant fragments could be part of a single variant ENST00000490149.2 this variant and one or more of the other non-overlapping variant fragments could be part of a single variant ENST00000490149.2 serum/glucocorticoid regulated kinase ENST00000484353.1 serum/glucocorticoid regulated kinase ENST00000484353.1 this variant fragment and one or more of the other non-overlapping variant fragments could be part of a single variant ENST00000485771.1 serum/glucocorticoid regulated kinase ENST00000460769.1 serum/glucocorticoid regulated kinase ENST00000524929.1 serum/glucocorticoid regulated kinase ENST00000533224.1 alternative 5' UTR ENST00000405771.1 keratin 8 (KRT8) pseudogene ENST00000418701.1 novel pseudogene (similar to murine ethanol induced 6) ENST00000417483.1 novel transcript ENST00000422736.1 novel transcript ENST00000431422.1 novel transcript ENST00000456749.1 novel transcript ENST00000440090.1 novel transcript ENST00000418837.1 novel transcript ENST00000423028.1 novel transcript ENST00000434593.1 novel transcript ENST00000407496.1 family with sequence similarity 8, member A1 (FAM8A1) (Autosomal Highly Conserved Protein) pseudogene ENST00000412602.1 putative novel transcript ENST00000452888.1 putative novel transcript ENST00000447557.1 putative novel transcript ENST00000441868.1 novel pseudogene ENST00000265605.2 aldehyde dehydrogenase 8 family, member A1 ENST00000367845.2 aldehyde dehydrogenase 8 family, member A1 ENST00000460753.1 aldehyde dehydrogenase 8 family, member A1 ENST00000416448.2 putative novel transcript ENST00000367837.5 HBS1-like (S. cerevisiae) (KIAA1038, EFRS) ENST00000527005.1 HBS1-like (S. cerevisiae) (KIAA1038, EFRS) ENST00000415177.2 not organism-supported ENST00000367826.2 NP_001138630.1 ENST00000529641.1 alternative 5' UTR ENST00000527507.1 alternative 5' UTR ENST00000314674.3 HBS1-like (S. cerevisiae) (KIAA1038, EFRS) ENST00000314674.3 not organism-supported ENST00000367822.5 HBS1-like (S. cerevisiae) (KIAA1038, EFRS) ENST00000447508.1 putative novel transcript ENST00000341911.5 v-myb myeloblastosis viral oncogene homolog (avian) ENST00000367814.4 v-myb myeloblastosis viral oncogene homolog (avian) ENST00000527615.1 not organism-supported ENST00000420123.2 v-myb myeloblastosis viral oncogene homolog (avian) ENST00000528140.1 alternative 3' UTR ENST00000533384.1 alternative 3' UTR ENST00000525514.1 alternative 3' UTR ENST00000526320.1 alternative 3' UTR ENST00000533808.1 alternative 3' UTR ENST00000529586.1 alternative 3' UTR ENST00000531845.1 v-myb myeloblastosis viral oncogene homolog (avian) ENST00000430686.2 v-myb myeloblastosis viral oncogene homolog (avian) ENST00000534736.1 alternative 3' UTR ENST00000455534.1 Bender et al. 1987 [PMID: 3498214] ENST00000434255.1 putative novel transcript ENST00000457866.2 alternative 5' UTR ENST00000475846.2 novel protein ENST00000498558.1 novel transcript ENST00000367799.2 novel protein (contains FLJ20069 and DKFZp434N031) ENST00000265602.6 alternative 5' UTR ENST00000487135.1 novel transcript ENST00000327035.6 novel protein ENST00000524469.1 not organism-supported ENST00000488690.2 novel protein ENST00000534469.1 alternative 5' UTR ENST00000444302.1 novel transcript ENST00000436554.1 continues from dJ71N10.2 in Em:AL133544 ENST00000436554.1 novel transcript ENST00000423411.2 glyceraldehde-3-phosphate dehydrogenase (GAPD) pseudogene ENST00000416481.1 putative novel transcript ENST00000421378.1 putative novel transcript ENST00000438618.1 putative novel transcript ENST00000403495.1 high-mobility group (non-histone chromosomal) protein 1-like 1 (HMG1L1) pseudogene ENST00000447848.1 putative novel transcript ENST00000308191.6 phosphodiesterase 7B ENST00000446774.1 novel protein ENST00000392354.2 cytochrome c oxidase subunit Vb (COX5B) pseudogene ENST00000451457.2 novel protein ENST00000367784.2 novel protein ENST00000420702.1 novel protein ENST00000420702.1 alternative 5' UTR ENST00000531224.1 KIAA0164 protein ENST00000527536.1 not organism-supported ENST00000527613.1 alternative 3' UTR ENST00000530429.1 not organism-supported ENST00000529917.1 not organism-supported ENST00000529826.1 NAGNAG splice site ENST00000529826.1 not organism-supported ENST00000476194.1 novel transcript ENST00000403956.1 pseudogene similar to Elongation Factor 1-Alpha (EF-1-ALPHA, Statin S1) ENST00000354570.2 microtubule-associated protein 7 (EMAP115, E-MAP-115) ENST00000407767.1 ribosomal protein, large, P1 (RPLP1) pseudogene ENST00000405850.1 novel pseudogene ENST00000405668.1 NADH dehydrogenase (ubiquinone) Fe-S protein 5 (15kD) (NADH-coenzyme Q reductase) (NDUFS5) pseudogene ENST00000359015.4 mitogen-activated protein kinase kinase kinase 5 (ASK1, MEKK5, MAPKKK5) ENST00000463140.1 novel transcript ENST00000432477.1 novel transcript ENST00000367756.4 peroxisomal biogenesis factor 7 (PTS2R, RCDP1) ENST00000318471.3 peroxisomal biogenesis factor 7 (PTS2R, RCDP1) ENST00000425027.1 ribosomal protein L7a (RPL7A) pseudogene ENST00000432330.1 novel transcript ENST00000418699.1 novel transcript ENST00000458017.1 putative novel transcript ENST00000316649.5 interleukin 20 receptor alpha (class II cytokine receptor ZCYTOR7) ENST00000468393.1 interleukin 20 receptor alpha (class II cytokine receptor ZCYTOR7) ENST00000367746.3 interleukin 20 receptor alpha (class II cytokine receptor ZCYTOR7) ENST00000461799.1 interleukin 20 receptor alpha (class II cytokine receptor ZCYTOR7) ENST00000460306.1 interleukin 20 receptor alpha (class II cytokine receptor ZCYTOR7) ENST00000349184.4 class II cytokine receptor (IL22RA2) (interleukin 22-binding protein, IL22BP), variant 1 (CRF2-10) ENST00000296980.2 class II cytokine receptor (IL22RA2) (interleukin 22-binding protein, IL22BP), variant 2 (CRF2-10L) ENST00000339602.3 class II cytokine receptor (IL22RA2) (interleukin 22-binding protein, IL22BP), variant 3 (CRF2-10S) ENST00000367739.4 interferon gamma receptor 1 (immune interferon, receptor for) ENST00000458076.1 interferon gamma receptor 1 (immune interferon, receptor for) ENST00000414770.1 interferon gamma receptor 1 (immune interferon, receptor for) ENST00000478333.1 interferon gamma receptor 1 (immune interferon, receptor for) ENST00000418879.1 basic transcription factor 3 (BTF3) pseudogene ENST00000440397.1 putative novel transcript ENST00000404534.1 protein tyrosine phosphatase, non-receptor type 11 (Noonan syndrome 1) (PTPN11) (CFC, NS1,SHP2, BPTP3, PTP2C, SHP-2, PTP-1D, SH-PTP2, SH-PTP3) pseudogene ENST00000411615.1 putative novel transcript ENST00000419220.1 putative novel transcript ENST00000440578.1 putative novel transcript ENST00000448942.1 putative novel transcript ENST00000431144.1 putative novel transcript ENST00000421450.1 alternatively spliced 5' UTR; shares partial CDS with bA356I2.3.1 ENST00000421450.1 tumour necrosis factor, alpha-induced protein 3 (A20, TNFA1P2) ENST00000421450.1 alternative 5' UTR ENST00000420009.1 alternatively spliced 5' UTR; shares partial CDS with bA356I2.3.1 ENST00000420009.1 tumour necrosis factor, alpha-induced protein 3 (A20, TNFA1P2) ENST00000420009.1 alternative 5' UTR ENST00000237289.4 tumour necrosis factor, alpha-induced protein 3 (A20, TNFA1P2) ENST00000433680.1 alternatively spliced 5' UTR; shares partial CDS with bA356I2.3.1 ENST00000433680.1 alternative 5' UTR ENST00000433680.1 4tumour necrosis factor, alpha-induced protein 3 (A20, TNFA1P2) ENST00000485192.1 tumour necrosis factor, alpha-induced protein 3 (A20, TNFA1P2) ENST00000417932.1 putative novel transcript ENST00000417800.1 putative novel transcript ENST00000434437.1 putative novel transcript ENST00000403415.1 laminin receptor 1 (67kD, ribosomal protein SA) (LAMR1) pseudogene ENST00000421351.2 p53-induced protein PIGPC1 (PERP) ENST00000404229.1 pseudogene similar to Mus musculus upregulated during skeletal muscle growth 5 (Usmg5) ENST00000401037.2 macrophage myristoylated alanine-rich C kinase substrate (MACMARCKS) pseudogene ENST00000453452.1 novel transcript ENST00000427025.2 novel protein protein (KIAA1357) ENST00000427025.2 not organism-supported ENST00000343505.5 NP_001137532.1 ENST00000342260.5 not organism-supported ENST00000405630.1 mitochondrial carrier homolog 1 (MTCH1) pseudogene ENST00000432673.1 novel transcript ENST00000428044.1 novel transcript ENST00000458733.1 novel transcript ENST00000447494.1 novel transcript ENST00000332797.6 novel protein (includes DKFZP586D0623) ENST00000401414.2 alternative 5' UTR ENST00000449542.1 novel 7 transmembrane receptor (rhodopsin family) pseudogene similar to CCRL1 ENST00000404494.1 suppressor of mif two 3 homolog 2 (yeast) (SMT3H2) pseudogene ENST00000367663.4 NP_001122089.1 ENST00000529597.1 NAGNAG splice site ENST00000529597.1 not organism-supported ENST00000409812.2 Human Swiss-Prot isoform SW:Q96D71-2.3 ENST00000258062.5 Human Swiss-Prot isoform SW:Q96D71-3.3 ENST00000258062.5 NP_114128.3 ENST00000258062.5 NAGNAG splice site ENST00000415951.2 not organism-supported ENST00000367660.3 hypothetical protein PRO2013 ENST00000461027.1 hypothetical protein PRO2013 ENST00000367658.2 hHDC for homolog of Drosophila headcase (LOC51696) ENST00000415194.1 novel transcript ENST00000358430.3 novel protein DKFZp451A175 (similar to M. musculus muscle-derived protein MDP77), variant 1 (3' UTR includes FLJ32408) ENST00000358430.3 novel protein DKFZp451A175 (similar to M. musculus muscle-derived protein MDP77) ENST00000367652.4 novel protein ENST00000441249.1 novel transcript ENST00000440518.1 novel transcript ENST00000455535.1 putative novel transcript ENST00000403909.1 DnaJ (Hsp40) homolog, subfamily C, member 7 (DNAJC7) pseudogene ENST00000367651.2 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 (MRG1, P35SRJ) ENST00000454788.1 putative novel transcript ENST00000402768.1 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit b, variant 1 (ATP5F1) pseudogene ENST00000381279.2 thyroid hormone receptor interactor 4 (TRIP4) pseudogene ENST00000431609.1 novel transcript ENST00000414038.1 novel transcript ENST00000445585.1 putative novel transcript ENST00000456896.1 novel transcript ENST00000418834.1 novel transcript ENST00000446458.1 novel transcript ENST00000407896.1 40s ribosomal protein S3a (v-fos transformation effector protein 1) (RPS3A)(FTE1) pseudogene ENST00000455011.1 putative novel transcript ENST00000407538.1 ribosomal protein S18 (40S ribosomal protein S18) (RPS18)(KE3, HKE3, KE-3) pseudogene ENST00000401762.1 ribosomal protein S3A (40S ribosomal protein S3a, v-fos transformation effector protein 1) (RPS3A)(FTE1) pseudogene ENST00000480652.1 neuromedin B receptor (NMBR) ENST00000258042.1 neuromedin B receptor (NMBR) ENST00000454401.1 putative novel transcript ENST00000450456.1 novel transcript ENST00000367621.1 hypothetical protein HSPC228 (HSPC228) ENST00000491881.1 hypothetical protein HSPC228 (HSPC228) ENST00000426166.1 putative novel transcript ENST00000230173.6 novel protein (DKFZP564D0462)(FLJ14937) ENST00000367608.2 novel protein (DKFZP564D0462)(FLJ14937) ENST00000435011.2 NAGNAG splice site ENST00000463637.1 novel protein (DKFZP564D0462)(FLJ14937) ENST00000497898.2 novel protein (DKFZP564D0462)(FLJ14937) ENST00000447311.1 novel transcript ENST00000437067.1 putative novel transcript ENST00000367604.1 human immunodeficiency virus type I enhancer binding protein 2 (human immunodeficiency virus type I enhancer-binding protein 2)(HIVEP2)(MBP-2, HIV-EP2) ENST00000012134.2 human immunodeficiency virus type I enhancer binding protein 2 (human immunodeficiency virus type I enhancer-binding protein 2)(HIVEP2)(MBP-2, HIV-EP2) ENST00000474532.1 human immunodeficiency virus type I enhancer binding protein 2 (human immunodeficiency virus type I enhancer-binding protein 2)(HIVEP2)(MBP-2, HIV-EP2) ENST00000454411.1 putative novel transcript ENST00000421237.1 putative novel transcript ENST00000417650.1 putative novel transcript ENST00000419957.1 novel transcript (FLJ32928) ENST00000446115.1 novel transcript (FLJ32928) ENST00000454588.1 putative novel transcript ENST00000367601.4 androgen induced protein (AIG-1) (CGI-103) ENST00000447498.1 androgen induced protein (AIG-1) (CGI-103) ENST00000357847.4 androgen induced protein (AIG-1) (CGI-103) ENST00000367596.1 androgen induced protein (AIG-1) (CGI-103) ENST00000275235.4 androgen induced protein (AIG-1) (CGI-103) ENST00000275235.4 androgen induced protein (AIG-1) (CGI-103), variant 5 (FLJ10485) ENST00000458219.1 androgen induced protein (AIG-1) (CGI-103) ENST00000470265.1 androgen induced protein (AIG-1) (CGI-103) ENST00000494282.1 androgen induced protein (AIG-1) (CGI-103) ENST00000423500.1 putative novel transcript ENST00000404020.1 pseudogene similar to actin genes ENST00000403591.1 ribosomal protein L31 (RPL31) pseudogene ENST00000402907.1 pseudogene similar to hypothetical proteins PRO2207 and similar to presenilins associated rhomboid-like protein ENST00000237283.8 novel protein similar to yeast and bacterial cytosine deaminase ENST00000367593.1 novel protein similar to yeast and bacterial cytosine deaminase ENST00000402141.1 probably a pseudogene ENST00000402141.1 novel protein similar to tubulin, beta polypeptide 4, member Q (TUBB4Q) ENST00000367592.1 peroxisomal biogenesis factor 3 (peroxin 3) ENST00000367591.4 peroxisomal biogenesis factor 3 (peroxin 3) ENST00000406025.1 VDAC1 (voltage-dependent anion channel 1 (Plasmalemmal porin)) pseudogene ENST00000002165.5 novel protein (MGC1314) similar to fucosidase, alpha-L- 1, tissue ENST00000451668.1 novel protein (MGC1314) similar to fucosidase, alpha-L- 1, tissue ENST00000367585.1 novel protein (MGC1314) similar to fucosidase, alpha-L- 1, tissue ENST00000415586.1 novel transcript ENST00000367584.4 novel protein (contains KIAA0680) ENST00000367584.4 not organism-supported ENST00000427704.2 novel protein (contains KIAA0680) ENST00000305766.6 NP_001093636.1 ENST00000440869.2 novel protein (contains KIAA0680) ENST00000440869.2 NP_001093634.1 ENST00000451827.2 novel protein (contains KIAA0680) ENST00000450575.1 novel transcript ENST00000545614.1 subject to nonsense-mediated decay ENST00000367576.5 novel protein (similar to nucleolin) (contains FLJ14909) ENST00000416313.1 novel protein similar to hypothetical mouse protein ENST00000416313.1 may simply continue as dJ468K18.5.2 ENST00000454207.1 novel protein similar to hypothetical mouse protein ENST00000360537.2 pleiomorphic adenoma gene-like 1 (PLAG-like 1, LOT1, ZAC, ZAC tumor suppressor) ENST00000354765.2 pleiomorphic adenoma gene-like 1 (PLAG-like 1, LOT1, ZAC, ZAC tumor suppressor) ENST00000367572.1 pleiomorphic adenoma gene-like 1 (PLAG-like 1, LOT1, ZAC, ZAC tumor suppressor) ENST00000367571.1 pleiomorphic adenoma gene-like 1 (PLAG-like 1, LOT1, ZAC, ZAC tumor suppressor) ENST00000417959.1 pleiomorphic adenoma gene-like 1 (PLAG-like 1, LOT1, ZAC, ZAC tumor suppressor) ENST00000493898.1 pleiomorphic adenoma gene-like 1 (PLAG-like 1, LOT1, ZAC, ZAC tumor suppressor) ENST00000401791.1 FK506 binding protein 7 (FKBP7) pseudogene ENST00000401492.1 pseudogene similar to hypothetical mouse protein ENST00000367568.4 syntaxin 11 ENST00000403538.1 tumor protein, translationally-controlled 1 (TPT1) pseudogene ENST00000404655.1 pseudogene similar to single-stranded DNA-binding protein ENST00000433557.1 utrophin (dystrophin-related protein) (DRP, DRP1, DMDL) ENST00000433557.1 utrophin (homologous to dystrophin) (DRP, DRP1, DMDL) ENST00000367545.3 utrophin (homologous to dystrophin) ENST00000367545.3 utrophin (dystrophin-related protein) (DRP, DRP1, DMDL) ENST00000367545.3 utrophin (homologous to dystrophin) (DRP, DRP1, DMDL) ENST00000421035.1 utrophin (homologous to dystrophin) (DRP, DRP1, DMDL) ENST00000367526.4 utrophin (homologous to dystrophin) (DRP, DRP1, DMDL) ENST00000367525.3 utrophin (homologous to dystrophin) (DRP, DRP1, DMDL) ENST00000480333.1 utrophin (homologous to dystrophin) ENST00000367524.3 utrophin (homologous to dystrophin) ENST00000432686.1 utrophin (homologous to dystrophin) ENST00000417142.1 utrophin (homologous to dystrophin) ENST00000455022.1 utrophin (homologous to dystrophin) ENST00000465299.1 utrophin (homologous to dystrophin) ENST00000460618.1 utrophin (homologous to dystrophin) ENST00000431309.1 putative novel transcript ENST00000402856.1 novel pseudogene similar to FLJ23678 ENST00000406602.1 novel pseudogene similar to hypothetical protein HT023 ENST00000402316.1 novel pseudogene ENST00000404707.1 BTB/POZ domain zinc finger protein pseudogene ENST00000450221.1 epilepsy, progressive myoclonus type 2, Lafora disease (laforin) ENST00000450221.1 epilepsy, progressive myoclonus type 2, Lafora disease protein (laforin) protein ENST00000450221.1 epilepsy, progressive myoclonus type 2, Lafora disease protein (laforin) ENST00000367519.3 epilepsy, progressive myoclonus type 2, Lafora disease protein (laforin) ENST00000435470.1 epilepsy, progressive myoclonus type 2, Lafora disease protein (laforin) ENST00000496228.1 epilepsy, progressive myoclonus type 2, Lafora disease protein (laforin) ENST00000489412.1 epilepsy, progressive myoclonus type 2, Lafora disease protein (laforin) ENST00000461700.1 epilepsy, progressive myoclonus type 2, Lafora disease protein (laforin) ENST00000237281.3 novel protein similar to KIAA1195 ENST00000452617.1 novel transcript ENST00000367505.2 novel protein similar to S. pombe Rad8 ENST00000275233.7 alternative 5' UTR ENST00000334716.2 novel pseudogene ENST00000405812.1 phosphoribosyl pyrophosphate synthetase (PRPS1, PRPS2) pseudogene ENST00000367495.3 RAB32, member RAS oncogene family ENST00000419168.1 novel transcript ENST00000397944.3 confirm experimentally ENST00000397944.3 NP_078970.3 ENST00000326929.4 FLJ40251 ENST00000453433.1 novel pseudogene ENST00000367477.3 FLJ34275 ENST00000436295.1 putative novel transcript ENST00000359838.3 putative novel transcript ENST00000367481.3 tomosyn (LOC134957), variant 1 (possible ortholog of rat m-tomosyn, contains FLJ30922) ENST00000321680.6 tomosyn (LOC134957), variant 2 (possible ortholog of rat b-tomosyn) ENST00000367480.3 tomosyn (LOC134957), variant 3 (possible ortholog of rat s-tomosyn) ENST00000367475.2 tomosyn (LOC134957) ENST00000392291.2 tomosyn (LOC134957) ENST00000443556.1 may link to bA361F15.1 ENST00000443556.1 putative novel transcript ENST00000401504.1 Yes-associated protein 1, 65kD (YAP1) pseudogene ENST00000367474.1 novel protein similar to hypothetical Drosophila proteins (contains a SAM domain) ENST00000432506.1 novel transcript ENST00000442094.1 novel transcript ENST00000434985.1 novel transcript ENST00000427015.1 novel transcript ENST00000448909.1 putative novel transcript ENST00000422023.1 novel transcript ENST00000417838.1 putative novel transcript ENST00000417838.1 non canonical splice acceptor site ENST00000423268.1 novel transcript ENST00000367469.1 novel protein ENST00000367467.3 KIAA0790 protein (KIAA0970) (FLJ21842, FLJ14341, FLJ23669) ENST00000470750.1 novel transcript ENST00000400072.2 cytochrome P450, 51 (lanosterol 14-alpha-demethylase) (CYP51) pseudogene ENST00000407465.1 small nuclear ribonucleoprotein polypeptide E (SNRPE) pseudogene ENST00000367463.4 uronyl-2-sulfotransferase (uronyl2-sulfotransferase, dermatan/chondroitin sulfate 2-sulfotransferase) ENST00000367463.4 uronyl-2-sulfotransferase (uronyl 2-sulfotransferase, dermatan/chondroitin sulfate 2-sulfotransferase) ENST00000473631.1 uronyl-2-sulfotransferase (uronyl 2-sulfotransferase, dermatan/chondroitin sulfate 2-sulfotransferase) ENST00000466695.1 uronyl-2-sulfotransferase (uronyl 2-sulfotransferase, dermatan/chondroitin sulfate 2-sulfotransferase) ENST00000413845.1 novel transcript ENST00000433442.1 putative novel transcript ENST00000407763.1 small nuclear ribonucleoprotein polypeptide B'' (SNRPB2) pseudogene ENST00000443992.1 novel transcript ENST00000451095.1 novel transcript ENST00000445901.1 novel transcript ENST00000484505.1 mitogen-activated protein kinase kinase kinase 7 interacting protein 2 (TAK1-binding protein 2) (MAP3K7IP2)(TAB2, FLJ21885, KIAA0733) ENST00000424421.1 putative novel transcript ENST00000401911.1 pseudogene similar to peripheral myelin protein 2 (M-FABP) (PMP2)(P2, MP2, FABP8). ENST00000406807.1 HSPC128 protein (HSPC128) pseudogene ENST00000253329.2 peptidylprolyl isomerase (cyclophilin)-like 4 (HDCME13P) ENST00000340881.2 peptidylprolyl isomerase (cyclophilin)-like 4 (HDCME13P) ENST00000446392.1 putative novel transcript ENST00000367419.5 novel protein (LOC116254) ENST00000433539.1 novel protein ENST00000435273.1 putative novel transcript ENST00000419134.1 putative novel transcript ENST00000482817.1 ribosomal protein S18 (RPS18) pseudogene ENST00000543571.1 LATS, large tumor suppressor, homolog 1 (Drosophila) ENST00000253339.5 alternative 5' UTR ENST00000253339.5 not organism-supported ENST00000441107.1 alternative 5' UTR ENST00000542720.1 LATS, large tumor suppressor, homolog 1 (Drosophila) ENST00000463048.2 upstream uORF ENST00000367378.1 alternative_3'_end ENST00000464889.1 NM_005389.2 ENST00000480010.1 novel transcript ENST00000404779.1 novel pseudogene ENST00000455607.1 novel transcript ENST00000239367.2 novel protein (FLJ14735) ENST00000463728.1 novel transcript ENST00000367368.2 novel protein ENST00000472053.1 novel transcript ENST00000406551.1 t-complex 1 (TCP1) pseudogene ENST00000531073.1 alternative 5' UTR ENST00000446954.1 novel transcript ENST00000407115.1 novel pseudogene similar to FLJ13465 ENST00000402138.1 pseudogene similar to small nuclear RNA activating complex, polypeptide 1, 43kD (SNAPC1) (SNAP43, PTFGAMMA, PTFgamma) ENST00000367360.2 novel protein similar to UL16 binding protein 2 (ULBP2) ENST00000421363.1 novel transcript ENST00000435483.1 novel transcript ENST00000407271.1 pseudogene similar to small nuclear RNA activating complex, polypeptide 1, 43kD (SNAPC1) (SNAP43, PTFGAMMA, PTFgamma) ENST00000367351.3 UL16 binding protein 2 (RAET1H, ALCAN-alpha) ENST00000399570.2 pseudogene similar to small nuclear RNA activating complex, polypeptide 1, 43kD (SNAPC1) (SNAP43, PTFGAMMA, PTFgamma) ENST00000367345.1 UL16 binding protein 1 ENST00000406262.1 pseudogene similar to UL16 binding protein 1 (ULBP16) ENST00000433415.1 basic transcription factor 3 (BTF3) pseudogene ENST00000367341.1 retinoic acid early transcript 1 (RAET1L) ENST00000405282.1 retinoic acid early transcript 1 (RAET1L) pseudogene ENST00000456346.1 putative novel transcript ENST00000392260.2 prohibitin (PHB) pseudogene ENST00000367339.1 UL16 binding protein 3 ENST00000361131.4 protein phosphatase 1, regulatory (inhibitor) subunit 14C (KEPI, NY-BR-81, CPI17-like) ENST00000407630.1 signal sequence receptor, alpha (translocon-associated protein alpha) (SSR1) (TRAPA) pseudogene ENST00000407887.1 alpha-methylacyl-CoA racemase (AMACR) pseudogene ENST00000367326.1 novel protein (contains FLJ31738 and KIAA1209) ENST00000358517.2 novel protein (contains FLJ31738 and KIAA1209) ENST00000475490.1 novel protein (contains FLJ31738 and KIAA1209) ENST00000430770.1 putative novel transcript ENST00000456018.1 putative novel transcript ENST00000455229.1 putative novel transcript ENST00000398028.2 novel pseudogene similar to phosducin-like proteins ENST00000367321.3 novel protein similar to C1-tetrahydrofolate synthases (contains DKFZP586G1517 protein and FLJ21145, contains a tetrahydrofolate dehydrogenase/cyclohydrolase domain) ENST00000367308.4 novel protein similar to C1-tetrahydrofolate synthases ENST00000441122.1 novel protein similar to C1-tetrahydrofolate synthases (contains DKFZP586G1517 protein and FLJ21145, contains a tetrahydrofolate dehydrogenase/cyclohydrolase domain) ENST00000423867.1 novel protein similar to C1-tetrahydrofolate synthases (contains DKFZP586G1517 protein and FLJ21145, contains a tetrahydrofolate dehydrogenase/cyclohydrolase domain) ENST00000443074.1 novel protein similar to C1-tetrahydrofolate synthases (contains DKFZP586G1517 protein and FLJ21145, contains a tetrahydrofolate dehydrogenase/cyclohydrolase domain) ENST00000425276.1 novel protein similar to C1-tetrahydrofolate synthases (contains DKFZP586G1517 protein and FLJ21145, contains a tetrahydrofolate dehydrogenase/cyclohydrolase domain) ENST00000421497.1 novel protein similar to C1-tetrahydrofolate synthases (contains DKFZP586G1517 protein and FLJ21145, contains a tetrahydrofolate dehydrogenase/cyclohydrolase domain) ENST00000478643.1 novel protein similar to C1-tetrahydrofolate synthases (contains DKFZP586G1517 protein and FLJ21145, contains a tetrahydrofolate dehydrogenase/cyclohydrolase domain) ENST00000420192.1 novel protein similar to C1-tetrahydrofolate synthases (contains DKFZP586G1517 protein and FLJ21145, contains a tetrahydrofolate dehydrogenase/cyclohydrolase domain) ENST00000453602.1 novel protein similar to C1-tetrahydrofolate synthases ENST00000450635.1 novel protein similar to C1-tetrahydrofolate synthases ENST00000404372.1 ADP-riboslyation factor-like 4 (ARL4) pseudogene ENST00000445833.1 novel transcript ENST00000415477.1 novel transcript ENST00000405720.1 60S ribosomal protein L32 (RPL32) pseudogene ENST00000431947.1 putative novel transcript ENST00000440335.1 ribosomal protein S12 (RPS12) pseudogene ENST00000253332.1 A kinase (PRKA) anchor protein (gravin) 12 ENST00000354675.6 A kinase (PRKA) anchor protein (gravin) 12 ENST00000490177.1 A kinase (PRKA) anchor protein (gravin) 12 ENST00000325144.4 novel protein (KIAA1483) ENST00000367303.4 FLJ20627 ENST00000367294.3 novel protein (FLJ12910), variant 1 ENST00000494826.1 novel protein, variant 2 ENST00000483931.1 novel transcript, variant 3 ENST00000239374.7 novel protein (FLJ23305) ENST00000239374.7 continues as bA282P11.1 in Em:AL359494 ENST00000239374.7 continued from bA108N8.3 in Em:AL590543 ENST00000544131.1 overlapping uORF ENST00000404742.1 alternative 5' UTR ENST00000338799.5 alternative 5' UTR ENST00000446550.1 alternative 5' UTR ENST00000488573.1 estrogen receptor 1 ENST00000482101.1 estrogen receptor 1 ENST00000451697.1 putative novel transcript ENST00000539504.1 Evidence: mouse SW:Q6ZWR6-3.2 (949aa) ENST00000539504.1 synaptic nuclei expressed gene 1b (SYNE-1) (nesprin-1 beta, MYNE1, SYNE1, KIAA0796) ENST00000539504.1 not organism-supported ENST00000367257.4 not organism-supported ENST00000347037.5 synaptic nuclei expressed gene 1b (SYNE-1) (nesprin-1 beta, MYNE1, SYNE1, KIAA0796) ENST00000354674.4 Evidence: mouse SW:Q6ZWR6-2.2 ENST00000354674.4 not organism-supported ENST00000472563.2 synaptic nuclei expressed gene 1b (SYNE-1) (nesprin-1 beta, MYNE1, SYNE1, KIAA0796) ENST00000488376.2 synaptic nuclei expressed gene 1b (SYNE-1) (nesprin-1 beta, MYNE1, SYNE1, KIAA0796) ENST00000367253.4 confirm experimentally ENST00000367248.3 Evidence: mouse SW:Q6ZWR6-5.2 (1431aa) ENST00000367248.3 not organism-supported ENST00000413186.2 confirm experimentally ENST00000537750.1 not organism-supported ENST00000412161.1 novel transcript ENST00000458194.1 novel transcript ENST00000449282.1 putative novel transcript ENST00000532295.1 alternative 3' UTR ENST00000402302.1 pseudogene similar to part of heat shock 60kD protein 1 (chaperonin) (HSPD1) (GROEL) ENST00000367244.3 vasoactive intestinal peptide ENST00000367243.3 vasoactive intestinal peptide ENST00000431366.1 vasoactive intestinal peptide ENST00000456715.1 novel transcript ENST00000417654.1 putative novel transcript ENST00000406999.1 tubulin, beta pseudogene ENST00000405959.1 novel pseudogene ENST00000477822.1 F-box only protein 5 (EMI1, FBX5, F-box protein Fbx5) ENST00000442269.1 putative novel transcript ENST00000461949.1 novel transcript ENST00000367233.5 similar to prokaryotic-type class I peptide chain release factors (LOC54516) ENST00000464135.1 novel transcript ENST00000367231.5 novel protein ENST00000367230.1 novel protein ENST00000414771.1 novel protein ENST00000485512.1 novel transcript ENST00000463251.1 novel transcript ENST00000485283.1 novel transcript ENST00000448966.1 novel protein ENST00000482526.1 novel transcript ENST00000492974.1 ribosomal protein L27a (60S ribosomal protein L27a) (RPL27A) pseudogene ENST00000436953.1 novel transcript ENST00000402702.1 cytochrome c oxidase II (MTCO2) pseudogene ENST00000406098.1 ATP synthase 8 (MTATP8) pseudogene ENST00000406985.1 ATP synthase 6 (MTATP6) pseudogene ENST00000405526.1 cytochrome c oxidase III (MTCO3) pseudogene ENST00000407663.1 NADH dehydrogenase 3 (MTND3) pseudogene ENST00000402379.1 NADH dehydrogenase 4L (NADH dehydrogenase, subunit 4L (complex I)) (MTND4L) pseudogene ENST00000402078.1 NADH dehydrogenase 4 (NADH dehydrogenase, subunit 4 (complex I)) (MTND4) pseudogene ENST00000403971.1 high mobility group (nonhistone chromosomal) protein 4 (HMG4) pseudogene ENST00000419506.2 NP_001138758.1 ENST00000522555.1 alternative 5' UTR ENST00000522236.1 alternative 5' UTR ENST00000422970.2 alternative 5' UTR ENST00000517438.1 alternative 5' UTR ENST00000519405.1 alternative 5' UTR ENST00000519190.1 alternative 5' UTR ENST00000520261.1 alternative 5' UTR ENST00000456309.1 ribosomal protein L17 (RPL17) pseudogene ENST00000367213.2 similar to maguin-2; maguin-1 (LOC154043, FLJ31349) ENST00000424998.1 similar to maguin-2; maguin-1 (LOC154043, FLJ31349) ENST00000454664.1 similar to maguin-2; maguin-1 (LOC154043, FLJ31349) ENST00000404107.1 novel pseudogene ENST00000402039.1 ribosomal protein S4, X-linked (RPS4X) pseudogene ENST00000367178.3 novel protein (KIAA1116) ENST00000461219.1 novel protein (KIAA1116) ENST00000464628.1 novel protein (KIAA1116) ENST00000479234.1 novel protein (KIAA1116) ENST00000545347.1 alternative 5' UTR ENST00000538270.1 alternative 5' UTR ENST00000535231.1 alternative 5' UTR ENST00000528535.1 alternative 5' UTR ENST00000535583.1 alternative 5' UTR ENST00000360366.4 Human Swiss-Prot isoform: Q8IVF5-5.4 (1077aa); partial at its 5' end ENST00000360366.4 not organism-supported ENST00000529824.2 Human Swiss-Prot isoform: Q8IVF5-2.4 (1730aa) ENST00000529824.2 confirm experimentally ENST00000456877.2 Human Swiss-Prot isoform: Q8IVF5-4.4 (1013aa) ENST00000528391.2 T-cell lymphoma invasion and metastasis 2 (SIF and Tiam 1-like exchange factor) (TIAM2)(STEF) ENST00000275246.7 Human Swiss-Prot isoform: Q8IVF5-3.4 (626aa) ENST00000435295.1 putative novel transcript ENST00000367166.4 transcription factor B1, mitochondrial (CGI-75 protein homolog of yeast mitochondrial transcription factor B) (TFB1M)(CGI75, mtTFB, CGI-75) ENST00000468889.1 transcription factor B1, mitochondrial (CGI-75 protein homolog of yeast mitochondrial transcription factor B) (TFB1M)(CGI75, mtTFB, CGI-75) ENST00000470239.1 transcription factor B1, mitochondrial (CGI-75 protein homolog of yeast mitochondrial transcription factor B) (TFB1M)(CGI75, mtTFB, CGI-75) ENST00000495806.1 transcription factor B1, mitochondrial (CGI-75 protein homolog of yeast mitochondrial transcription factor B) (TFB1M)(CGI75, mtTFB, CGI-75) ENST00000489874.1 transcription factor B1, mitochondrial (CGI-75 protein homolog of yeast mitochondrial transcription factor B) (TFB1M)(CGI75, mtTFB, CGI-75) ENST00000487586.1 transcription factor B1, mitochondrial (CGI-75 protein homolog of yeast mitochondrial transcription factor B) (TFB1M)(CGI75, mtTFB, CGI-75) ENST00000475849.1 transcription factor B1, mitochondrial (CGI-75 protein homolog of yeast mitochondrial transcription factor B) (TFB1M)(CGI75, mtTFB, CGI-75) ENST00000480390.1 transcription factor B1, mitochondrial (CGI-75 protein homolog of yeast mitochondrial transcription factor B) (TFB1M)(CGI75, mtTFB, CGI-75) ENST00000466349.1 transcription factor B1, mitochondrial (CGI-75 protein homolog of yeast mitochondrial transcription factor B) (TFB1M)(CGI75, mtTFB, CGI-75) ENST00000367165.3 claudin 20 (CLDN20) ENST00000453579.1 putative novel transcript ENST00000159060.2 NADPH oxidase 3 (NADPH oxidase catalytic subunit-like 3) (NOX3)(GP91-3) ENST00000433486.1 novel transcript ENST00000449072.1 novel transcript ENST00000402808.1 H3 histone, family 3A (H3F3A) (H3F3, H3.3A) pseudogene ENST00000494260.1 putative novel transcript ENST00000478761.1 novel transcript ENST00000506048.1 DAN15 protein ENST00000406202.1 ribosomal protein S15a (RPS15A) pseudogene ENST00000442936.1 putative novel transcript ENST00000400788.3 chromosome 6 open reading frame 35 (BM033) ENST00000367144.3 chromosome 6 open reading frame 35 (BM033) ENST00000405916.2 lactate dehydrogenase A (LDHA) pseudogene ENST00000428694.1 steroid dehydrogenase homolog pseudogene ENST00000407196.1 hypothetical protein PNAS-131 pseudogene ENST00000401486.1 novel reverse transcriptase (RNA-dependent DNA polymerase) domain containing pseudogene ENST00000392185.3 sorting nexin 9 (SH3 and PX domain-containing protein (SH3PX1, SDP1), FLJ22984) ENST00000411838.1 putative novel transcript ENST00000457427.1 putative novel transcript ENST00000422776.1 putative novel transcript ENST00000446768.1 novel transcript ENST00000405341.1 HSPE1 (heat shock 10kD protein 1 (chaperonin 10)) pseudogene ENST00000355585.4 synaptojanin 2 (inositol phosphate 5'-phosphatase 2, INPP5H) (contains FLJ23714 and DKFZp761E1512) ENST00000367113.4 synaptojanin 2 (inositol phosphate 5'-phosphatase 2, INPP5H) (contains FLJ23714) ENST00000449320.1 synaptojanin 2 (inositol phosphate 5'-phosphatase 2, INPP5H) (contains FLJ23714) ENST00000485863.1 synaptojanin 2 (inositol phosphate 5'-phosphatase 2, INPP5H) (contains FLJ23714) ENST00000367112.1 synaptojanin 2 (inositol phosphate 5'-phosphatase 2, INPP5H) (contains FLJ23714) ENST00000442328.1 novel transcript ENST00000367104.3 hypothetical protein FLJ14917, variant 1 (contains FLJ13594) ENST00000367104.3 hypothetical protein FLJ14917 ENST00000435180.1 hypothetical protein FLJ14917 ENST00000367101.1 hypothetical protein FLJ14917 ENST00000438073.1 novel protein (FLJ30544) ENST00000344851.4 signal recognition particle 72kD (SRP72) pseudogene ENST00000432358.1 novel transcript ENST00000367097.3 tubby super-family protein (TUSP, KIAA1397) ENST00000367094.2 tubby super-family protein (TUSP, KIAA1397) ENST00000435116.1 novel transcript ENST00000406011.1 pseudogene similar to Siah-interacting protein (SIP, calcyclin binding protein, CACYBP) ENST00000367090.3 KIAA1423 protein ENST00000403590.1 pseudogene similar to putative deoxyribonuclease KIAA0218 ENST00000367089.3 t-complex-associated-testis-expressed 1-like 1 (CW-1, tctex-1) ENST00000367088.1 t-complex-associated-testis-expressed 1-like 1 (CW-1, tctex-1) ENST00000367085.3 t-complex-associated-testis-expressed 1-like 1 (CW-1, tctex-1) ENST00000469735.1 synaptotagmin-like 3 (SLP3, FLJ31188) ENST00000469735.1 alternatively spliced in 5' UTR; exact exon structure linking this object to the rest of the gene is not yet determined ENST00000469735.1 alternative 5' UTR ENST00000297239.9 synaptotagmin-like 3 (SLP3, FLJ31188) ENST00000406819.1 novel pseudogene ENST00000337147.7 villin 2 (ezrin, Villin-2, cytovillin, CVL, MGC1584, DKFZp762H157) ENST00000367075.3 villin 2 (ezrin, Villin-2, cytovillin, CVL, MGC1584, DKFZp762H157), variant 3; alternatively spliced in 5' UTR ENST00000476189.1 villin 2 (ezrin, Villin-2, cytovillin, CVL, MGC1584, DKFZp762H157) ENST00000451712.1 putative novel transcript ENST00000367073.3 novel protein ENST00000367072.1 novel protein ENST00000486232.1 novel transcript ENST00000434104.1 SNARE Vti1a-beta protein pseudogene (LOC143187) ENST00000367069.1 radial spoke protein 3 (RSP3) ENST00000449822.1 radial spoke protein 3 (RSP3) ENST00000367066.3 T-cell activation GTPase activating protein ENST00000326965.6 T-cell activation GTPase activating protein ENST00000338313.5 T-cell activation GTPase activating protein ENST00000446887.1 putative novel transcript ENST00000421161.1 novel transcript ENST00000419064.1 putative novel transcript ENST00000297267.9 NP_115921.2 ENST00000427460.1 putative novel transcript ENST00000429657.1 novel transcript ENST00000404609.1 60S Ribosomal protein L21 (RPL21) pseudogene ENST00000430078.1 FLJ27255 ENST00000427974.1 putative novel transcript ENST00000367055.4 superoxide dismutase 2, mitochondrial ENST00000367055.4 alternative 3' UTR ENST00000538183.1 superoxide dismutase 2, mitochondrial ENST00000367054.2 alternative 3' UTR ENST00000337404.4 NP_001019637.1 ENST00000537657.1 alternative 5' UTR ENST00000452684.2 superoxide dismutase 2, mitochondrial ENST00000403291.1 pseudogene similar to heterogenous nuclear ribonucleoprotein H ENST00000358372.4 Wilms' tumor 1-associating protein (KIAA0105) (WTAP) ENST00000494513.1 Wilms' tumor 1-associating protein (KIAA0105) (WTAP) ENST00000337387.4 Wilms' tumor 1-associating protein (KIAA0105) (WTAP) ENST00000462110.1 Wilms' tumor 1-associating protein (KIAA0105) (WTAP) ENST00000367048.4 acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl Coenzyme A thiolase) ENST00000467951.1 acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl Coenzyme A thiolase) ENST00000472052.1 acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl Coenzyme A thiolase) ENST00000321394.7 t-complex 1 (CCT1, Ccta, D6S230E) ENST00000392168.2 NP_001008897.1 ENST00000467544.2 t-complex 1 (CCT1, Ccta, D6S230E) ENST00000539948.1 alternative 5' UTR ENST00000536394.1 alternative 5' UTR ENST00000476826.1 mitochondrial ribosomal protein L18 ENST00000479638.1 mitochondrial ribosomal protein L18 ENST00000367034.4 mitochondrial ribosomal protein L18 ENST00000480842.1 mitochondrial ribosomal protein L18 ENST00000434562.1 putative novel transcript ENST00000356956.1 insulin-like growth factor 2 receptor (cation-independent mannose-6 phosphate receptor, Insulin-like growth factor-2 receptor (mannose-6-phosphate receptor, cation-independent)) (IGF2R)(MPRI, CD222, CIMPR, M6P-R) ENST00000464636.1 insulin-like growth factor 2 receptor (cation-independent mannose-6 phosphate receptor, Insulin-like growth factor-2 receptor (mannose-6-phosphate receptor, cation-independent)) (IGF2R)(MPRI, CD222, CIMPR, M6P-R) ENST00000479434.1 insulin-like growth factor 2 receptor (cation-independent mannose-6 phosphate receptor, Insulin-like growth factor-2 receptor (mannose-6-phosphate receptor, cation-independent)) (IGF2R)(MPRI, CD222, CIMPR, M6P-R) ENST00000487607.1 insulin-like growth factor 2 receptor (cation-independent mannose-6 phosphate receptor, Insulin-like growth factor-2 receptor (mannose-6-phosphate receptor, cation-independent)) (IGF2R)(MPRI, CD222, CIMPR, M6P-R) ENST00000475834.1 insulin-like growth factor 2 receptor (cation-independent mannose-6 phosphate receptor, Insulin-like growth factor-2 receptor (mannose-6-phosphate receptor, cation-independent)) (IGF2R)(MPRI, CD222, CIMPR, M6P-R) ENST00000475584.1 insulin-like growth factor 2 receptor (cation-independent mannose-6 phosphate receptor, Insulin-like growth factor-2 receptor (mannose-6-phosphate receptor, cation-independent)) (IGF2R)(MPRI, CD222, CIMPR, M6P-R) ENST00000366273.3 calcium binding protein P22 (calcineurin B homolog, SLC9A1 binding protein, calcineurin homologous protein) (CHP) (SLC9A1BP) pseudogene ENST00000366963.4 solute carrier family 22 (organic cation transporter), member 1 (SLC22A1) (OCT1) ENST00000539263.1 not organism-supported ENST00000324965.4 confirm experimentally ENST00000324965.4 non-submitted evidence ENST00000457470.2 confirm experimentally ENST00000457470.2 non-submitted evidence ENST00000460902.2 confirm experimentally ENST00000460902.2 non-submitted evidence ENST00000460902.2 solute carrier family 22 (organic cation transporter), member 1 (SLC22A1) (OCT1) ENST00000478607.1 solute carrier family 22 (organic cation transporter), member 1 (SLC22A1) (OCT1) ENST00000402250.1 novel pseudogene ENST00000486916.1 solute carrier family 22 (organic cation transporter), member 2 (SLC22A2) (OCT2) ENST00000366953.3 solute carrier family 22 (organic cation transporter), member 2 (SLC22A2) (OCT2) ENST00000498556.1 solute carrier family 22 (organic cation transporter), member 2 (SLC22A2) (OCT2) ENST00000491092.1 solute carrier family 22 (organic cation transporter), member 2 (SLC22A2) (OCT2) ENST00000474259.1 solute carrier family 22 (organic cation transporter), member 2 (SLC22A2) (OCT2) ENST00000366952.1 solute carrier family 22 (organic cation transporter), member 2 (SLC22A2) (OCT2) ENST00000489644.1 solute carrier family 22 (organic cation transporter), member 2 (SLC22A2) (OCT2) ENST00000419196.1 putative novel transcript ENST00000275300.2 solute carrier family 22 (extraneuronal monoamine transporter), member 3 (extraneuronal monoamine transporter solute carrier family 22 (organic cation transporter), member 3) (SLC22A3)(EMT, EMTh, OCT3) ENST00000454031.1 plasminogen (PLG) pseudogene ENST00000316300.5 lipoprotein, Lp(a) (LP, AK38) ENST00000316300.5 The CDS of this object differs considerably from that of Em:X06290.1, the mRNA on which it was based (McLean et al (1987) Nature 330 (6144) 132-137) ENST00000484276.1 lipoprotein, Lp(a) (LP, AK38) ENST00000484276.1 non-canonical splice acceptor site between exons 5 and 6 ENST00000452651.1 pseudogene similar to part of plasminogen (PLG) ENST00000448126.1 putative novel transcript ENST00000447702.1 putative novel transcript ENST00000462918.1 plasminogen (PLG) ENST00000461414.1 plasminogen (PLG) ENST00000454317.1 novel transcript ENST00000454826.1 novel transcript ENST00000443380.1 novel transcript ENST00000413062.1 novel transcript ENST00000437861.1 novel transcript ENST00000405580.1 pseudogene similar to lipoproteins (contains kringle domains) ENST00000420601.1 novel transcript ENST00000417479.1 novel transcript ENST00000366919.2 mitogen-activated protein kinase kinase kinase 4 (MTK1, MEKK4, MAPKKK4, KIAA0213, homolog of yeast SSK2/SSK22 MAP kinase kinase kinase), variant 2 (variant b) ENST00000392142.4 mitogen-activated protein kinase kinase kinase 4 (MTK1, MEKK4, MAPKKK4, KIAA0213, homolog of yeast SSK2/SSK22 MAP kinase kinase kinase), variant 1 (variant a) ENST00000366920.2 not organism-supported ENST00000348824.7 not organism-supported ENST00000446500.1 mitogen-activated protein kinase kinase kinase 4 (MTK1, MEKK4, MAPKKK4, KIAA0213, homolog of yeast SSK2/SSK22 MAP kinase kinase kinase) ENST00000320285.4 FLJ23628, DKFZp434M038 ENST00000437165.1 lysophosphatidic acid acyltransferase-delta (LPAAT-delta), variant 4 (contains mRNA DKFZp434M038) ENST00000436279.1 lysophosphatidic acid acyltransferase-delta (LPAAT-delta) ENST00000366905.3 lysophosphatidic acid acyltransferase-delta (LPAAT-delta) ENST00000366898.1 Parkinson disease (autosomal recessive, juvenile) 2, parkin (PDJ, PRKN, AR-JP), variant 1 (variant 1) ENST00000366897.1 Parkinson disease (autosomal recessive, juvenile) 2, parkin (PDJ, PRKN, AR-JP), variant 2 (variant 2) ENST00000366896.1 Parkinson disease (autosomal recessive, juvenile) 2, parkin (PDJ, PRKN, AR-JP) ENST00000366896.1 Parkinson disease (autosomal recessive, juvenile) 2, parkin (PDJ, PRKN, AR-JP), variant 3 (variant 3) ENST00000366894.1 Parkinson disease (autosomal recessive, juvenile) 2, parkin (PDJ, PRKN, AR-JP) ENST00000338468.3 Parkinson disease (autosomal recessive, juvenile) 2, parkin (PDJ, PRKN, AR-JP) ENST00000479615.1 Parkinson disease (autosomal recessive, juvenile) 2, parkin (PDJ, PRKN, AR-JP) ENST00000366892.1 Parkinson disease (autosomal recessive, juvenile) 2, parkin (PDJ, PRKN, AR-JP) ENST00000441609.1 keratin 8 (KRT8) pseudogene ENST00000366889.2 novel protein (FLJ32724) ENST00000366888.2 novel protein (FLJ32724) ENST00000366888.2 alternative 5' UTR ENST00000404178.1 ribosomal protein L34 (RPL34) pseudogene ENST00000440924.1 novel transcript ENST00000433489.1 novel transcript ENST00000418665.1 novel transcript ENST00000406553.1 RPL37A (60S Ribosomal Protein L37A) pseudogene ENST00000361758.4 not organism-supported ENST00000453779.2 homolog of mouse quaking QKI (KH domain RNA binding protein) ENST00000275262.7 homolog of mouse quaking QKI (KH domain RNA binding protein) ENST00000361752.3 homolog of mouse quaking QKI (KH domain RNA binding protein) ENST00000424802.3 confirm experimentally ENST00000537041.1 alternative 5' UTR ENST00000537124.1 alternative 5' UTR ENST00000544823.1 alternative 5' UTR ENST00000446476.1 putative novel transcript ENST00000452944.1 putative novel transcript ENST00000451328.1 novel transcript ENST00000434356.1 novel transcript ENST00000456118.1 putative novel transcript ENST00000407696.1 pseudogene similar to zinc finger proteins ENST00000494696.1 novel transcript ENST00000230301.8 novel protein ENST00000491176.1 novel transcript ENST00000366882.1 phosphodiesterase 10A ENST00000435810.1 putative novel transcript ENST00000431017.1 putative novel transcript ENST00000455853.1 novel transcript ENST00000444465.1 novel transcript ENST00000402643.2 glyceraldehyde-3-phosphate dehydrogenase (GAPD) pseudogene ENST00000456477.1 novel transcript ENST00000366871.3 T, brachyury homolog (mouse) ENST00000444219.1 putative novel transcript ENST00000255500.2 guanine nucleotide binding protein (G protein), gamma 5 pseudogene (GCG5) ENST00000529616.1 alternative 5' UTR ENST00000487841.1 novel transcript ENST00000479490.1 novel transcript ENST00000478705.1 novel transcript ENST00000488773.1 novel transcript ENST00000494682.1 novel transcript ENST00000421336.1 pseudogene similar to heterogeneous nuclear ribonuclearprotein A ENST00000360961.6 brain protein 44-like (BRP44l) ENST00000487218.1 novel transcript ENST00000366868.1 brain protein 44-like (BRP44l) ENST00000475708.1 novel transcript ENST00000503859.1 NP_001006933.1 ENST00000405189.3 alternative 5' UTR ENST00000507350.1 alternative 5' UTR ENST00000512860.1 alternative 5' UTR ENST00000506565.1 alternative 5' UTR ENST00000511034.1 alternative 5' UTR ENST00000454907.1 IGF-II mRNA-binding protein 3 (KOC1) pseudogene ENST00000455390.1 putative novel transcript ENST00000366855.6 ribonuclease 6 precursor (RNASE6PL)(FLJ10907) ENST00000508775.1 ribonuclease 6 precursor (RNASE6PL)(FLJ10907) ENST00000421787.1 ribonuclease 6 precursor (RNASE6PL)(FLJ10907) ENST00000476238.2 alternative 5' UTR ENST00000476238.2 ribonuclease 6 precursor (RNASE6PL)(FLJ10907) ENST00000478180.2 ribonuclease 6 precursor (RNASE6PL)(FLJ10907) ENST00000478180.2 alternative 5' UTR ENST00000467705.2 ribonuclease 6 precursor (RNASE6PL)(FLJ10907) ENST00000358165.3 ribonuclease 6 precursor (RNASE6PL)(FLJ10907) ENST00000496851.2 ribonuclease 6 precursor (RNASE6PL)(FLJ10907) ENST00000444102.1 novel transcript ENST00000366847.3 FGFR1 oncogene partner (FOP) ENST00000349556.4 FGFR1 oncogene partner (FOP) ENST00000494781.1 FGFR1 oncogene partner (FOP) ENST00000476078.1 FGFR1 oncogene partner (FOP) ENST00000496181.1 FGFR1 oncogene partner (FOP) ENST00000488525.1 FGFR1 oncogene partner (FOP) ENST00000341935.5 chemokine (C-C motif) receptor 6 (chemokine receptor-like3 chemokine (C-C) receptor 6 G protein-coupled receptor 29 seven-transmembrane receptor, lymphocyte, 22) (CCR6) (BN-1, CKR6, DCR2, CKRL3, DRY-6, GPR29, CKR-L3, CMKBR6, GPRCY4, STRL22, GPR-CY4) ENST00000341935.5 alternatively spliced 5' UTR; shares CDS with bA517H2.1.1 ENST00000341935.5 alternative 5' UTR ENST00000349984.4 alternatively spliced 5' UTR; shares CDS with bA517H2.1.2 ENST00000349984.4 chemokine (C-C motif) receptor 6 (chemokine receptor-like3 chemokine (C-C) receptor 6 G protein-coupled receptor 29 seven-transmembrane receptor, lymphocyte, 22) (CCR6) (BN-1, CKR6, DCR2, CKRL3, DRY-6, GPR29, CKR-L3, CMKBR6, GPRCY4, STRL22, GPR-CY4) ENST00000349984.4 alternative 5' UTR ENST00000366832.2 confirm experimentally ENST00000366832.2 not best-in-genome evidence ENST00000366832.2 NP_001138593.1 ENST00000283507.6 confirm experimentally ENST00000283507.6 not best-in-genome evidence ENST00000366834.1 G protein-coupled receptor 31 (GPR31) ENST00000404577.1 novel pseudogene ENST00000454185.1 putative novel transcript ENST00000439207.1 putative novel transcript ENST00000503433.1 alternative 5' UTR ENST00000366829.2 NP_001137419.1 ENST00000239587.5 NYD-TSPG protein ENST00000397829.4 NP_004601.3 ENST00000485157.1 alternative 5' UTR ENST00000400831.2 novel tanscript (FLJ32038) ENST00000392115.2 serine palmitoyltransferase, long chain base subunit 2 (SPTLC2) (LCB2) pseudogene ENST00000495520.1 novel protein (HGC6.2) ENST00000366822.2 novel protein (HGC6.2) ENST00000359760.5 novel gene, variant 1 (HGC6.4) ENST00000425438.1 novel transcript ENST00000417244.1 novel transcript ENST00000441716.1 novel transcript ENST00000414364.1 HGC6.1.1 protein ENST00000456585.1 HGC6.1.1 protein ENST00000443060.2 alternative 5' UTR ENST00000354419.2 kinesin-like 3 ENST00000351261.3 kinesin-like 3 ENST00000496008.1 kinesin-like 3 ENST00000440994.2 NP_001116313.1 ENST00000457340.1 novel transcript ENST00000424343.1 novel transcript ENST00000434596.1 this gene fragment and fragment bA503C24.4 could be part of one gene ENST00000434596.1 novel transcript ENST00000446811.1 this gene fragment and fragment bA503C24.3 could be part of one gene ENST00000446811.1 novel transcript (FLJ31232) ENST00000416709.1 meningioma expressed antigen 6 (coiled-coil proline-rich) (MGEA6) pseudogene ENST00000366795.3 owing to a deletion in cDNA Em:AF318336 between bp 828 and 829 with respect to the genomic sequence, the published translation of this gene (Tr:Q8WYW2) is significantly shorter ENST00000366795.3 novel protein (pp13671) ENST00000445442.1 novel transcript ENST00000436492.1 novel transcript ENST00000444586.1 novel transcript ENST00000419800.1 novel transcript ENST00000413324.1 putative novel transcript ENST00000435377.1 putative novel transcript ENST00000435791.1 alternative 5' UTR ENST00000440168.1 putative novel transcript (FLJ21008) ENST00000433388.1 putative novel transcript ENST00000479310.1 novel transcript ENST00000448612.1 NP_872358.4 ENST00000467418.1 novel transcript ENST00000486490.1 novel transcript ENST00000464249.1 novel transcript ENST00000474018.1 alternative 5' UTR ENST00000366780.4 NP_579866 ENST00000339209.4 NP_060758 ENST00000413088.1 novel transcript ENST00000430250.1 putative novel transcript ENST00000366774.3 t-complex-associated-testis-expressed 3 ENST00000366773.3 hypothetical protein FLJ11152 ENST00000366772.1 novel protein (FLJ10507) ENST00000366771.1 novel protein (FLJ11458) ENST00000492738.1 novel transcript ENST00000477995.1 novel transcript ENST00000437615.1 FLJ31451 ENST00000427017.1 putative novel transcript ENST00000429305.1 putative novel transcript ENST00000405880.1 ribosomal protein L12 (RPL12) ENST00000452071.1 Novel transcript (FLJ25454) ENST00000438622.1 novel transcript ENST00000422894.1 novel transcript ENST00000366756.3 delta-like 1 (Drosophila) ENST00000366751.3 novel protein ENST00000476287.1 novel protein ENST00000476287.1 novel protein (KIAA1838) ENST00000467012.1 novel transcript ENST00000496635.1 Putative novel transcript ENST00000462957.1 proteasome subunit HC5 ENST00000421512.1 alternatively spliced 5' UTR; shares partial CDS with dJ191N21.2.1 ENST00000421512.1 TATA box binding protein (GTF2D, SCA17, TFIID) ENST00000421512.1 alternative 5' UTR ENST00000230354.5 TATA box binding protein (GTF2D, SCA17, TFIID) ENST00000423353.1 alternatively spliced 5' UTR; shares partial CDS with dJ191N21.2.1 ENST00000423353.1 TATA box binding protein (GTF2D, SCA17, TFIID) ENST00000423353.1 alternative 5' UTR ENST00000446829.1 TATA box binding protein (GTF2D, SCA17, TFIID) ENST00000446829.1 this variant and either of variant fragments dJ191N21.2.2 or dJ191N21.2.1 could be part of one single variant ENST00000541970.1 Programmed cell death 2 ENST00000453163.2 Programmed cell death 2 ENST00000453163.2 confirm experimentally ENST00000402444.1 7 transmembrane receptor (rhodopsin family) (olfactory receptor like) pseudogene (hs6M1-11) ENST00000448824.1 Putative novel transcript ENST00000438217.1 Putative novel transcript ENST00000426839.1 Putative novel transcript ENST00000415530.1 Putative novel transcript ENST00000405692.1 alternative 5' UTR ENST00000406797.1 alternative 5' UTR ENST00000403562.1 alternative 5' UTR ENST00000430040.1 alternative 5' UTR ENST00000417852.1 alternative 5' UTR ENST00000456696.1 alternative 5' UTR ENST00000389574.3 NP_079430.3 ENST00000435699.1 alternative 5' UTR ENST00000440380.1 alternative 5' UTR ENST00000439679.1 alternative 5' UTR ENST00000424128.1 alternative 5' UTR ENST00000457598.1 alternative 5' UTR ENST00000421580.1 alternative 5' UTR ENST00000401592.1 NP_001124437.1 ENST00000397098.3 alternative 5' UTR ENST00000491163.1 alternative 5' UTR ENST00000444847.1 alternative 5' UTR ENST00000427680.1 alternative 5' UTR ENST00000401670.1 alternative 5' UTR ENST00000413368.1 alternative 5' UTR ENST00000397088.3 alternative 5' UTR ENST00000316333.8 not organism-supported ENST00000403150.1 alternative 3' UTR ENST00000403150.1 alternative 5' UTR ENST00000406174.2 alternative 5' UTR ENST00000414730.1 alternative 5' UTR ENST00000441933.1 alternative 5' UTR ENST00000431208.1 alternative 5' UTR ENST00000404674.3 alternative 5' UTR ENST00000252329.3 alternative 5' UTR ENST00000406869.1 alternative 5' UTR ENST00000429779.1 alternative 5' UTR ENST00000397046.1 alternative 5' UTR ENST00000397048.1 alternative 5' UTR ENST00000454650.1 alternative 5' UTR ENST00000339737.2 alternative 5' UTR ENST00000457286.1 alternative 5' UTR ENST00000419693.1 alternative 5' UTR ENST00000360876.4 alternative 3' UTR ENST00000432336.1 alternative 5' UTR ENST00000420313.1 presumed genomic sequencing error in exon 3 (1 bp deletion) affects translation ENST00000420313.1 not organism-supported ENST00000423395.1 alternative 5' UTR ENST00000422276.1 alternative 5' UTR ENST00000396946.4 NP_115791 ENST00000356408.3 alternative 5' UTR ENST00000389531.3 confirm experimentally ENST00000457174.1 alternative 5' UTR ENST00000404991.1 The SW proteins in mouse and cow start at the second ATG ENST00000401401.3 NP_940685 ENST00000353796.3 NP_066986 ENST00000401525.3 NP_057087 ENST00000404704.3 NP_001028690 ENST00000382384.2 NP_001028691 ENST00000434816.1 alternative 5' UTR ENST00000396872.2 NP_001035751 ENST00000444741.1 alternative 5' UTR ENST00000297195.4 alternative 5' UTR ENST00000399537.4 not organism-supported ENST00000434361.1 alternative 5' UTR ENST00000432588.1 alternative 5' UTR ENST00000443528.1 alternative 5' UTR ENST00000417101.1 alternative 5' UTR ENST00000414620.1 alternative 5' UTR ENST00000447103.1 alternative 5' UTR ENST00000405801.2 alternative 5' UTR ENST00000416985.1 alternative 5' UTR ENST00000416608.1 alternative 5' UTR ENST00000416608.1 not organism-supported ENST00000404406.1 alternative 5' UTR ENST00000542644.1 alternative 5' UTR ENST00000455618.2 alternative 5' UTR ENST00000409061.1 not organism-supported ENST00000524898.1 alternative 5' UTR ENST00000530143.1 alternative 5' UTR ENST00000452113.1 not organism-supported ENST00000435185.1 not organism-supported ENST00000457091.2 confirm experimentally ENST00000405731.3 alternative 5' UTR ENST00000335965.6 alternative 5' UTR ENST00000396709.1 alternative 5' UTR ENST00000483589.1 alternative 5' UTR ENST00000405858.1 NP_057349 ENST00000342651.5 NP_008887 ENST00000403107.1 NP_001093167.1 ENST00000404077.1 alternative 5' UTR ENST00000435395.1 alternative 5' UTR ENST00000418406.1 alternative 5' UTR ENST00000316731.8 NP_056437 ENST00000429911.1 alternative 5' UTR ENST00000429911.1 not organism-supported ENST00000419721.1 alternative 5' UTR ENST00000453441.1 alternative 5' UTR ENST00000399429.3 NP_001032852 ENST00000340080.4 NP_061878 ENST00000405785.1 alternative 5' UTR ENST00000433635.1 alternative 5' UTR ENST00000456533.1 alternative 5' UTR ENST00000433056.1 alternative 5' UTR ENST00000445169.1 alternative 5' UTR ENST00000401447.1 alternative 5' UTR ENST00000396675.3 alternative 5' UTR ENST00000317367.5 alternative 5' UTR ENST00000447326.1 alternative 5' UTR ENST00000430867.1 alternative 5' UTR ENST00000446305.1 alternative 5' UTR ENST00000438764.1 alternative 5' UTR ENST00000429542.1 alternative 5' UTR ENST00000492822.1 non canonical TEC ENST00000403050.3 KIAA0783 ENST00000469407.1 FLJ41528 ENST00000423059.2 NP_056019.1 ENST00000497575.1 not organism-supported ENST00000396668.3 alternative 5' UTR ENST00000444443.1 alternative 5' UTR ENST00000453686.1 alternative 5' UTR ENST00000442107.1 alternative 5' UTR ENST00000356797.3 alternative 5' UTR ENST00000396664.2 alternative 5' UTR ENST00000439721.1 alternative 5' UTR ENST00000404894.1 alternative 5' UTR ENST00000430479.1 non canonical TEC ENST00000430479.1 30327bp (exon #10), genome sequence missing g ENST00000430479.1 NP_004947.2 ENST00000405358.4 non canonical TEC ENST00000403527.1 non canonical TEC ENST00000405218.2 non canonical TEC ENST00000405218.2 alternative 5' UTR ENST00000443137.1 non canonical TEC ENST00000403685.1 non canonical TEC ENST00000472931.2 non canonical TEC ENST00000438956.1 non canonical TEC ENST00000421381.1 alternative 5' UTR ENST00000431887.1 alternative 5' UTR ENST00000433547.1 alternative 5' UTR ENST00000403951.2 NP_004071.1 ENST00000402815.1 alternative 5' UTR ENST00000407950.1 alternative 5' UTR ENST00000406247.3 NP_663733.1 ENST00000403963.1 not organism-supported ENST00000437998.1 alternative 5' UTR ENST00000399310.3 not organism-supported ENST00000401542.2 not organism-supported ENST00000415365.1 alternative 5' UTR ENST00000446596.1 alternative 5' UTR ENST00000438834.1 alternative 5' UTR ENST00000430000.1 alternative 5' UTR ENST00000412973.1 alternative 5' UTR ENST00000463496.1 CCDS name: CCDS5366.1 ENST00000444712.1 not organism-supported ENST00000433709.2 alternative 5' UTR ENST00000413509.2 alternative 5' UTR ENST00000413380.1 alternative 5' UTR ENST00000406451.3 NP_848510 ENST00000441986.1 alternative 5' UTR ENST00000456174.2 alternative 5' UTR ENST00000405764.3 NP_689987.3 ENST00000493519.1 not organism-supported ENST00000332878.4 alternative 5' UTR ENST00000361443.4 NP_945194.1 ENST00000432066.1 not organism-supported ENST00000448246.1 not organism-supported ENST00000435031.1 alternative 5' UTR ENST00000424363.1 alternative 5' UTR ENST00000439708.1 alternative 5' UTR ENST00000426291.1 alternative 5' UTR ENST00000339077.4 NP_001026880.1 ENST00000409689.1 NP_061334.4 ENST00000465673.1 not organism-supported ENST00000492858.2 not organism-supported ENST00000258733.4 NP_002501.1 ENST00000381990.2 NP_001005340.1 ENST00000421467.1 not organism-supported ENST00000409765.1 alternative 5' UTR ENST00000448353.1 alternative 5' UTR ENST00000410069.1 alternative 5' UTR ENST00000456014.2 alternative 5' UTR ENST00000531170.1 alternative 5' UTR ENST00000444333.2 alternative 5' UTR ENST00000407573.1 alternative 5' UTR ENST00000405982.1 alternative 5' UTR ENST00000432190.1 alternative 5' UTR ENST00000396475.2 alternative 5' UTR ENST00000430180.1 not organism-supported ENST00000430180.1 alternative 5' UTR ENST00000409775.3 alternative 5' UTR ENST00000414428.1 alternative 5' UTR ENST00000409759.1 PMID: 12590732, Collier et al. (2003) DNA Cell Biol 22 ENST00000415162.1 alternative 5' UTR ENST00000441059.1 alternative 5' UTR ENST00000415952.1 alternative 5' UTR ENST00000409409.1 alternative 5' UTR ENST00000409764.1 alternative 5' UTR ENST00000413447.1 alternative 5' UTR ENST00000409280.1 alternative 5' UTR ENST00000443822.1 alternative 5' UTR ENST00000415598.1 alternative 5' UTR ENST00000444434.1 alternative 5' UTR ENST00000396386.2 alternative 5' UTR ENST00000456948.1 alternative 5' UTR ENST00000412416.1 alternative 5' UTR ENST00000396376.1 alternative 5' UTR ENST00000432747.1 alternative 5' UTR ENST00000317201.2 alternative 5' UTR ENST00000522788.1 alternative 5' UTR ENST00000522456.1 alternative 5' UTR ENST00000521779.1 alternative 5' UTR ENST00000521401.1 alternative 5' UTR ENST00000517635.2 FLJ31668 ENST00000519842.1 alternative 5' UTR ENST00000396345.1 This variant (called Hoxa9T) (Fujimoto et al 1998, PMID: 9524228) has been shown to be well conserved (back to chicken), to be expressed (by RT-PCR) and have some functional actvity in vitro (Dintilhac et al 2004, PMID: 15161102). Although the translation has not been shown in vivo, the protein is conserved in mouse ENST00000396345.1 NMD exception ENST00000520360.1 not organism-supported ENST00000522863.1 not organism-supported ENST00000521028.2 Wang et al. Nature 2011 [PMID:21423168] ENST00000418691.1 alternative 5' UTR ENST00000422800.1 alternative 5' UTR ENST00000409980.1 not organism-supported ENST00000457186.2 not organism-supported ENST00000396299.2 alternative 5' UTR ENST00000469531.1 not organism-supported ENST00000424599.1 alternative 5' UTR ENST00000322982.3 suspected genomic sequencing error affecting CDS in exon1 ENST00000396276.3 alternative 5' UTR ENST00000409850.1 alternative 5' UTR ENST00000447426.1 alternative 5' UTR ENST00000488891.2 alternative 5' UTR ENST00000449801.1 alternative 5' UTR ENST00000455544.1 alternative 5' UTR ENST00000437527.1 alternative 5' UTR ENST00000409350.1 alternative 5' UTR ENST00000450427.1 alternative 5' UTR ENST00000409497.1 alternative 5' UTR ENST00000421434.1 alternative 5' UTR ENST00000438497.1 alternative 5' UTR ENST00000411552.1 alternative 5' UTR ENST00000419799.1 alternative 5' UTR ENST00000413433.1 alternative 5' UTR ENST00000419601.1 alternative 5' UTR ENST00000458257.1 subject to nonsense-mediated decay ENST00000451002.1 subject to nonsense-mediated decay ENST00000431811.1 alternative 5' UTR ENST00000409717.1 alternative 5' UTR ENST00000456011.1 alternative 5' UTR ENST00000407970.3 NP_919276.2 ENST00000454513.1 alternative 5' UTR ENST00000396191.1 alternative 5' UTR ENST00000396182.2 alternative 5' UTR ENST00000396189.2 alternative 5' UTR ENST00000409909.3 alternative 5' UTR ENST00000409292.1 alternative 5' UTR ENST00000410044.1 alternative 5' UTR ENST00000409987.1 not organism-supported ENST00000409782.1 alternative 5' UTR ENST00000409782.1 not organism-supported ENST00000409952.3 alternative 5' UTR ENST00000452926.1 alternative 5' UTR ENST00000453627.1 alternative 5' UTR ENST00000423022.1 alternative 5' UTR ENST00000424468.1 alternative 5' UTR ENST00000449201.1 alternative 5' UTR ENST00000432983.1 alternative 5' UTR ENST00000242067.6 NP_940820.1 ENST00000350941.3 NP_055266.2 ENST00000396127.2 NP_001028776.1 ENST00000355070.2 NP_001028777.1 ENST00000428054.1 non-organism_supported ENST00000408931.3 NP_001071121 ENST00000311350.3 alternative 5' UTR ENST00000426180.1 non-organism_supported ENST00000438224.1 alternative 5' UTR ENST00000431396.1 alternative 5' UTR ENST00000418118.1 alternative 5' UTR ENST00000396045.3 alternative 5' UTR ENST00000396040.2 alternative 5' UTR ENST00000442504.1 alternative 5' UTR ENST00000448602.1 alternative 5' UTR ENST00000455879.1 alternative 5' UTR ENST00000453399.1 alternative 5' UTR ENST00000445322.1 alternative 5' UTR ENST00000450180.1 alternative 5' UTR ENST00000199448.4 upstream uORF ENST00000444718.1 alternative 5' UTR ENST00000440017.1 alternative 5' UTR ENST00000396013.1 alternative 5' UTR ENST00000440144.1 alternative 5' UTR ENST00000453225.1 alternative 5' UTR ENST00000429075.1 alternative 5' UTR ENST00000436911.2 F ENST00000436911.2 TRGC2*08 ENST00000390333.1 F ENST00000390333.1 TRGJ2*01 ENST00000390334.1 F ENST00000390334.1 TRGJP2*01 ENST00000443402.2 F ENST00000443402.2 TRGC1*01 ENST00000390337.1 F ENST00000390337.1 TRGJ1*02 ENST00000390338.2 F ENST00000390338.2 TRGJP*01 ENST00000390339.1 F ENST00000390339.1 TRGJP1*01 ENST00000390340.2 TRGV11*02 ENST00000390340.2 ORF ENST00000453257.1 TRGVB*01 ENST00000453257.1 P ENST00000390341.2 TRGV10*01 ENST00000390341.2 ORF ENST00000444775.2 TRGV9*01 ENST00000444775.2 F ENST00000413819.1 TRGVA is a very degenerated pseudogene and have been unable to add evidence ENST00000413819.1 TRGVA*01 ENST00000413819.1 P ENST00000390343.2 F ENST00000390343.2 TRGV8*01 ENST00000427089.1 TRGV7*01 ENST00000427089.1 P ENST00000417928.1 P ENST00000417928.1 TRGV6*01 ENST00000419915.1 P ENST00000419915.1 TRGV5P*02 ENST00000390344.2 F ENST00000390344.2 TRGV5*01 ENST00000390345.2 F ENST00000390345.2 TRGV4*02 ENST00000390346.2 F ENST00000390346.2 TRGV3*02 ENST00000426402.2 TRGV2*01 ENST00000426402.2 F ENST00000390348.2 TRGV1*01 ENST00000390348.2 ORF ENST00000418457.2 alternative 5' UTR ENST00000457055.1 cross species TrEMBL (CHICK) ENST00000524147.1 not organism-supported ENST00000520104.1 not organism-supported ENST00000559001.1 not organism-supported ENST00000436179.1 alternative 5' UTR ENST00000428627.1 Sw:Q96CS7.1 ENST00000444074.1 non-organism_supported ENST00000442711.1 alternative 5' UTR ENST00000448703.1 alternative 5' UTR ENST00000442788.1 subject to nonsense-mediated decay ENST00000433579.1 subject to nonsense-mediated decay ENST00000438029.1 alternative 5' UTR ENST00000425683.1 alternative 5' UTR ENST00000432637.1 alternative 5' UTR ENST00000481031.1 non-organism_supported ENST00000462448.1 non-organism_supported ENST00000490251.1 FLJ42014 ENST00000488813.1 FLJ26179 ENST00000395879.1 FLJ39884 ENST00000395879.1 alternative 5' UTR ENST00000310564.6 FLJ11843 ENST00000415798.1 alternative 5' UTR ENST00000402924.1 alternative 5' UTR ENST00000424330.1 alternative 5' UTR ENST00000336086.6 alternative 5' UTR ENST00000426198.1 alternative 5' UTR ENST00000455877.1 alternative 5' UTR ENST00000473007.2 non-organism_supported ENST00000258704.3 NP_778234 ENST00000492971.1 non-organism_supported ENST00000452185.1 alternative 5' UTR ENST00000433715.1 alternative 5' UTR ENST00000456038.1 alternative 5' UTR ENST00000418438.1 alternative 5' UTR ENST00000437084.1 non-organism_supported ENST00000476008.1 non-organism_supported ENST00000350811.3 alternative 3' UTR ENST00000395749.2 NP_001211 ENST00000497584.1 non-organism_supported ENST00000427209.1 non-organism_supported ENST00000419661.1 alternative 5' UTR ENST00000457123.1 alternative 5' UTR ENST00000395655.4 alternative 5' UTR ENST00000494076.1 alternative 5' UTR ENST00000475893.1 alternative 5' UTR ENST00000482285.1 alternative 5' UTR ENST00000495078.1 alternative 5' UTR ENST00000481345.1 alternative 3' UTR ENST00000381083.4 NP_001013416 ENST00000428530.1 alternative 3' UTR ENST00000417621.1 alternative 3' UTR ENST00000415929.1 alternative 5' UTR ENST00000413551.1 alternative 5' UTR ENST00000432325.1 alternative 5' UTR ENST00000432627.1 alternative 5' UTR ENST00000395572.2 alternative 5' UTR ENST00000416681.1 alternative 5' UTR ENST00000432131.1 alternative 5' UTR ENST00000395564.4 alternative 5' UTR ENST00000436673.1 alternative 5' UTR ENST00000331340.3 NP_006051.1 ENST00000439701.1 alternative 5' UTR ENST00000356889.4 alternative 5' UTR ENST00000433017.1 alternative 5' UTR ENST00000419119.1 alternative 5' UTR ENST00000436590.1 alternative 5' UTR ENST00000422854.1 alternative 5' UTR ENST00000440350.1 alternative 5' UTR ENST00000420829.1 alternative 5' UTR ENST00000448788.1 alternative 5' UTR ENST00000444124.2 alternative 5' UTR ENST00000420203.1 alternative 5' UTR ENST00000432526.2 alternative 5' UTR ENST00000402578.1 alternative 5' UTR ENST00000406641.1 alternative 5' UTR ENST00000407526.1 alternative 5' UTR ENST00000439044.1 alternative 5' UTR ENST00000407838.3 NP_872352 ENST00000395535.3 alternative 5' UTR ENST00000450622.1 alternative 5' UTR ENST00000342916.3 NP_958439.1 ENST00000344576.2 NP_958441.1 ENST00000420316.2 NP_958440.1 ENST00000452107.2 not organism-supported ENST00000428648.1 alternative 5' UTR ENST00000428097.1 alternative 5' UTR ENST00000453256.1 alternative 5' UTR ENST00000455023.1 alternative 5' UTR ENST00000414113.1 alternative 5' UTR ENST00000417399.1 alternative 5' UTR ENST00000452832.1 alternative 5' UTR ENST00000455909.1 novel transcript ENST00000388975.3 FLJ44060 ENST00000446692.1 alternative 5' UTR ENST00000443449.1 alternative 5' UTR ENST00000437355.2 not organism-supported ENST00000395471.3 alternative 5' UTR ENST00000421626.1 alternative 5' UTR ENST00000419984.2 alternative 5' UTR ENST00000421312.1 alternative 5' UTR ENST00000424596.1 alternative 5' UTR ENST00000413218.1 alternative 5' UTR ENST00000416592.1 alternative 5' UTR ENST00000335503.3 NP_001009186.1 ENST00000395436.2 NP_001035934.1 ENST00000395435.2 NP_001035935.1 ENST00000413952.2 NP_001035933.1 ENST00000424595.1 non-organism_supported ENST00000438373.1 alternative 5' UTR ENST00000360117.3 alternative 5' UTR ENST00000344930.3 alternative 5' UTR ENST00000282869.5 NP_056936.2 ENST00000438455.1 suspected genomic sequence error affecting CDS in exon 8 ENST00000380839.4 NP_001020117.1 ENST00000395332.3 alternative 5' UTR ENST00000395331.3 NP_001020115.1 ENST00000398684.2 NP_001035738.1 ENST00000338592.5 NP_001035737.1 ENST00000442120.1 alternative 5' UTR ENST00000451388.1 alternative 5' UTR ENST00000450873.1 alternative 5' UTR ENST00000442563.1 alternative 5' UTR ENST00000341567.4 FLJ10099 ENST00000413593.1 alternative 5' UTR ENST00000424964.2 alternative 5' UTR ENST00000418375.1 alternative 5' UTR ENST00000437742.1 alternative 5' UTR ENST00000432182.1 also supported by human protein P00395 ENST00000395275.2 NP_113656 ENST00000395276.2 alternative 5' UTR ENST00000431984.1 alternative 5' UTR ENST00000446128.1 alternative 5' UTR ENST00000355920.3 novel transcript ENST00000411562.1 novel transcript ENST00000359797.4 novel transcript ENST00000426970.1 novel transcript ENST00000453152.1 alternative 5' UTR ENST00000404251.1 alternative 3' UTR ENST00000354613.1 This variant represents swissprot isoform Q9NP71-4 ENST00000435050.1 alternative 5' UTR ENST00000465116.1 alternative 5' UTR ENST00000460943.1 alternative 5' UTR ENST00000475494.1 alternative 5' UTR ENST00000361082.3 alternative 5' UTR ENST00000275635.7 alternative 5' UTR ENST00000055077.3 CCDS5568.1 ENST00000432143.1 alternative 5' UTR ENST00000448772.1 alternative 5' UTR ENST00000429726.1 alternative 5' UTR ENST00000428817.1 non-organism_supported ENST00000424623.1 NP_002625 ENST00000339898.4 NP_061864 ENST00000394930.2 NP_001002840 ENST00000439813.1 Probable_NMD_if_extended ENST00000398379.2 alternative 5' UTR ENST00000336926.6 non-canonical splice sites between exons 2 and 3. (AT/AC) ENST00000434438.2 non-canonical splice sites between exons 2 and 3. (AT/AC) ENST00000420909.1 non-canonical splice sites between exons 2 and 3. (AT/AC) ENST00000394905.2 alternative 5' UTR ENST00000416943.1 alternative 5' UTR ENST00000006777.6 NP_001035546 ENST00000428119.1 NP_001035547 ENST00000453773.1 alternative 5' UTR ENST00000439963.1 alternative 5' UTR ENST00000421059.1 alternative 5' UTR ENST00000412521.1 alternative 5' UTR ENST00000414186.1 alternative 5' UTR ENST00000432753.1 alternative 5' UTR ENST00000449920.1 alternative 5' UTR ENST00000418341.1 alternative 5' UTR ENST00000431581.1 alternative 5' UTR ENST00000336517.4 NP_009086 ENST00000425780.1 alternative 5' UTR ENST00000456590.1 alternative 5' UTR ENST00000451769.1 alternative 5' UTR ENST00000457529.1 alternative 5' UTR ENST00000413936.2 NP_001096065 ENST00000423646.1 alternative 5' UTR ENST00000438930.1 alternative 5' UTR ENST00000430490.2 NP_001096064 ENST00000442516.1 alternative 5' UTR ENST00000423250.1 alternative 5' UTR ENST00000429179.1 alternative 5' UTR ENST00000435861.1 alternative 5' UTR ENST00000446820.2 NP_001096066 ENST00000434948.1 subject to nonsense-mediated decay ENST00000334348.3 NP_872625 ENST00000275569.4 isoform 2 ENST00000275569.4 NP_694537 ENST00000310842.4 isoform 1 ENST00000310842.4 NP_036362 ENST00000415750.1 alternative 5' UTR ENST00000257626.7 NP_059135 ENST00000334955.7 NP_940869 ENST00000442586.1 alternative 5' UTR ENST00000309881.7 NP_000063 ENST00000309881.7 alternative 5' UTR ENST00000438020.1 alternative 5' UTR ENST00000436384.1 alternative 5' UTR ENST00000428497.1 alternative 5' UTR ENST00000482059.2 alternative 5' UTR ENST00000394788.3 NP_000063 ENST00000394788.3 alternative 5' UTR ENST00000447544.2 NP_001001548 ENST00000447544.2 alternative 5' UTR ENST00000426978.1 alternative 5' UTR ENST00000413265.1 alternative 5' UTR ENST00000419819.2 alternative 5' UTR ENST00000419255.2 alternative 5' UTR ENST00000457544.2 NP_001010932 ENST00000444829.2 NP_001010931 ENST00000453411.1 NP_001010933 ENST00000423064.2 NP_001010934 ENST00000412881.1 alternative 5' UTR ENST00000421558.1 alternative 5' UTR ENST00000333891.8 NP_055325.2 ENST00000333891.8 not organism-supported ENST00000423517.2 not organism-supported ENST00000436949.1 alternative 5' UTR ENST00000420047.1 alternative 5' UTR ENST00000448879.1 alternative 5' UTR ENST00000424555.1 alternative 5' UTR ENST00000439105.1 not best-in-genome evidence ENST00000421579.1 alternative 5' UTR ENST00000441140.1 alternative 5' UTR ENST00000444627.1 non-organism_supported ENST00000480216.1 First exon found by using Dotter ENST00000423294.1 non-organism_supported ENST00000474609.1 First exon found using Dotter ENST00000398276.2 alternative 5' UTR ENST00000425689.1 alternative 5' UTR ENST00000413276.1 non-organism_supported ENST00000447863.1 [PMID 12917399, Tschan et al. (2003) J. Biol. Chem. 278 ENST00000447863.1 NMD exception ENST00000446796.1 alternative 5' UTR ENST00000425406.1 [PMID 12917399, Tschan et al. (2003) J. Biol. Chem. 278 ENST00000425406.1 NMD exception ENST00000420131.1 alternative 5' UTR ENST00000414630.1 alternative 5' UTR ENST00000453049.1 alternative 5' UTR ENST00000428819.1 alternative 5' UTR ENST00000448598.1 alternative 5' UTR ENST00000449088.2 alternative 5' UTR ENST00000430405.2 alternative 5' UTR ENST00000432937.2 NP_001135798 ENST00000547146.1 not organism-supported ENST00000434534.1 alternative 5' UTR ENST00000423590.1 alternative 5' UTR ENST00000432366.1 alternative 5' UTR ENST00000412139.1 [PMID 12917399, Tschan et al. (2003) J. Biol. Chem. 278 ENST00000412139.1 NMD exception ENST00000425705.1 alternative 5' UTR ENST00000433078.1 alternative 5' UTR ENST00000455575.1 alternative 5' UTR ENST00000359206.3 NP_000434.1 ENST00000265723.4 NP_061337.1 ENST00000453593.1 non-submitted evidence ENST00000417608.1 alternative 5' UTR ENST00000265724.3 NP_000918 ENST00000416177.1 alternative 5' UTR ENST00000341119.5 NP_061331 ENST00000398204.4 NP_057435 ENST00000265727.7 NP_068369 ENST00000429649.1 5' end found by Dotter ENST00000444032.1 We found the first 3 exons using BLAT and Dotter ENST00000448260.1 We found three exons using BLAT and Dotter; Base calling poor at the last exon ENST00000471553.1 non canonical TEC ENST00000428074.1 alternative 5' UTR ENST00000394626.1 alternative 5' UTR ENST00000394622.2 alternative 5' UTR ENST00000394624.1 alternative 5' UTR ENST00000451029.1 FLJ21062 ENST00000457170.2 GENCODE experimental pipeline ENST00000420245.1 SK name: TCAG_1959470 ENST00000445784.1 SK name: DKFZp434N065 ENST00000469675.1 SK name: DKFZp434N144 ENST00000496677.1 alternative 5' UTR ENST00000441971.1 SK name: THC1219317 ENST00000406735.2 alternative 5' UTR ENST00000456229.1 alternative 5' UTR ENST00000442961.1 alternative 5' UTR ENST00000425936.1 alternative 5' UTR ENST00000003100.8 NP_000777 ENST00000422722.1 probably NMD of this locus but does not contain start codon of main variant ENST00000458448.1 not organism-supported ENST00000437357.1 alternative 5' UTR ENST00000412043.2 alternative 5' UTR ENST00000394505.2 alternative 5' UTR ENST00000394503.2 NP_001013424 ENST00000458177.1 alternative 5' UTR ENST00000433016.1 alternative 5' UTR ENST00000454017.1 alternative 5' UTR ENST00000440209.1 alternative 5' UTR ENST00000430102.1 alternative 5' UTR ENST00000413688.1 alternative 5' UTR ENST00000458493.1 alternative 5' UTR ENST00000452773.1 alternative 5' UTR ENST00000444960.1 alternative 5' UTR ENST00000425073.1 alternative 5' UTR ENST00000442183.1 alternative 5' UTR ENST00000493463.1 supporting evidence has been masked out ENST00000438306.1 alternative 5' UTR ENST00000456502.1 alternative 5' UTR ENST00000424848.2 alternative 5' UTR ENST00000446617.1 alternative 5' UTR ENST00000411955.1 alternative 5' UTR ENST00000437805.1 alternative 5' UTR ENST00000446959.1 alternative 5' UTR ENST00000439952.1 alternative 5' UTR ENST00000414791.1 alternative 5' UTR ENST00000446033.1 alternative 5' UTR ENST00000426151.1 alternative 5' UTR ENST00000429473.1 alternative 5' UTR ENST00000428834.1 alternative 5' UTR ENST00000265735.7 NP_003910 ENST00000445866.2 NP_001092871 ENST00000488574.1 alternative 5' UTR ENST00000413325.1 alternative 5' UTR ENST00000422324.1 alternative 5' UTR ENST00000428113.1 NP_665879 ENST00000524053.1 alternative 5' UTR ENST00000518089.1 alternative 5' UTR ENST00000457059.1 alternative 5' UTR ENST00000493858.1 FLJ42280 ENST00000488005.1 Uporf ENST00000394309.3 alternative 5' UTR ENST00000444334.1 alternative 5' UTR ENST00000442734.1 alternative 5' UTR ENST00000437657.1 alternative 5' UTR ENST00000437657.1 not organism-supported ENST00000453600.1 alternative 5' UTR ENST00000451771.1 alternative 5' UTR ENST00000414884.1 alternative 5' UTR ENST00000257627.4 This is a duplication of oncemodulin , another copy is on the same chromosome different arm ENST00000473987.2 This is a duplication of oncemodulin , another copy is on the same chromosome different arm ENST00000473987.2 not organism-supported ENST00000297293.5 in Em:BC146773.& Em:AB029002.1, there is a gap in exon 13 ENST00000447648.2 KIAA1358 ENST00000479975.1 KIAA1358 ENST00000423128.1 alternative 5' UTR ENST00000415086.1 alternative 5' UTR ENST00000420697.1 alternative 5' UTR ENST00000474857.1 not organism-supported ENST00000445790.1 alternative 5' UTR ENST00000417523.1 alternative 5' UTR ENST00000446306.2 not organism-supported ENST00000443222.1 alternative 5' UTR ENST00000414376.1 alternative 5' UTR ENST00000484600.1 alternative 5' UTR ENST00000455009.1 alternative_5'_URTR ENST00000418347.1 alternative 5' UTR ENST00000429246.1 alternative 5' UTR ENST00000417330.1 alternative 5' UTR ENST00000431816.1 alternative 5' UTR ENST00000427217.1 alternative 5' UTR ENST00000458033.1 alternative 5' UTR ENST00000451682.1 alternative 5' UTR ENST00000445924.1 extra A @611 in EST sequence ENST00000403633.2 alternative 5' UTR ENST00000496696.1 alternative 5' UTR ENST00000430982.1 alternative 5' UTR ENST00000430029.1 alternative 5' UTR ENST00000419981.1 alternative 5' UTR ENST00000437572.1 alternative 5' UTR ENST00000451138.1 alternative 5' UTR ENST00000412686.1 poor sequence at 3' end ENST00000359832.4 NP_001003714 ENST00000488775.1 NP_001034267 ENST00000379724.3 NP001013276 ENST00000326775.5 alternative 5' UTR ENST00000451158.1 alternative 5' UTR ENST00000408938.2 alternative 5' UTR ENST00000320583.5 NP_001078836 ENST00000452314.1 alternative 5' UTR ENST00000454654.1 alternative 5' UTR ENST00000493277.1 NP_001077425 ENST00000422164.1 alternative 5' UTR ENST00000422647.1 alternative 5' UTR ENST00000427931.1 alternative 5' UTR ENST00000440391.1 NP_001009958 ENST00000394163.2 alternative 5' UTR ENST00000431485.2 alternative 5' UTR ENST00000463915.1 not organism-supported ENST00000444905.1 not organism-supported ENST00000415413.1 not organism-supported ENST00000477658.1 not organism-supported ENST00000495115.1 not organism-supported ENST00000433277.1 not organism-supported ENST00000491648.1 not organism-supported ENST00000292401.4 NP_001176 ENST00000432317.1 alternative 5' UTR ENST00000438937.1 alternative 5' UTR ENST00000413658.2 NP_060185 ENST00000449785.1 alternative 5' UTR ENST00000428683.1 alternative 5' UTR ENST00000441298.1 alternative 5' UTR ENST00000415068.1 alternative 5' UTR ENST00000292393.5 alternative 5' UTR ENST00000421755.1 alternative 3' UTR ENST00000453269.2 alternative 5' UTR ENST00000452041.1 alternative 5' UTR ENST00000493322.1 alternative 5' UTR ENST00000449571.1 alternative 5' UTR ENST00000520135.1 alternative 5' UTR ENST00000451699.1 alternative 5' UTR ENST00000417349.1 alternative 5' UTR ENST00000431404.2 alternative 5' UTR ENST00000460673.2 alternative 5' UTR ENST00000421390.1 alternative 5' UTR ENST00000419037.1 non-organism_supported ENST00000419037.1 not organism-supported ENST00000426455.1 alternative 5' UTR ENST00000416412.1 alternative 5' UTR ENST00000422690.1 alternative 5' UTR ENST00000439782.1 alternative 5' UTR ENST00000491498.1 not organism-supported ENST00000440830.1 not organism-supported ENST00000420688.1 alternative 5' UTR ENST00000457519.1 alternative 5' UTR ENST00000443526.1 alternative 5' UTR ENST00000419749.1 alternative 5' UTR ENST00000422808.1 alternative 5' UTR ENST00000455145.1 alternative 5' UTR ENST00000431140.1 alternative 5' UTR ENST00000438231.1 alternative 5' UTR ENST00000432297.1 alternative 5' UTR ENST00000350573.2 NP_840056.1 ENST00000465843.1 NP_036304.1 ENST00000427939.2 NP_036304.2 ENST00000393950.2 alternative 5' UTR ENST00000451587.1 alternative 5' UTR ENST00000436220.1 alternative 5' UTR ENST00000427895.1 alternative 5' UTR ENST00000393926.1 alternative 5' UTR ENST00000431068.1 alternative 5' UTR ENST00000412215.1 alternative 5' UTR ENST00000393924.1 alternative 5' UTR ENST00000471340.2 not organism-supported ENST00000457480.1 alternative 5' UTR ENST00000434158.1 alternative 5' UTR ENST00000423692.1 not organism-supported ENST00000448764.1 not organism-supported ENST00000445337.1 non canonical TEC ENST00000428317.1 alternative 5' UTR ENST00000412389.1 alternative 5' UTR ENST00000441605.1 alternative 5' UTR ENST00000445236.1 alternative 5' UTR ENST00000483366.1 am confident this is real, its the start of the gene, however the assembly is a little odd around here so cant join ENST00000445482.2 alternative 5' UTR ENST00000445482.2 not organism-supported ENST00000455377.1 alternative 5' UTR ENST00000444446.1 alternative 5' UTR ENST00000456079.1 alternative 5' UTR ENST00000308344.5 alternative 5' UTR ENST00000401528.1 FLJ31541 ENST00000414035.1 not organism-supported ENST00000412417.1 not organism-supported ENST00000435848.1 not organism-supported ENST00000422177.1 not organism-supported ENST00000498704.2 NP_001124294.1 ENST00000528707.1 NP_597714 ENST00000546411.2 not organism-supported ENST00000444095.1 gene fragments AC005088.8-001 and AC005088.9-001 are part of the same gene; the exact exon structure ENST00000444095.1 linking the fragments is yet to be determined ENST00000432527.1 linking the fragments is yet to be determined ENST00000432527.1 gene fragments AC005088.9-001 and AC005088.8-001 are part of the same gene; the exact exon structure ENST00000496391.1 alternative 5' UTR ENST00000482237.1 alternative 5' UTR ENST00000495936.1 alternative 5' UTR ENST00000468241.1 alternative 5' UTR ENST00000403646.3 alternative 5' UTR ENST00000498661.1 alternative 5' UTR ENST00000473939.1 alternative 5' UTR ENST00000507918.1 non-canonical splice donor site at exon 1 ENST00000507918.1 NP_001026789.2 ENST00000461209.1 alternative 5' UTR ENST00000520042.1 alternative 5' UTR ENST00000507450.1 non-canonical splice donor site at exon 1 ENST00000436908.1 alternative 5' UTR ENST00000436908.1 not organism-supported ENST00000455453.1 alternative 5' UTR ENST00000417955.1 alternative 5' UTR ENST00000417955.1 not organism-supported ENST00000465647.1 alternative 3' UTR ENST00000427257.1 alternative 5' UTR ENST00000418294.1 alternative 5' UTR ENST00000425379.1 alternative 5' UTR ENST00000426036.2 not organism-supported ENST00000457587.1 alternative 5' UTR ENST00000425206.1 alternative 5' UTR ENST00000393727.1 non-canonical (a/gt ttg\) splicing between exons 15 and 16 ENST00000393723.1 non-canonical (a/gt ttg\) splicing between exons 14 and 15 ENST00000343529.5 NP_774959.1 ENST00000429186.1 not organism-supported ENST00000478990.1 not organism-supported ENST00000495267.1 alternative 5' UTR ENST00000474203.1 alternative 5' UTR ENST00000393651.3 NP_872634.1 ENST00000489828.1 alternative 5' UTR ENST00000482897.1 not organism-supported ENST00000460391.1 alternative 5' UTR ENST00000482862.1 not organism-supported ENST00000481939.1 not organism-supported ENST00000356362.2 alternative 5' UTR ENST00000482157.1 not organism-supported ENST00000497979.1 not organism-supported ENST00000472195.1 alternative 5' UTR ENST00000472195.1 not organism-supported ENST00000464029.1 alternative 3' UTR ENST00000424768.1 alternative 5' UTR ENST00000417537.1 alternative 5' UTR ENST00000523505.1 FLJ36031 ENST00000496166.1 alternative 5' UTR ENST00000359195.3 alternative 5' UTR ENST00000468410.1 alternative 5' UTR ENST00000478930.1 alternative 5' UTR ENST00000464009.1 alternative 5' UTR ENST00000468401.1 alternative 5' UTR ENST00000497535.1 alternative 5' UTR ENST00000485846.1 alternative 5' UTR ENST00000479011.1 alternative 5' UTR ENST00000468056.2 not organism-supported ENST00000445771.2 NP_001008405.1 ENST00000479917.1 alternative 5' UTR ENST00000421217.1 alternative 5' UTR ENST00000457837.1 alternative 5' UTR ENST00000379117.2 not organism-supported ENST00000379117.2 alternative 5' UTR ENST00000473124.1 alternative 5' UTR ENST00000491150.1 NP_001008406.1 ENST00000440056.1 alternative 5' UTR ENST00000453332.1 alternative 5' UTR ENST00000393559.1 alternative 5' UTR ENST00000522550.1 Isoform C ENST00000351718.4 Isoform B ENST00000417701.1 alternative 5' UTR ENST00000419936.1 alternative 5' UTR ENST00000456431.1 alternative 5' UTR ENST00000418239.1 alternative 5' UTR ENST00000426128.1 alternative 5' UTR ENST00000422087.1 alternative 5' UTR ENST00000436062.1 alternative 5' UTR ENST00000427008.1 alternative 5' UTR ENST00000415498.2 alternative 5' UTR ENST00000415914.2 Isoform 1 ENST00000313516.5 NP_872335.2 ENST00000313516.5 Isoform 2 ENST00000331762.3 alternative 5' UTR ENST00000452895.1 not organism-supported ENST00000452895.1 alternative 5' UTR ENST00000452753.1 alternative 5' UTR ENST00000308478.5 alternative 5' UTR ENST00000422987.2 alternative 5' UTR ENST00000421101.1 alternative 5' UTR ENST00000464835.1 alternative 5' UTR ENST00000469898.1 non-organism_supported ENST00000432734.1 alternative 5' UTR ENST00000005558.4 alternative 5' UTR ENST00000445335.1 alternative 5' UTR ENST00000417662.1 alternative 5' UTR ENST00000403825.3 alternative 5' UTR ENST00000440625.1 alternative 5' UTR ENST00000466459.1 not organism-supported ENST00000439068.2 alternative 5' UTR ENST00000455302.1 Isoform 2 ENST00000455302.1 alternative 5' UTR ENST00000312849.3 alternative 5' UTR ENST00000312849.3 Isoform 1 ENST00000454074.1 alternative 5' UTR ENST00000418785.1 (Bos taurus) ENST00000418785.1 not organism-supported ENST00000424100.1 alternative 5' UTR ENST00000449591.1 alternative 5' UTR ENST00000449735.1 alternative 5' UTR ENST00000438062.1 alternative 5' UTR ENST00000487573.1 alternative 5' UTR ENST00000397764.3 Mouse protein OTTMUSP00000045705 ENST00000397764.3 LOC401397 ENST00000441359.1 alternative 5' UTR ENST00000413744.1 alternative 5' UTR ENST00000439551.1 alternative 5' UTR ENST00000324462.6 alternative 5' UTR ENST00000393494.2 alternative 5' UTR ENST00000393498.1 GENCODE experimental pipeline ENST00000360232.4 NP_683697.2 ENST00000393495.2 GENCODE experimental pipeline ENST00000423503.1 alternative 5' UTR ENST00000393485.1 SK name: TFEC_transcript_variant_1 ENST00000393481.2 SK name: TES_transcript_variant_1 ENST00000413968.1 contains a non-canonical splice site ENST00000484156.1 non-canonial splicing between exons 6 and 7 ENST00000489776.1 non-canonial splicing between exons 7 and 8 ENST00000495046.1 non-canonial splicing between exons 5 and 6 ENST00000497046.1 non-canonial splicing between exons 8 and 9 ENST00000491643.1 non-canonical splicing between exons 6 and 7 ENST00000476156.1 non-canonical splicing between exons 3 and 4 ENST00000454623.1 GENCODE experimental pipeline ENST00000484325.1 alternative 5' UTR ENST00000393451.3 NP_060882 ENST00000417919.1 alternative 5' UTR ENST00000449366.1 alternative 5' UTR ENST00000434836.1 alternative 5' UTR ENST00000477742.1 alternative 5' UTR ENST00000420755.1 alternative 5' UTR ENST00000543837.1 This variant corresponds to the official locus ST7OT3, i.e. ST7 overlapping transcript 3 (non-coding RNA) ENST00000466018.1 novel transcript ENST00000470996.1 novel transcript ENST00000491214.1 not organism-supported ENST00000454375.1 alternative 5' UTR ENST00000412853.1 alternative 5' UTR ENST00000265224.4 NP_062618 ENST00000417525.1 upstream_ATG-53 ENST00000415871.1 alternative 5' UTR ENST00000441017.1 alternative 5' UTR ENST00000433758.1 alternative 5' UTR ENST00000424710.1 alternative 5' UTR ENST00000430985.1 alternative 5' UTR ENST00000339121.5 NP_938008 ENST00000428526.1 alternative 5' UTR ENST00000361301.2 NP_057171 ENST00000412653.1 alternative 5' UTR ENST00000455828.1 alternative 5' UTR ENST00000393376.1 alternative 5' UTR ENST00000418046.1 alternative 5' UTR ENST00000420146.2 not organism-supported ENST00000427975.1 not organism-supported ENST00000466202.1 alternative 5' UTR ENST00000434204.1 alternative 5' UTR ENST00000434204.1 not organism-supported ENST00000437535.1 alternative 5' UTR ENST00000451215.1 alternative 5' UTR ENST00000447789.1 alternative 5' UTR ENST00000489978.1 alternative 5' UTR ENST00000488323.1 alternative 5' UTR ENST00000223026.4 alternative 5' UTR ENST00000413927.1 alternative 5' UTR ENST00000460182.1 alternative 5' UTR ENST00000340011.5 NP_003108 ENST00000446993.1 alternative 5' UTR ENST00000480995.1 non canonical TEC ENST00000457830.1 alternative 5' UTR ENST00000465800.1 non canonical TEC ENST00000412160.1 alternative 5' UTR ENST00000393313.1 alternative 5' UTR ENST00000393312.1 alternative 5' UTR ENST00000434602.1 alternative 5' UTR ENST00000436992.1 alternative 5' UTR ENST00000439506.1 Em:DQ655936.2 ENST00000439506.1 alternative 5' UTR ENST00000341640.2 NP_006184.1 ENST00000378740.2 This protein is truncated by 2 amino acids relative to the SwissProt entry due to a SNP rs2233584 in the reference genome that introduces a stop codon in the last exon ENST00000476782.1 alternative 5' UTR ENST00000478726.1 alternative 5' UTR ENST00000464607.1 alternative 5' UTR ENST00000495931.1 alternative 5' UTR ENST00000338791.6 NP_000874.2 ENST00000338791.6 1bp mismatch at donor splice site of exon 3 in cDNA Em:J05272.1 ENST00000354269.5 NP_001096075.1 ENST00000348127.6 NP_899066.1 ENST00000497665.1 not organism-supported ENST00000435296.2 alternative 5' UTR ENST00000480462.1 non canonical conserved ENST00000434001.2 alternative 3' UTR ENST00000477515.1 non canonical conserved ENST00000493278.1 alternative 3' UTR ENST00000485998.2 alternative 5' UTR ENST00000459946.1 alternative 5' UTR ENST00000472049.1 alternative 5' UTR ENST00000488925.1 alternative 5' UTR ENST00000476647.2 suspected genomic sequence error affecting CDS in exon 12 ENST00000487494.1 There is an insertion of 1bp (g) (rs11335250) in exon one in the genome reference sequence that causes a frame shift. There is also a potential SNP (rs34061445) in exon 16 ENST00000489702.1 alternative 5' UTR ENST00000357234.5 NP_001092099.1 ENST00000479582.1 alternative 5' UTR ENST00000464557.1 alternative 5' UTR ENST00000467002.1 alternative 5' UTR ENST00000473745.1 alternative 5' UTR ENST00000460109.1 NP_001124194 ENST00000474594.1 NP_001124195 ENST00000468226.1 alternative 5' UTR ENST00000471077.1 alternative 5' UTR ENST00000486598.1 alternative 5' UTR ENST00000497503.1 alternative 5' UTR ENST00000463587.1 alternative 5' UTR ENST00000461828.1 alternative 5' UTR ENST00000494311.1 alternative 5' UTR ENST00000466363.2 alternative 5' UTR ENST00000466363.2 not organism-supported ENST00000431780.2 NP_001120914 ENST00000474905.1 alternative 5' UTR ENST00000393213.3 alternative 5' UTR ENST00000481342.1 alternative 5' UTR ENST00000476062.1 alternative 5' UTR ENST00000492389.1 alternative 5' UTR ENST00000475282.1 alternative 5' UTR ENST00000341441.4 CCDS5823.1 ENST00000427521.1 alternative 5' UTR ENST00000399874.2 alternative 5' UTR ENST00000433159.1 alternative 5' UTR ENST00000421001.1 alternative 5' UTR ENST00000437637.1 alternative 5' UTR ENST00000458161.1 alternative 5' UTR ENST00000356588.3 alternative 5' UTR ENST00000443954.1 alternative 5' UTR ENST00000438346.1 alternative 5' UTR ENST00000416992.1 alternative 5' UTR ENST00000378555.3 NP_001018121.1 ENST00000332558.4 FLJ40288 ENST00000418040.1 alternative 5' UTR ENST00000393132.2 alternative 5' UTR ENST00000443095.1 alternative 5' UTR ENST00000417172.1 alternative 5' UTR ENST00000436461.2 alternative 5' UTR ENST00000454108.1 alternative 5' UTR ENST00000435928.1 alternative 5' UTR ENST00000424142.1 alternative 5' UTR ENST00000354475.4 Aa257 different from Sw:A4D1P6.1 Leu to Pro ENST00000453373.1 alternative 5' UTR ENST00000320658.5 alternative 5' UTR ENST00000401861.1 alternative 5' UTR ENST00000310018.2 NP_065683.2 ENST00000353492.4 alternative 5' UTR ENST00000442682.2 NP_001078898.1 ENST00000440172.1 NP_065961.2 ENST00000242351.5 Q7Z2W4-1 ENST00000340940.4 Sw:A4D1S0-1 ENST00000438104.1 alternative 5' UTR ENST00000336425.5 upstream_ATG-1aa ENST00000477571.1 not organism-supported ENST00000491505.1 alternative 5' UTR ENST00000495590.1 alternative 5' UTR ENST00000474576.1 non-organism_supported ENST00000471104.1 alternative 5' UTR ENST00000467513.1 alternative 5' UTR ENST00000494939.1 alternative 5' UTR ENST00000475180.1 alternative 5' UTR ENST00000496613.1 alternative 5' UTR ENST00000491728.1 alternative 5' UTR ENST00000489552.1 alternative 5' UTR ENST00000477488.1 alternative 5' UTR ENST00000483369.1 not organism-supported ENST00000482954.1 alternative 5' UTR ENST00000476279.1 alternative 3' UTR ENST00000465506.1 alternative 3' UTR ENST00000464566.1 alternative 3' UTR ENST00000472695.1 alternative 5' UTR ENST00000476470.1 alternative 5' UTR ENST00000496384.1 non-organism_supported ENST00000497784.1 not organism-supported ENST00000393008.3 alternative 5' UTR ENST00000496958.1 alternative 5' UTR ENST00000469351.1 alternative 5' UTR ENST00000469351.1 not organism-supported ENST00000482493.1 not organism-supported ENST00000498107.1 alternative 5' UTR ENST00000467681.1 alternative 5' UTR ENST00000465582.1 alternative 3' UTR ENST00000484178.1 alternative 5' UTR ENST00000473783.1 alternative 5' UTR ENST00000481508.1 alternative 5' UTR ENST00000438520.1 alternative 5' UTR ENST00000484361.1 unitary_pseudogene ENST00000465654.1 alternative 5' UTR ENST00000552471.1 alternative 5' UTR ENST00000476502.1 P ENST00000476502.1 TRBV1*01 ENST00000455382.2 F ENST00000455382.2 TRBV2*01 ENST00000390387.3 F ENST00000390387.3 TRBV3-1*01 ENST00000390357.3 TRBV4-1*01 ENST00000390357.3 F ENST00000390381.3 F ENST00000390381.3 TRBV5-1*01 ENST00000390353.2 F ENST00000390353.2 TRBV6-1*01 ENST00000547918.2 TRBV7-1*01 ENST00000547918.2 ORF ENST00000390392.3 F ENST00000390392.3 TRBV4-2*01 ENST00000390359.3 F ENST00000390359.3 TRBV7-8*01 ENST00000390379.1 F ENST00000390379.1 TRBV6-9*01 ENST00000390378.1 ORF ENST00000390378.1 TRBV5-7*01 ENST00000390377.1 F ENST00000390377.1 TRBV7-7*01 ENST00000390376.2 F ENST00000390376.2 TRBV6-8*01 ENST00000390375.2 F ENST00000390375.2 TRBV5-6*01 ENST00000390374.3 F ENST00000390374.3 TRBV7-6*01 ENST00000390373.2 TRBV6-7*01 ENST00000390373.2 ORF ENST00000390372.3 F ENST00000390372.3 TRBV5-5*01 ENST00000390382.3 P ENST00000390382.3 TRBV7-5*01 ENST00000390371.3 F ENST00000390371.3 TRBV6-6*01 ENST00000454561.2 F ENST00000454561.2 TRBV5-4*01 ENST00000390369.2 F ENST00000390369.2 TRBV7-4*01 ENST00000390368.2 TRBV6-5*01 ENST00000390368.2 F ENST00000489763.1 TRBV12-2*01 ENST00000489763.1 P ENST00000471935.1 F ENST00000471935.1 suspected genomic sequence error affecting CDS in exon 1 ENST00000471935.1 TRBV11-2*01 ENST00000426318.2 F ENST00000426318.2 TRBV10-2*01 ENST00000479785.1 P ENST00000479785.1 TRBV12-1*01 ENST00000390367.3 F ENST00000390367.3 TRBV11-1*01 ENST00000390364.3 F ENST00000390364.3 TRBV10-1*01 ENST00000390363.2 F ENST00000390363.2 TRBV9*01 ENST00000390362.1 TRBV5-3*01 ENST00000390362.1 ORF ENST00000475637.1 P ENST00000475637.1 TRBV8-2*01 ENST00000390361.3 TRBV7-3*01 ENST00000390361.3 F ENST00000390360.3 TRBV6-4*01 ENST00000390360.3 F ENST00000489095.1 P ENST00000489095.1 TRBV5-2*01 ENST00000481590.1 TRBV8-1*01 ENST00000481590.1 P ENST00000390393.3 F ENST00000390393.3 TRBV19*01 ENST00000390394.3 F ENST00000390394.3 TRBV20-1*01 ENST00000453262.2 P ENST00000453262.2 TRBV21-1*01 ENST00000424543.2 TRBV22-1*01 ENST00000424543.2 P ENST00000390396.1 TRBV23-1*01 ENST00000390396.1 ORF ENST00000390397.2 F ENST00000390397.2 TRBV24-1*01 ENST00000390398.3 F ENST00000390398.3 TRBV25-1*01 ENST00000498804.1 TRBVA*01 ENST00000498804.1 P ENST00000456572.2 TRBV26*01 ENST00000456572.2 P ENST00000506718.1 non canonical conserved ENST00000477100.1 P ENST00000477100.1 TRBVB*01 ENST00000390399.3 TRBV27*01 ENST00000390399.3 P ENST00000390400.2 F ENST00000390400.2 TRBV28*01 ENST00000422143.2 F ENST00000422143.2 TRBV29-1*01 ENST00000390412.1 F ENST00000390412.1 TRBJ2-1*01 ENST00000390413.1 F ENST00000390413.1 TRBJ2-2*01 ENST00000390414.1 TRBJ2-2P*01 ENST00000390414.1 ORF ENST00000390415.1 F ENST00000390415.1 TRBJ2-3*01 ENST00000390416.1 F ENST00000390416.1 TRBJ2-4*01 ENST00000390417.1 F ENST00000390417.1 TRBJ2-5*01 ENST00000390418.1 F ENST00000390418.1 TRBJ2-6*01 ENST00000390419.1 F ENST00000390419.1 TRBJ2-7*01 ENST00000466254.1 F ENST00000466254.1 TRBC2*01 ENST00000417977.2 F ENST00000417977.2 TRBV30*01 ENST00000442129.1 NP_004436.2 ENST00000436401.1 non canonical conserved ENST00000439304.1 not organism-supported ENST00000409500.3 NP_001137152.1 ENST00000443571.2 NP_001137153.1 ENST00000479303.1 NP_001137151.1 ENST00000473649.1 FLJ37944 ENST00000409102.1 alternative 5' UTR ENST00000409244.1 alternative 5' UTR ENST00000409541.1 alternative 5' UTR ENST00000410004.1 alternative 5' UTR ENST00000443739.2 FLJ42566 ENST00000409346.1 alternative 5' UTR ENST00000409408.1 alternative 5' UTR ENST00000457235.1 alternative 5' UTR ENST00000441404.1 unitary_pseudogene ENST00000444908.2 alternative 5' UTR ENST00000460532.1 alternative 5' UTR ENST00000491908.1 alternative 5' UTR ENST00000478172.1 alternative 5' UTR ENST00000485416.1 alternative 5' UTR ENST00000449203.1 unitary_pseudogene ENST00000428688.2 unitary_pseudogene ENST00000483238.1 confirm experimentally ENST00000467773.1 confirm experimentally ENST00000482940.1 alternative 5' UTR ENST00000552881.1 alternative 5' UTR ENST00000489798.1 alternative 5' UTR ENST00000546806.1 alternative 5' UTR ENST00000478654.1 alternative 5' UTR ENST00000320356.2 NP_004447.2 ENST00000350995.2 NP_694543.1 ENST00000426851.2 alternative 5' UTR ENST00000491174.1 alternative 5' UTR ENST00000479560.1 dbSNP build 129 rs33979845 ENST00000497895.1 alternative 5' UTR ENST00000477518.1 gene fragments RP4-751H13.3-012 and RP4-751H13.3-013 and RP4-751H13.3-014 and RP4-751H13.3-015 andRP4-751H13.3-016 and RP4-751H13.3-017 are part of the same gene; the exact exon structure linking the fragments is yet to be determined ENST00000477518.1 not organism-supported ENST00000472797.1 gene fragments RP4-751H13.3-012 and RP4-751H13.3-013 and RP4-751H13.3-014 and RP4-751H13.3-015 andRP4-751H13.3-016 and RP4-751H13.3-017 are part of the same gene; the exact exon structure linking the fragments is yet to be determined ENST00000484709.1 gene fragments RP4-751H13.3-012 and RP4-751H13.3-013 and RP4-751H13.3-014 and RP4-751H13.3-015 andRP4-751H13.3-016 and RP4-751H13.3-017 are part of the same gene; the exact exon structure linking the fragments is yet to be determined ENST00000481772.1 gene fragments RP4-751H13.3-012 and RP4-751H13.3-013 and RP4-751H13.3-014 and RP4-751H13.3-015 andRP4-751H13.3-016 and RP4-751H13.3-017 are part of the same gene; the exact exon structure linking the fragments is yet to be determined ENST00000478854.1 gene fragments RP4-751H13.3-012 and RP4-751H13.3-013 and RP4-751H13.3-014 and RP4-751H13.3-015 andRP4-751H13.3-016 and RP4-751H13.3-017 are part of the same gene; the exact exon structure linking the fragments is yet to be determined ENST00000493567.1 NAGNAG splice site ENST00000493567.1 non canonical polymorphism ENST00000465639.1 non canonical polymorphism ENST00000472850.1 non canonical polymorphism ENST00000477367.1 alternative 5' UTR ENST00000323078.7 alternative 5' UTR ENST00000493307.1 alternative 5' UTR ENST00000466675.1 alternative 5' UTR ENST00000482669.1 alternative 5' UTR ENST00000519397.1 alternative 5' UTR ENST00000461637.2 alternative 5' UTR ENST00000518514.1 alternative 5' UTR ENST00000478789.1 alternative 5' UTR ENST00000490973.1 alternative 5' UTR ENST00000479232.1 alternative 5' UTR ENST00000328902.5 NP_078987.3 ENST00000492607.1 alternative 5' UTR ENST00000492607.1 not organism-supported ENST00000326442.5 alternative 5' UTR ENST00000429904.2 alternative 5' UTR ENST00000484928.1 alternative 5' UTR ENST00000493429.1 alternative 5' UTR ENST00000467291.1 alternative 5' UTR ENST00000460213.1 alternative 5' UTR ENST00000483043.1 alternative 5' UTR ENST00000494791.1 suspected genomic sequence error affecting CDS in exon 10 ENST00000483786.1 alternative 5' UTR ENST00000485713.1 alternative 5' UTR ENST00000490898.1 alternative 5' UTR ENST00000482950.1 alternative 5' UTR ENST00000463414.1 alternative 5' UTR ENST00000488420.1 alternative 5' UTR ENST00000392818.3 alternative 5' UTR ENST00000462940.1 alternative 5' UTR ENST00000482202.1 alternative 5' UTR ENST00000476627.1 alternative 5' UTR ENST00000488752.1 alternative 5' UTR ENST00000492838.1 alternative 5' UTR ENST00000297537.4 not organism-supported ENST00000377867.3 NP_543147 ENST00000222388.2 NP_005683.2 ENST00000468073.1 alternative 5' UTR ENST00000441774.1 alternative 5' UTR ENST00000477252.1 alternative 5' UTR ENST00000491651.1 alternative 5' UTR ENST00000470229.1 alternative 5' UTR ENST00000483358.1 alternative 5' UTR ENST00000470370.1 not organism-supported ENST00000418337.2 Isoform b ENST00000287878.3 Isoform a ENST00000392801.2 Isoform c ENST00000476632.1 alternative 5' UTR ENST00000431418.2 non canonical polymorphism ENST00000448366.2 non canonical polymorphism ENST00000426341.2 non canonical polymorphism ENST00000416269.2 non canonical polymorphism ENST00000414073.2 non canonical polymorphism ENST00000482812.1 alternative 5' UTR ENST00000430044.2 alternative 5' UTR ENST00000431668.1 alternative 5' UTR ENST00000446096.1 alternative 5' UTR ENST00000447778.1 alternative 5' UTR ENST00000434507.1 alternative 5' UTR ENST00000419245.1 alternative 5' UTR ENST00000447796.1 alternative 5' UTR ENST00000424877.1 not organism-supported ENST00000485241.1 not organism-supported ENST00000418061.1 not organism-supported ENST00000418673.1 not organism-supported ENST00000490130.1 not finished ENST00000452749.1 NAGNAG splice site ENST00000416982.1 346547 ENST00000425591.1 FLJ46080 ENST00000449486.1 FLJ32047 ENST00000287907.2 FLJ36936 ENST00000425172.1 alternative 5' UTR ENST00000401878.3 NP_444271.2 ENST00000377722.2 FLJ42330 ENST00000404282.2 alternative 5' UTR ENST00000439609.1 alternative 5' UTR ENST00000405335.1 alternative 5' UTR ENST00000389103.4 Isoform 3 - cDNA Em:BC026241.1 also made as an artifact ENST00000441561.1 alternative 5' UTR ENST00000429029.2 Isofrom B ENST00000262177.4 Isoform A ENST00000486083.2 not organism-supported ENST00000417758.1 alternative 5' UTR ENST00000437030.1 alternative 5' UTR ENST00000412557.1 alternative 5' UTR ENST00000453383.1 alternative 5' UTR ENST00000439402.1 alternative 5' UTR ENST00000389416.4 NP_570857 ENST00000409610.1 FLJ43955 ENST00000409423.1 alternative 5' UTR ENST00000441982.1 FLJ20311 ENST00000251527.5 KIAA1228 ENST00000435514.2 FLJ42097 ENST00000377633.3 FLJ16511 ENST00000518652.1 alternative 5' UTR ENST00000518240.1 alternative 5' UTR ENST00000349830.3 NP_055444.2 ENST00000405979.2 NMD transcript ENST00000518724.1 Suspected genomic sequence error affecting CDS in exon 6 ENST00000518724.1 NP_997294.2 ENST00000430797.1 NMD transcript ENST00000382692.2 Identical to AF238378.4-001 ENST00000382689.3 Identical to AF233439.7-001 ENST00000355602.2 NP_001035795 ENST00000533250.1 confirm experimentally ENST00000454911.2 not organism-supported ENST00000326625.5 not organism-supported ENST00000400120.3 FLJ78400 ENST00000529252.1 not best-in-genome evidence ENST00000533615.1 not best-in-genome evidence ENST00000520004.1 rs71217287 ENST00000520004.1 rs35972623 ENST00000520004.1 NP_001074295.1 ENST00000519292.1 alternative 3' UTR ENST00000519699.1 alternative 5' UTR ENST00000521863.1 not organism-supported ENST00000521242.1 not organism-supported ENST00000521149.1 non-canonical acceptor splice sites between exons 3 and 4 ENST00000521818.1 not organism-supported ENST00000534308.1 alternative 5' UTR ENST00000528897.1 alternative 5' UTR ENST00000531804.1 alternative 5' UTR ENST00000528027.1 alternative 5' UTR ENST00000455213.2 alternative 5' UTR ENST00000528323.1 NP_001129220 ENST00000436750.2 alternative 5' UTR ENST00000530337.1 alternative 5' UTR ENST00000525900.1 alternative 5' UTR ENST00000530664.1 alternative 5' UTR ENST00000530640.1 alternative 5' UTR ENST00000531089.1 alternative 5' UTR ENST00000453527.2 alternative 5' UTR ENST00000345125.3 alternative 5' UTR ENST00000533455.1 alternative 5' UTR ENST00000534510.1 alternative 5' UTR ENST00000534636.1 alternative 5' UTR ENST00000533572.1 alternative 5' UTR ENST00000530296.1 alternative 5' UTR ENST00000525076.1 alternative 5' UTR ENST00000526195.1 alternative 5' UTR ENST00000527243.1 alternative 5' UTR ENST00000534149.1 alternative 5' UTR ENST00000505496.2 alternative 5' UTR ENST00000524500.1 alternative 5' UTR ENST00000531502.1 alternative 5' UTR ENST00000532656.1 alternative 5' UTR ENST00000534382.1 alternative 5' UTR ENST00000528965.1 alternative 5' UTR ENST00000524654.1 alternative 5' UTR ENST00000512044.2 alternative 5' UTR ENST00000382080.1 not organism-supported ENST00000518960.1 alternative 5' UTR ENST00000519044.1 not organism-supported ENST00000524358.1 alternative 5' UTR ENST00000520178.1 alternative 5' UTR ENST00000522656.1 alternative 5' UTR ENST00000470360.1 P52569-2 ENST00000398056.2 alternative 5' UTR ENST00000522444.1 alternative 5' UTR ENST00000518650.1 alternative 5' UTR ENST00000523055.1 alternative 5' UTR ENST00000262097.6 isoform a ENST00000381733.4 isoform b ENST00000314146.10 NP_001120977 ENST00000518087.1 last intron has donor and acceptor splice sites but only 29bp ENST00000518029.1 alternative 5' UTR ENST00000517492.1 alternative 5' UTR ENST00000520546.1 alternative 5' UTR ENST00000521878.1 not organism-supported ENST00000519207.1 alternative 5' UTR ENST00000454498.2 alternative 5' UTR ENST00000522854.1 alternative 5' UTR ENST00000519222.1 alternative 5' UTR ENST00000523262.1 alternative 5' UTR ENST00000517494.1 alternative 5' UTR ENST00000520003.1 alternative 5' UTR ENST00000524213.1 alternative 5' UTR ENST00000520827.1 non-canonical splice acceptor site between exons 1 and 2 ENST00000524029.1 alternative 5' UTR ENST00000522701.1 alternative 5' UTR ENST00000265808.7 alternative 5' UTR ENST00000519026.1 alternative 5' UTR ENST00000306793.4 not organism-supported ENST00000517328.1 not organism-supported ENST00000517328.1 alternative 5' UTR ENST00000517892.1 not organism-supported ENST00000522071.1 alternative 5' UTR ENST00000518017.1 alternative 5' UTR ENST00000433566.3 not organism-supported ENST00000520125.1 alternative 5' UTR ENST00000521157.1 alternative 5' UTR ENST00000522813.1 alternative 5' UTR ENST00000518119.1 alternative 5' UTR ENST00000289820.6 alternative 5' UTR ENST00000522148.1 alternative 5' UTR ENST00000519850.1 alternative 5' UTR ENST00000523623.1 alternative 5' UTR ENST00000520174.1 alternative 5' UTR ENST00000517804.1 alternative 5' UTR ENST00000517418.1 alternative 5' UTR ENST00000523266.1 alternative 5' UTR ENST00000312841.8 Based on: ENST00000312841.8 cDNA or EST evidences are absent ENST00000321613.3 alternative 5' UTR ENST00000306433.4 alternative 5' UTR ENST00000454009.2 alternative 5' UTR ENST00000520644.1 alternative 5' UTR ENST00000289952.5 alternative 5' UTR ENST00000524285.1 alternative 5' UTR ENST00000456545.1 alternative 5' UTR ENST00000452226.1 alternative 5' UTR ENST00000397761.2 alternative 5' UTR ENST00000422517.1 alternative 5' UTR ENST00000436754.1 alternative 5' UTR ENST00000426493.1 alternative 5' UTR ENST00000429812.1 alternative 5' UTR ENST00000521301.1 alternative 5' UTR ENST00000389279.3 alternative 5' UTR ENST00000521837.1 alternative 5' UTR ENST00000523349.1 alternative 5' UTR ENST00000519492.1 not organism-supported ENST00000524077.1 alternative 5' UTR ENST00000397703.2 confirm experimentally ENST00000356864.3 upstream_ATG-40 ENST00000518454.1 alternative 5' UTR ENST00000265806.6 NP_001129580.1 ENST00000519952.1 alternative 5' UTR ENST00000518840.1 alternative 5' UTR ENST00000521588.1 alternative 5' UTR ENST00000523833.1 non-canonical splice acceptor site between exons 2 and 3 ENST00000518083.1 alternative 5' UTR ENST00000524168.1 alternative 5' UTR ENST00000519243.1 alternative 5' UTR ENST00000417331.2 not organism-supported ENST00000523930.1 not organism-supported ENST00000380789.1 not organism-supported ENST00000521540.1 not organism-supported ENST00000433454.2 NP_001099011 ENST00000221169.5 suspected genomic sequence error affecting CDS in exon 3 ENST00000276440.7 NP_079216.4 ENST00000421054.2 alternative 5' UTR ENST00000519665.1 not organism-supported ENST00000330560.3 NP_689775 ENST00000520409.1 alternative 5' UTR ENST00000518611.1 alternative 5' UTR ENST00000522362.1 NP_009188 ENST00000521913.1 alternative 5' UTR ENST00000522745.1 alternative 3' UTR ENST00000380586.1 NP_150646 ENST00000519096.1 alternative 5' UTR ENST00000380573.3 alternative 5' UTR ENST00000397501.1 alternative 5' UTR ENST00000519650.1 alternative 5' UTR ENST00000522517.1 alternative 5' UTR ENST00000412793.1 alternative 5' UTR ENST00000524096.1 alternative 5' UTR ENST00000518712.1 alternative 5' UTR ENST00000521921.1 alternative 5' UTR ENST00000520208.1 alternative 5' UTR ENST00000518328.1 alternative 5' UTR ENST00000380476.3 alternative 5' UTR ENST00000523500.1 alternative 5' UTR ENST00000520012.1 alternative 5' UTR ENST00000523589.1 alternative 5' UTR ENST00000520796.1 alternative 5' UTR ENST00000519742.1 alternative 5' UTR ENST00000520491.1 alternative 5' UTR ENST00000522413.1 alternative 5' UTR ENST00000519472.1 first 62 bp of ESTs hasn't found ENST00000519472.1 alternative 5' UTR ENST00000523396.1 alternative 5' UTR ENST00000522238.1 alternative 5' UTR ENST00000337221.3 NP_878185.1 ENST00000523566.1 alternative 5' UTR ENST00000519637.1 alternative 5' UTR ENST00000522944.1 alternative 5' UTR ENST00000517320.1 non-canonical acceptor splice site between exons 1 and 2 ENST00000520270.1 alternative 5' UTR ENST00000521570.1 alternative 5' UTR ENST00000521099.1 alternative 5' UTR ENST00000518479.1 alternative 5' UTR ENST00000520535.1 not organism-supported ENST00000523202.1 alternative 5' UTR ENST00000523095.1 alternative 5' UTR ENST00000521912.1 alternative 5' UTR ENST00000520290.1 alternative 5' UTR ENST00000521185.1 alternative 5' UTR ENST00000522795.1 alternative 5' UTR ENST00000517459.1 alternative 5' UTR ENST00000523546.1 alternative 5' UTR ENST00000523149.1 not organism-supported ENST00000520184.1 alternative 5' UTR ENST00000287701.10 alternative 5' UTR ENST00000519662.1 alternative 5' UTR ENST00000558662.1 not organism-supported ENST00000560599.1 not organism-supported ENST00000517386.1 NAGNAG splice site ENST00000523127.1 not organism-supported ENST00000523116.1 NP_001121680.1 ENST00000523666.1 not organism-supported ENST00000522708.1 not organism-supported ENST00000518599.1 alternative 5' UTR ENST00000518445.1 alternative 5' UTR ENST00000522735.1 suspected genomic sequence error affecting CDS in exon 8 ENST00000517341.1 suspected genomic sequence error affecting CDS in exon 7 ENST00000519246.1 suspected genomic sequence error affecting CDS in exon 7 ENST00000523607.1 suspected genomic sequence error affecting CDS in exon 6 ENST00000221138.4 NP_001009552.1 ENST00000520056.1 not organism-supported ENST00000523392.1 alternative 5' UTR ENST00000523534.1 not organism-supported ENST00000405005.2 non-canonical splice donor site between exons 1 and 2 ENST00000518672.1 alternative 5' UTR ENST00000360742.5 alternative 5' UTR ENST00000522668.1 alternative 5' UTR ENST00000523305.1 alternative 5' UTR ENST00000523956.1 alternative 5' UTR ENST00000522982.1 alternative 5' UTR ENST00000420357.1 not organism-supported ENST00000287272.2 not organism-supported ENST00000416672.1 not organism-supported ENST00000523973.1 not organism-supported ENST00000517363.1 alternative 5' UTR ENST00000518586.1 alternative 5' UTR ENST00000335171.6 alternative 5' UTR ENST00000521644.1 alternative 5' UTR ENST00000519638.1 not organism-supported ENST00000519638.1 alternative 5' UTR ENST00000523187.1 alternative 5' UTR ENST00000521631.1 aligns to the genomic sequence ENST00000412232.2 NP_116166.7 ENST00000518826.1 alternative 5' UTR ENST00000519081.1 ENSG00000207103 ENST00000521915.1 ENSG00000206610 ENST00000527834.1 alternative 5' UTR ENST00000533100.1 not organism-supported ENST00000520272.2 alternative 5' UTR ENST00000529845.1 (Bos taurus) ENST00000529845.1 not organism-supported ENST00000526071.1 (Bos taurus) ENST00000526071.1 not organism-supported ENST00000424479.2 Isoform 1 ENST00000534339.1 not organism-supported ENST00000530588.1 non-canonical splice donor site between exons 1 and 2 ENST00000419686.2 NP_001096030.1 ENST00000529223.1 alternative 5' UTR ENST00000534155.1 alternative 5' UTR ENST00000534539.1 alternative 5' UTR ENST00000527334.1 alternative 5' UTR ENST00000297720.5 NP_653253.1 ENST00000524874.1 not organism-supported ENST00000518883.2 alternative 5' UTR ENST00000526356.1 alternative 5' UTR ENST00000487647.1 non-canonical splice donor site between exons 8 and 9 ENST00000487647.1 non canonical conserved ENST00000466021.1 non canonical conserved ENST00000466021.1 non-canonical splice donor site between exons 2 and 3 ENST00000397108.4 non-canonical splice donor site between exons 10 and 11 ENST00000397108.4 alternative 5' UTR ENST00000397103.1 non-canonical splice donor site between exons 7 and 8 ENST00000397103.1 non canonical conserved ENST00000326324.6 non-canonical splice donor site between exons 8 and 9 ENST00000326324.6 non canonical conserved ENST00000532791.1 alternative 5' UTR ENST00000397113.2 non canonical conserved ENST00000397113.2 non-canonical splice donor site between exons 9 and 10 ENST00000397113.2 alternative 5' UTR ENST00000356207.5 non-canonical splice donor site between exons 8 and 9 ENST00000356207.5 non canonical conserved ENST00000397091.5 non canonical conserved ENST00000397091.5 non-canonical splice donor site between exons 9 and 10 ENST00000527203.1 NMD likely if extended ENST00000525001.1 alternative 5' UTR ENST00000526742.1 alternative 5' UTR ENST00000529552.1 alternative 5' UTR ENST00000530568.1 alternative 5' UTR ENST00000434187.1 alternative 5' UTR ENST00000440174.1 alternative 5' UTR ENST00000522904.1 not organism-supported ENST00000524354.1 alternative 5' UTR ENST00000521528.1 alternative 5' UTR ENST00000520973.1 alternative 5' UTR ENST00000521935.1 alternative 5' UTR ENST00000524193.1 alternative 5' UTR ENST00000521866.1 not organism-supported ENST00000518571.1 suspected genomic sequence error affecting CDS in exon 11 ENST00000388745.4 suspected genomic sequence error affecting CDS in exon 12 ENST00000519640.1 alternative 5' UTR ENST00000521784.1 suspected genomic sequence error affecting CDS in exon 10 ENST00000521784.1 not organism-supported ENST00000456845.2 alternative 5' UTR ENST00000522142.1 alternative 5' UTR ENST00000517872.1 alternative 5' UTR ENST00000520152.1 alternative 5' UTR ENST00000522198.1 not organism-supported ENST00000518804.1 alternative 5' UTR ENST00000519154.1 alternative 5' UTR ENST00000522495.1 alternative 5' UTR ENST00000522840.1 alternative 5' UTR ENST00000519406.1 alternative 5' UTR ENST00000518270.1 alternative 5' UTR ENST00000357743.4 alternative 5' UTR ENST00000519853.1 alternative 5' UTR ENST00000520223.1 alternative 5' UTR ENST00000348036.4 NP_065213 ENST00000406337.1 alternative 5' UTR ENST00000418721.1 FLJ46465 ENST00000426524.1 alternative 5' UTR ENST00000518421.1 alternative 5' UTR ENST00000522288.1 alternative 5' UTR ENST00000517969.1 alternative 5' UTR ENST00000429089.2 not organism-supported ENST00000520523.1 alternative 5' UTR ENST00000521694.1 alternative 5' UTR ENST00000522610.1 not organism-supported ENST00000519771.1 not organism-supported ENST00000518579.1 not organism-supported ENST00000520115.1 alternative 5' UTR ENST00000522069.1 alternative 5' UTR ENST00000522572.1 not organism-supported ENST00000518495.1 non-canonical splice donor site between exons 5 and 6 ENST00000521158.1 NP_001129166.1 ENST00000522010.1 not organism-supported ENST00000520262.1 alternative 5' UTR ENST00000520179.1 alternative 5' UTR ENST00000518717.1 alternative 5' UTR ENST00000517366.1 alternative 5' UTR ENST00000522707.1 alternative 5' UTR ENST00000518384.1 alternative 5' UTR ENST00000438528.2 alternative 5' UTR ENST00000414154.2 alternative 5' UTR ENST00000416469.2 alternative 5' UTR ENST00000490331.2 alternative 5' UTR ENST00000345117.2 NP_945354.1 ENST00000529779.1 not organism-supported ENST00000531440.1 alternative 5' UTR ENST00000524954.1 alternative 5' UTR ENST00000529687.1 non-canonical aceptor splice site between exons 9 and 10 ENST00000518991.1 alternative 5' UTR ENST00000523565.1 confirm experimentally ENST00000523565.1 suspected genomic sequence error affecting CDS in exon 31 ENST00000518216.1 suspected genomic sequence error affecting CDS in exon 31 ENST00000518221.1 alternative 5' UTR ENST00000523944.1 alternative 5' UTR ENST00000396826.2 alternative 5' UTR ENST00000518382.1 alternative 5' UTR ENST00000524276.1 alternative 5' UTR ENST00000521261.1 alternative 5' UTR ENST00000520809.1 alternative 5' UTR ENST00000520595.1 alternative 5' UTR ENST00000324746.3 not organism-supported ENST00000521628.1 alternative 5' UTR ENST00000430626.1 FLJ46365 ENST00000523008.1 alternative 3' UTR ENST00000522254.1 alternative 3' UTR ENST00000517663.1 alternative 5' UTR ENST00000518864.1 alternative 5' UTR ENST00000523085.1 alternative 5' UTR ENST00000360540.5 alternative 5' UTR ENST00000517580.1 alternative 5' UTR ENST00000519118.1 alternative 5' UTR ENST00000518468.1 alternative 5' UTR ENST00000520287.1 alternative 5' UTR ENST00000396774.2 alternative 5' UTR ENST00000521275.1 alternative 5' UTR ENST00000524234.1 alternative 5' UTR ENST00000522521.1 not organism-supported ENST00000522090.1 alternative 5' UTR ENST00000522030.1 not organism-supported ENST00000523423.1 alternative 5' UTR ENST00000520414.1 alternative 5' UTR ENST00000522576.1 alternative 5' UTR ENST00000523180.1 alternative 5' UTR ENST00000520050.1 alternative 5' UTR ENST00000520627.1 alternative 5' UTR ENST00000520627.1 not organism-supported ENST00000316981.3 alternative 5' UTR ENST00000517636.1 alternative 5' UTR ENST00000524136.2 non canonical TEC ENST00000314922.3 alternative 5' UTR ENST00000518974.1 alternative 5' UTR ENST00000413219.2 alternative 5' UTR ENST00000427130.2 NP_001138244.1 ENST00000531654.1 not organism-supported ENST00000530071.1 not organism-supported ENST00000526846.1 alternative 5' UTR ENST00000522621.1 alternative 5' UTR ENST00000519846.1 alternative 5' UTR ENST00000524095.1 alternative 5' UTR ENST00000520712.1 alternative 5' UTR ENST00000356457.5 NP_115855.1 ENST00000389204.4 NP_064549 ENST00000522603.1 NP_115856.1 ENST00000521674.1 suspected genomic sequence error affecting CDS in exon 1 ENST00000521674.1 ticket number HG-421 ENST00000523455.1 suspected genomic sequence error affecting CDS in exon 1 ENST00000523455.1 alternative 5' UTR ENST00000524135.1 suspected genomic sequence error affecting CDS in exon 1 ENST00000518438.1 suspected genomic sequence error affecting CDS in exon 1 ENST00000518438.1 alternative 5' UTR ENST00000522740.1 not organism-supported ENST00000518908.1 alternative 5' UTR ENST00000519352.1 alternative 5' UTR ENST00000523253.1 alternative 5' UTR ENST00000415254.1 not organism-supported ENST00000276576.7 FLJ32430 ENST00000460144.1 not organism-supported ENST00000517885.1 not organism-supported ENST00000519289.1 alternative 5' UTR ENST00000521198.1 alternative 5' UTR ENST00000522398.1 alternative 5' UTR ENST00000520976.1 alternative 5' UTR ENST00000519561.1 alternative 5' UTR ENST00000396592.3 NP_001129633.1 ENST00000422365.2 NP_775789.3 ENST00000313616.5 NP_001129632.1 ENST00000517736.1 not organism-supported ENST00000525061.1 alternative 5' UTR ENST00000529134.1 alternative 5' UTR ENST00000402687.4 alternative 5' UTR ENST00000419716.3 alternative 5' UTR ENST00000534179.1 alternative 5' UTR ENST00000528783.1 alternative 5' UTR ENST00000525999.1 alternative 5' UTR ENST00000426346.1 alternative 5' UTR ENST00000518287.1 not organism-supported ENST00000519724.1 alternative 5' UTR ENST00000520416.1 alternative 5' UTR ENST00000522447.1 alternative 3' UTR ENST00000520030.1 alternative 5' UTR ENST00000519350.1 alternative 5' UTR ENST00000388742.4 alternative 5' UTR ENST00000465115.1 FLJ45899 ENST00000396467.1 alternative 5' UTR ENST00000396466.1 alternative 5' UTR ENST00000435330.1 alternative 5' UTR ENST00000431653.1 alternative 5' UTR ENST00000524300.1 rs949493 ENST00000355780.5 alternative 5' UTR ENST00000521451.1 rs949493 ENST00000521447.1 alternative 5' UTR ENST00000521736.1 alternative 5' UTR ENST00000358757.4 subject to nonsense-mediated decay ENST00000519487.1 alternative 5' UTR ENST00000284811.8 alternative 5' UTR ENST00000522337.1 alternative 5' UTR ENST00000523815.1 alternative 5' UTR ENST00000519082.1 alternative 5' UTR ENST00000519021.1 alternative 5' UTR ENST00000434412.2 NP_001035808 ENST00000260113.2 alternative 5' UTR ENST00000520277.1 alternative 5' UTR ENST00000517683.1 not organism-supported ENST00000520307.1 alternative 5' UTR ENST00000523885.1 alternative 5' UTR ENST00000523809.1 alternative 5' UTR ENST00000518282.1 not organism-supported ENST00000520103.1 alternative 5' UTR ENST00000522527.1 alternative 5' UTR ENST00000518986.1 alternative 5' UTR ENST00000519956.1 alternative 5' UTR ENST00000352966.5 alternative 5' UTR ENST00000518467.1 alternative 5' UTR ENST00000518491.1 alternative 5' UTR ENST00000521434.1 alternative 5' UTR ENST00000519120.1 alternative 5' UTR ENST00000520946.1 alternative 5' UTR ENST00000518271.1 alternative 5' UTR ENST00000430430.1 NP_001099009.1 ENST00000519936.1 alternative 5' UTR ENST00000311489.4 NP_001138351.1 ENST00000449740.2 NP_001138350.1 ENST00000521360.1 alternative 5' UTR ENST00000522997.1 alternative 5' UTR ENST00000521287.1 alternative 5' UTR ENST00000520635.1 alternative 5' UTR ENST00000520604.1 alternative 5' UTR ENST00000523361.1 alternative 5' UTR ENST00000517450.1 alternative 5' UTR ENST00000521742.1 alternative 5' UTR ENST00000518419.1 alternative 5' UTR ENST00000520076.1 alternative 5' UTR ENST00000353788.4 NP_690050.1 ENST00000521810.1 alternative 5' UTR ENST00000519119.1 alternative 5' UTR ENST00000519817.1 alternative 5' UTR ENST00000518183.1 alternative 5' UTR ENST00000521773.1 alternative 5' UTR ENST00000522613.1 alternative 5' UTR ENST00000522455.1 alternative 5' UTR ENST00000521695.1 alternative 5' UTR ENST00000517988.1 alternative 5' UTR ENST00000522647.1 alternative 5' UTR ENST00000417663.2 suspected genomic sequence error affecting CDS in exon 87 ENST00000431163.2 suspected genomic sequence error affecting CDS in exon 49 ENST00000421308.2 suspected genomic sequence error affecting CDS in exon 87 ENST00000421308.2 alternative 5' UTR ENST00000524353.1 suspected genomic sequence error affecting CDS in exon 87 ENST00000524353.1 alternative 5' UTR ENST00000518562.1 suspected genomic sequence error affecting CDS in exon 49 ENST00000518091.1 suspected genomic sequence error affecting CDS in exon 87 ENST00000518091.1 alternative 5' UTR ENST00000458398.2 suspected genomic sequence error affecting CDS in exon 87 ENST00000458398.2 alternative 5' UTR ENST00000523281.1 alternative 5' UTR ENST00000523022.1 alternative 5' UTR ENST00000517618.1 alternative 5' UTR ENST00000517590.1 alternative 5' UTR ENST00000521846.1 alternative 5' UTR ENST00000522579.1 alternative 5' UTR ENST00000522814.1 alternative 5' UTR ENST00000522662.1 alternative 5' UTR ENST00000523858.1 alternative 5' UTR ENST00000519129.1 alternative 5' UTR ENST00000521564.1 alternative 5' UTR ENST00000523635.1 alternative 5' UTR ENST00000523072.1 alternative 5' UTR ENST00000523001.1 alternative 5' UTR ENST00000520814.1 alternative 5' UTR ENST00000517771.1 alternative 5' UTR ENST00000523469.1 alternative 5' UTR ENST00000522240.1 alternative 5' UTR ENST00000451899.2 NP_001119583 ENST00000517772.1 alternative 5' UTR ENST00000517337.1 alternative 5' UTR ENST00000523716.1 alternative 5' UTR ENST00000520613.1 alternative 5' UTR ENST00000514406.2 alternative 5' UTR ENST00000521852.1 alternative 5' UTR ENST00000522820.1 alternative 5' UTR ENST00000518304.1 alternative 5' UTR ENST00000522862.1 alternative 5' UTR ENST00000276609.3 alternative 5' UTR ENST00000360348.2 NP_783553 ENST00000422361.2 NP_783554 ENST00000520724.1 alternative 5' UTR ENST00000518844.1 alternative 5' UTR ENST00000518992.1 alternative 5' UTR ENST00000521054.1 alternative 5' UTR ENST00000519847.1 alternative 5' UTR ENST00000517792.1 alternative 5' UTR ENST00000522467.1 alternative 5' UTR ENST00000517919.1 alternative 5' UTR ENST00000521733.1 alternative 5' UTR ENST00000520556.1 alternative 5' UTR ENST00000521319.1 alternative 5' UTR ENST00000520583.1 alternative 5' UTR ENST00000523168.1 alternative 5' UTR ENST00000518823.1 alternative 5' UTR ENST00000518317.1 alternative 5' UTR ENST00000521375.1 alternative 5' UTR ENST00000520974.1 alternative 5' UTR ENST00000518832.1 alternative 5' UTR ENST00000518954.1 alternative 5' UTR ENST00000519061.1 alternative 5' UTR ENST00000520428.1 alternative 5' UTR ENST00000518449.1 alternative 5' UTR ENST00000518748.1 alternative 5' UTR ENST00000520686.1 alternative 5' UTR ENST00000520430.1 alternative 5' UTR ENST00000517858.1 alternative 5' UTR ENST00000378861.5 alternative 5' UTR ENST00000524037.1 alternative 5' UTR ENST00000521617.1 alternative 5' UTR ENST00000519069.1 alternative 5' UTR ENST00000524107.1 alternative 5' UTR ENST00000519969.1 alternative 5' UTR ENST00000517751.1 alternative 5' UTR ENST00000522903.1 alternative 5' UTR ENST00000520955.1 alternative 5' UTR ENST00000519109.1 alternative 5' UTR ENST00000518597.1 alternative 5' UTR ENST00000520560.1 alternative 5' UTR ENST00000521947.1 alternative 5' UTR ENST00000498673.1 alternative 5' UTR ENST00000409623.3 NP_001135773 ENST00000520614.1 alternative 5' UTR ENST00000520728.1 alternative 5' UTR ENST00000518107.1 alternative 5' UTR ENST00000518573.1 alternative 5' UTR ENST00000517764.1 alternative 5' UTR ENST00000518827.1 alternative 5' UTR ENST00000521144.1 alternative 5' UTR ENST00000450165.2 NP_001138135 ENST00000521491.1 alternative 5' UTR ENST00000396194.2 NP_859053 ENST00000523433.1 alternative 5' UTR ENST00000523839.1 alternative 5' UTR ENST00000423620.2 NP_001116298 ENST00000523378.1 alternative 5' UTR ENST00000396113.1 alternative 5' UTR ENST00000519804.1 alternative 5' UTR ENST00000448464.2 NP_001129205 ENST00000519516.1 alternative 5' UTR ENST00000519366.1 not organism-supported ENST00000517720.1 alternative 5' UTR ENST00000522072.1 alternative 5' UTR ENST00000522911.1 alternative 5' UTR ENST00000519914.1 alternative 5' UTR ENST00000521590.1 alternative 5' UTR ENST00000523877.1 alternative 5' UTR ENST00000519900.1 alternative 5' UTR ENST00000517742.1 alternative 5' UTR ENST00000519484.1 alternative 5' UTR ENST00000521142.1 alternative 5' UTR ENST00000521291.1 alternative 5' UTR ENST00000523172.1 not organism-supported ENST00000521726.1 alternative 5' UTR ENST00000522319.1 alternative 5' UTR ENST00000349693.3 alternative 5' UTR ENST00000519420.1 alternative 5' UTR ENST00000521839.1 alternative 5' UTR ENST00000521839.1 not organism-supported ENST00000522510.1 alternative 5' UTR ENST00000518199.1 alternative 5' UTR ENST00000355155.1 NP_056058.2 ENST00000355155.1 CCDS6283.1 ENST00000524330.1 not organism-supported ENST00000297564.2 alternative 5' UTR ENST00000520271.1 alternative 5' UTR ENST00000517682.1 alternative 5' UTR ENST00000524245.1 alternative 5' UTR ENST00000522940.1 alternative 5' UTR ENST00000518171.1 BI254944 ENST00000518171.1 BI667068 ENST00000518171.1 alternative 3' UTR ENST00000519092.1 alternative 5' UTR ENST00000519408.1 alternative 5' UTR ENST00000519449.1 alternative 5' UTR ENST00000519527.1 alternative 5' UTR ENST00000523167.1 alternative 5' UTR ENST00000522369.1 alternative 5' UTR ENST00000432381.2 alternative 5' UTR ENST00000523481.1 alternative 5' UTR ENST00000519597.1 alternative 5' UTR ENST00000520311.1 alternative 5' UTR ENST00000519316.1 not organism-supported ENST00000358990.3 alternative 5' UTR ENST00000524072.1 alternative 5' UTR ENST00000524072.1 not organism-supported ENST00000523000.1 alternative 5' UTR ENST00000521345.1 alternative 5' UTR ENST00000518293.1 non-submitted evidence ENST00000518293.1 alternative 3' UTR ENST00000518293.1 CA307218 ENST00000520868.1 alternative 3' UTR ENST00000517990.1 not organism-supported ENST00000522658.1 alternative 3' UTR ENST00000518196.1 alternative 5' UTR ENST00000521865.1 alternative 5' UTR ENST00000520142.1 alternative 5' UTR ENST00000522720.1 alternative 5' UTR ENST00000521067.1 alternative 5' UTR ENST00000520804.1 alternative 5' UTR ENST00000519363.1 alternative 5' UTR ENST00000395956.3 alternative 5' UTR ENST00000353245.3 alternative 5' UTR ENST00000523848.1 not organism-supported ENST00000517797.1 non-canonical acceptor splice site between exons 2 and 3 ENST00000522819.1 alternative 5' UTR ENST00000395953.2 alternative 5' UTR ENST00000395951.3 alternative 5' UTR ENST00000419477.2 alternative 5' UTR ENST00000521328.1 alternative 5' UTR ENST00000521328.1 not organism-supported ENST00000418997.1 alternative 5' UTR ENST00000437293.1 alternative 5' UTR ENST00000523131.1 alternative 5' UTR ENST00000523131.1 not organism-supported ENST00000523938.1 alternative 5' UTR ENST00000523938.1 not organism-supported ENST00000520411.1 Em:AA431609 ENST00000518090.1 DB516632 ENST00000518090.1 DB524701 ENST00000520984.1 alternative 3' UTR ENST00000517844.1 alternative 5' UTR ENST00000520347.1 alternative 5' UTR ENST00000518336.1 alternative 5' UTR ENST00000523146.1 not organism-supported ENST00000523922.1 alternative 5' UTR ENST00000520454.1 alternative 5' UTR ENST00000521085.1 alternative 5' UTR ENST00000220931.6 alternative 5' UTR ENST00000519508.1 alternative 5' UTR ENST00000522951.1 alternative 5' UTR ENST00000518727.1 alternative 5' UTR ENST00000520425.1 alternative 5' UTR ENST00000518166.1 alternative 5' UTR ENST00000522252.1 alternative 5' UTR ENST00000517822.1 alternative 5' UTR ENST00000524209.1 alternative 5' UTR ENST00000517531.1 alternative 5' UTR ENST00000521964.1 alternative 5' UTR ENST00000519098.1 alternative 5' UTR ENST00000523923.1 alternative 5' UTR ENST00000520346.1 alternative 5' UTR ENST00000518661.1 alternative 5' UTR ENST00000522206.1 alternative 5' UTR ENST00000524137.1 alternative 5' UTR ENST00000522078.1 alternative 5' UTR ENST00000523645.1 alternative 5' UTR ENST00000347770.4 alternative 5' UTR ENST00000520402.1 alternative 5' UTR ENST00000518353.1 alternative 5' UTR ENST00000518738.1 alternative 5' UTR ENST00000521246.1 alternative 5' UTR ENST00000520027.1 alternative 5' UTR ENST00000517361.1 alternative 5' UTR ENST00000518932.1 BF572569 ENST00000531443.1 NP_060472.2 ENST00000520734.1 alternative 5' UTR ENST00000520033.1 alternative 5' UTR ENST00000521502.1 not organism-supported ENST00000521502.1 alternative 5' UTR ENST00000521757.1 alternative 5' UTR ENST00000521956.1 alternative 5' UTR ENST00000522333.1 alternative 5' UTR ENST00000518632.1 not organism-supported ENST00000518632.1 alternative 5' UTR ENST00000517756.1 not organism-supported ENST00000395785.2 alternative 5' UTR ENST00000529502.1 NMD candidate ENST00000530629.1 alternative 5' UTR ENST00000534318.1 alternative 5' UTR ENST00000424158.2 non-canonical splice acceptor site between exons 3 and 4 ENST00000446070.2 alternative 5' UTR ENST00000528647.1 alternative 5' UTR ENST00000533065.1 alternative 5' UTR ENST00000533171.1 alternative 5' UTR ENST00000528045.1 alternative 5' UTR ENST00000529190.1 alternative 5' UTR ENST00000528569.1 alternative 5' UTR ENST00000533821.1 alternative 5' UTR ENST00000530841.1 alternative 5' UTR ENST00000531230.1 alternative 5' UTR ENST00000534501.1 alternative 5' UTR ENST00000524720.1 alternative 5' UTR ENST00000534184.1 alternative 5' UTR ENST00000528716.1 alternative 5' UTR ENST00000526302.1 alternative 5' UTR ENST00000534578.1 alternative 5' UTR ENST00000527600.1 alternative 5' UTR ENST00000297405.5 signal at the upstream start site ENST00000297405.5 NP_937756.1 ENST00000455883.2 NP_443132.3 ENST00000395713.2 alternative 5' UTR ENST00000519815.1 alternative 5' UTR ENST00000422939.1 alternative 5' UTR ENST00000451156.1 alternative 5' UTR ENST00000520813.1 alternative 5' UTR ENST00000520992.1 alternative 5' UTR ENST00000517485.1 alternative 5' UTR ENST00000523547.1 alternative 5' UTR ENST00000519837.1 alternative 5' UTR ENST00000522699.1 alternative 5' UTR ENST00000521243.1 alternative 5' UTR ENST00000519688.1 alternative 5' UTR ENST00000314727.4 5RACE341_AC023590.2-001_from_encode_region_ENr321:_exons_1-1_/_1Single_exon_gene:_only_1_exon_submitted_Spleen ENST00000297350.4 Note that there is a further upstream ATG, approx. 30 AA residues upstream from the current TSS. However, this has relatively poor kozak sequence, but does show conservation amongst other spp ENST00000521748.1 suspected genomic sequence error affecting CDS in exon 1 ENST00000297848.3 NP_066933 ENST00000517992.1 alternative 5' UTR ENST00000520717.1 alternative 5' UTR ENST00000534247.1 alternative 5' UTR ENST00000519018.1 alternative 5' UTR ENST00000523036.1 alternative 5' UTR ENST00000520368.1 alternative 5' UTR ENST00000519418.1 alternative 5' UTR ENST00000522420.1 alternative 5' UTR ENST00000521676.1 alternative 5' UTR ENST00000518684.1 alternative 5' UTR ENST00000518805.1 alternative 5' UTR ENST00000517516.1 alternative 5' UTR ENST00000522655.1 alternative 5' UTR ENST00000522595.1 alternative 5' UTR ENST00000524267.1 alternative 5' UTR ENST00000521903.1 upstream uORF ENST00000523984.1 alternative 5' UTR ENST00000523888.1 alternative 5' UTR ENST00000523297.1 alternative 5' UTR ENST00000523741.1 alternative 5' UTR ENST00000517532.1 alternative 5' UTR ENST00000518013.1 alternative 5' UTR ENST00000522563.1 alternative 5' UTR ENST00000517291.1 Start codon is ctg rather than atg (ref:PMID:3277717) ENST00000377970.2 Start codon is ctg rather than atg (ref:PMID:3277717) ENST00000524013.1 Start codon is ctg rather than atg (ref:PMID:3277717) ENST00000522746.1 alternative 5' UTR ENST00000523509.1 alternative 5' UTR ENST00000401979.2 alternative 5' UTR ENST00000519110.1 alternative 5' UTR ENST00000517654.1 not organism-supported ENST00000517654.1 alternative 5' UTR ENST00000519540.1 alternative 5' UTR ENST00000519142.1 alternative 5' UTR ENST00000521223.1 alternative 5' UTR ENST00000520204.1 alternative 5' UTR ENST00000519020.1 alternative 5' UTR ENST00000517672.1 alternative 5' UTR ENST00000522361.1 alternative 5' UTR ENST00000520927.1 not organism-supported ENST00000254624.5 KIAA0143 ENST00000519920.1 not organism-supported ENST00000434736.2 not organism-supported ENST00000519187.1 alternative 5' UTR ENST00000519304.1 alternative 5' UTR ENST00000522119.1 alternative 5' UTR ENST00000519341.1 alternative 5' UTR ENST00000521302.1 alternative 5' UTR ENST00000523610.1 alternative 5' UTR ENST00000519747.1 alternative 5' UTR ENST00000519558.1 alternative 5' UTR ENST00000323851.7 alternative 5' UTR ENST00000519228.1 alternative 5' UTR ENST00000519580.1 alternative 5' UTR ENST00000522890.1 alternative 5' UTR ENST00000521544.1 alternative 5' UTR ENST00000523634.1 alternative 5' UTR ENST00000519924.1 alternative 5' UTR ENST00000523855.1 alternative 5' UTR ENST00000520727.1 alternative 5' UTR ENST00000523040.1 not organism-supported ENST00000522257.1 not organism-supported ENST00000518674.1 non-canonical splice sites between exons 2 and 3 ENST00000520981.1 not organism-supported ENST00000522079.1 not organism-supported ENST00000160713.4 alternative 5' UTR ENST00000517849.1 alternative 5' UTR ENST00000520380.1 alternative 5' UTR ENST00000522373.1 not best-in-genome evidence ENST00000517887.1 not organism-supported ENST00000521059.1 alternative 5' UTR ENST00000519419.1 not organism-supported ENST00000522424.1 alternative 5' UTR ENST00000521562.1 alternative 5' UTR ENST00000523388.1 alternative 5' UTR ENST00000519024.1 alternative 5' UTR ENST00000521791.1 alternative 5' UTR ENST00000523067.1 alternative 5' UTR ENST00000520475.1 alternative 5' UTR ENST00000520892.1 alternative 5' UTR ENST00000523803.1 alternative 5' UTR ENST00000521907.1 alternative 5' UTR ENST00000517453.1 alternative 5' UTR ENST00000520045.1 alternative 5' UTR ENST00000521395.1 alternative 5' UTR ENST00000521332.1 alternative 5' UTR ENST00000524040.1 alternative 5' UTR ENST00000524257.1 alternative 5' UTR ENST00000521276.1 ENST00000385057 ENST00000523147.1 alternative 5' UTR ENST00000430863.1 non-canonical splicing ENST00000430863.1 173704 ENST00000521161.1 non-canonical splicing ENST00000427937.1 not organism-supported ENST00000520166.1 NAGNAG in exon 9 ENST00000520462.1 alternative 5' UTR ENST00000521103.1 ENSG00000222423 ENST00000517894.1 non-canonical acceptor splice site between exons 5 and 6 ENST00000521208.1 not organism-supported ENST00000521208.1 alternative 5' UTR ENST00000356613.1 NMD exception ENST00000512113.1 suspected genomic sequence error affecting CDS in exon 3 ENST00000301258.4 The rs2294008 is a human lineage specific T to C transition which affects the translation start of the protein. The derived allele C in some human populations changes an ATG codon to ACG which in turn disrupts the start codon (Met) into a Thr. The reference sequence has got the derived allele C and therefore it does not start on a Met. The first report on PSCA protein (PMID: 9465086) ENST00000292430.6 upstream ATG ENST00000317543.7 NP_803253.1 ENST00000335822.5 NP_076435.1 ENST00000395192.2 NP_803252.1 ENST00000345173.6 alternative 5' UTR ENST00000522929.1 alternative 5' UTR ENST00000520131.1 alternative 5' UTR ENST00000519281.1 not organism-supported ENST00000519411.1 not organism-supported ENST00000517471.1 NP_001021384.1 ENST00000323110.2 NP_000489.3 ENST00000517503.1 alternative 5' UTR ENST00000429120.2 NP_001120685.1 ENST00000521699.1 alternative 5' UTR ENST00000520466.1 alternative 5' UTR ENST00000521003.1 alternative 5' UTR ENST00000522971.1 alternative 5' UTR ENST00000522024.1 alternative 5' UTR ENST00000342752.4 NP_001123950.1 ENST00000414417.2 alternative 5' UTR ENST00000520584.1 NMD exception ENST00000520584.1 alternative 5' UTR ENST00000330701.4 NMD exception ENST00000522452.1 alternative 5' UTR ENST00000518575.1 alternative 5' UTR ENST00000518432.1 alternative 5' UTR ENST00000518007.1 not organism-supported ENST00000518760.1 not organism-supported ENST00000526406.1 alternative 5' UTR ENST00000529854.1 alternative 5' UTR ENST00000533348.1 alternative 5' UTR ENST00000525721.1 alternative 5' UTR ENST00000533888.1 alternative 5' UTR ENST00000442189.2 NP_115754.2 ENST00000528610.1 NP_001123528.1 ENST00000395119.3 NP_001951.2 ENST00000524624.1 alternative 5' UTR ENST00000524624.1 not organism-supported ENST00000534380.1 alternative 5' UTR ENST00000533204.1 alternative 5' UTR ENST00000530191.1 alternative 5' UTR ENST00000531218.1 alternative 5' UTR ENST00000533494.1 alternative 5' UTR ENST00000530445.1 alternative 5' UTR ENST00000533749.1 not organism-supported ENST00000525695.1 alternative 5' UTR ENST00000526340.1 alternative 5' UTR ENST00000525223.1 alternative 5' UTR ENST00000532543.1 alternative 5' UTR ENST00000531931.1 alternative 5' UTR ENST00000526710.1 alternative 5' UTR ENST00000531281.1 alternative 5' UTR ENST00000532596.1 alternative 5' UTR ENST00000524883.1 alternative 5' UTR ENST00000531670.1 alternative 5' UTR ENST00000528519.1 alternative 5' UTR ENST00000529832.1 alternative 5' UTR ENST00000530306.1 alternative 5' UTR ENST00000530545.1 alternative 5' UTR ENST00000525261.1 alternative 5' UTR ENST00000534804.1 alternative 5' UTR ENST00000524900.1 alternative 5' UTR ENST00000526135.1 alternative 5' UTR ENST00000531953.1 alternative 5' UTR ENST00000526133.1 alternative 5' UTR ENST00000534475.1 alternative 5' UTR ENST00000528303.1 alternative 5' UTR ENST00000529064.1 alternative 5' UTR ENST00000529048.1 alternative 5' UTR ENST00000533817.1 alternative 5' UTR ENST00000526290.1 alternative 5' UTR ENST00000526926.1 alternative 5' UTR ENST00000458270.2 NP_001075949.1 ENST00000532796.1 NP_055604.3 ENST00000532796.1 non-canonical splice donor site between exons 1 and 2 ENST00000534303.1 alternative 5' UTR ENST00000529833.1 alternative 5' UTR ENST00000526970.1 alternative 5' UTR ENST00000532158.1 alternative 5' UTR ENST00000532205.1 alternative 5' UTR ENST00000527139.1 not organism-supported ENST00000356994.2 not organism-supported ENST00000525985.1 NP_112598 ENST00000528025.1 not organism-supported ENST00000525879.1 alternative 5' UTR ENST00000528625.1 alternative 5' UTR ENST00000525486.1 alternative 5' UTR ENST00000531537.1 alternative 5' UTR ENST00000529842.1 alternative 5' UTR ENST00000528914.1 alternative 5' UTR ENST00000528136.1 alternative 5' UTR ENST00000529311.1 alternative 5' UTR ENST00000532311.1 alternative 5' UTR ENST00000531707.1 alternative 5' UTR ENST00000529301.1 alternative 5' UTR ENST00000530898.1 alternative 5' UTR ENST00000447830.2 NP_001127846 ENST00000561181.1 not organism-supported ENST00000528912.1 not organism-supported ENST00000534424.1 suspected genomic sequence error affecting CDS in exon 25 ENST00000532522.1 alternative 5' UTR ENST00000527572.1 alternative 5' UTR ENST00000531225.1 alternative 5' UTR ENST00000530047.1 alternative 5' UTR ENST00000527078.1 alternative 5' UTR ENST00000402965.1 alternative 5' UTR ENST00000532887.1 alternative 5' UTR ENST00000526887.1 alternative 5' UTR ENST00000403000.2 alternative 5' UTR ENST00000424149.2 alternative 5' UTR ENST00000530637.1 alternative 5' UTR ENST00000529283.1 alternative 5' UTR ENST00000532237.1 suspected genomic sequence error affecting CDS in exon 14 ENST00000532269.1 suspected genomic sequence error affecting CDS in exon 14 ENST00000527730.1 alternative 5' UTR ENST00000529022.1 alternative 5' UTR ENST00000530854.1 alternative 5' UTR ENST00000525766.1 alternative 5' UTR ENST00000377307.2 NP_079527.1 ENST00000394920.2 alternative 5' UTR ENST00000527914.1 alternative 5' UTR ENST00000534813.1 alternative 5' UTR ENST00000532702.1 alternative 5' UTR ENST00000525105.1 alternative 5' UTR ENST00000446747.2 alternative 5' UTR ENST00000525266.1 alternative 5' UTR ENST00000402718.3 alternative 5' UTR ENST00000305103.3 alternative 5' UTR ENST00000529143.1 alternative 5' UTR ENST00000533270.1 alternative 5' UTR ENST00000533221.1 alternative 5' UTR ENST00000533622.1 alternative 5' UTR ENST00000525694.1 alternative 5' UTR ENST00000527049.1 alternative 5' UTR ENST00000276816.4 alternative 5' UTR ENST00000529315.1 alternative 5' UTR ENST00000421620.1 pseudogene similar to part of DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11(CHL1-like helicase homolog, S. cerevisiae) (CHL1, KRG2, CHLR1, MGC9335) (DDX11) ENST00000442926.2 novel pseudogene ENST00000422679.1 putative novel transcript ENST00000438175.1 novel pseudogene similar to phosphoglucomutase 5 (PGM5) ENST00000458364.1 putative novel transcript ENST00000429980.1 putative novel transcript ENST00000442069.1 putative novel transcript ENST00000435421.1 putative novel transcript ENST00000427318.1 putative novel transcript ENST00000416242.1 putative novel transcript ENST00000356521.4 COBW-like protein (LOC55871) ENST00000475990.1 novel transcript ENST00000465380.1 non-canonical acceptor splice site at 5th exon ENST00000465380.1 novel transcript ENST00000382447.4 COBW-like protein (LOC55871) ENST00000465014.1 continued from bA174M15.1.6 in Em:AL356244 ENST00000465014.1 novel transcript ENST00000314367.10 COBW-like protein (LOC55871) ENST00000487575.1 novel transcript ENST00000464198.1 novel transcript ENST00000495302.1 novel transcript ENST00000462513.1 novel transcript ENST00000475411.1 novel transcript ENST00000498044.1 novel transcript ENST00000489272.1 novel transcript ENST00000377447.3 COBW-like protein (LOC55871) ENST00000431099.2 COBW-like protein (LOC55871) ENST00000483817.1 novel transcript ENST00000382393.1 COBW-like protein (LOC55871) ENST00000382389.1 COBW-like protein (LOC55871) ENST00000479404.1 alternative 5' UTR ENST00000487230.1 alternative 5' UTR ENST00000495184.1 Retained intron ENST00000429661.1 putative novel transcript ENST00000415004.1 putative novel transcript ENST00000382303.1 kidney ankyrin repeat-containing protein (KANK, KIAA0172) ENST00000467541.1 novel transcript ENST00000475690.1 novel transcript ENST00000354485.5 kidney ankyrin repeat-containing protein (KANK,, KIAA0172) ENST00000382289.1 kidney ankyrin repeat-containing protein (KANK, KIAA0172) ENST00000382286.1 kidney ankyrin repeat-containing protein (KANK, KIAA0172) ENST00000455592.1 60S ribosomal protein L12 (RPL12) pseudogene ENST00000442442.1 putative novel transcript ENST00000441028.1 putative novel transcript ENST00000444793.1 putative novel transcript ENST00000421436.1 translation initiation factor (SUI1) pseudogene ENST00000421645.1 putative novel transcript ENST00000382276.3 doublesex and mab-3 related transcription factor 1 ENST00000190165.2 doublesex and mab-3 related transcription factor 3 ENST00000417254.1 doublesex and mab-3 related transcription factor 3 ENST00000437555.1 H3 histone pseudogene ENST00000453789.1 putative novel transcript ENST00000382255.3 doublesex and mab-3 related transcription factor 2 ENST00000412350.2 doublesex and mab-3 related transcription factor 2 ENST00000358146.2 doublesex and mab-3 related transcription factor 2 ENST00000259622.6 doublesex and mab-3 related transcription factor 2 ENST00000443334.1 DiGeorge syndrome-related protein pseudogene ENST00000422868.1 ubiquitin pseudogene ENST00000432346.1 transcription factor IIA small 12 kDa subunit (GTF2A2) pseudogene ENST00000436102.1 laminin receptor 1 (67kD, ribosomal protein SA) pseudogene ENST00000450198.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SNF2LA) ENST00000457226.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SNF2LA) ENST00000439732.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SNF2LA) ENST00000382203.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SNF2LA) ENST00000382194.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SNF2LA) ENST00000491574.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SNF2LA) ENST00000452193.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SNF2LA) ENST00000302401.3 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SNF2LA) ENST00000423555.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SNF2LA) ENST00000382186.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SNF2LA) ENST00000417599.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SNF2LA) ENST00000382185.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SNF2LA) ENST00000382183.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SNF2LA) ENST00000416751.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SNF2LA) ENST00000382182.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SNF2LA) ENST00000426860.1 putative novel transcript ENST00000416826.1 novel transcript (FLJ35024) ENST00000453601.1 novel transcript ENST00000424605.1 novel transcript ENST00000447278.1 novel transcript ENST00000445631.1 putative novel transcript ENST00000382100.2 very low density lipoprotein receptor ENST00000382096.1 very low density lipoprotein receptor ENST00000382099.2 very low density lipoprotein receptor ENST00000382092.1 very low density lipoprotein receptor ENST00000478776.1 very low density lipoprotein receptor ENST00000382082.3 voltage-gated potassium channel Kv11.1 (Kv11.1) ENST00000490444.1 novel transcript ENST00000382032.3 putative novel transcript ENST00000469168.1 putative novel transcript ENST00000452746.1 novel transcript ENST00000382004.3 regulatory factor X, 3 (influences HLA class II expression) ENST00000358730.2 regulatory factor X, 3 (influences HLA class II expression) ENST00000449234.1 regulatory factor X, 3 (influences HLA class II expression) ENST00000449234.1 this variant and variant 4 could be part of the same variant ENST00000458034.1 this variant and variant 3 could be part of the same variant ENST00000458034.1 regulatory factor X, 3 (influences HLA class II expression) ENST00000457373.1 regulatory factor X, 3 (influences HLA class II expression) ENST00000451859.1 regulatory factor X, 3 (influences HLA class II expression) ENST00000442560.1 regulatory factor X, 3 (influences HLA class II expression) ENST00000420720.1 regulatory factor X, 3 (influences HLA class II expression) ENST00000449190.1 regulatory factor X, 3 (influences HLA class II expression) ENST00000381984.2 regulatory factor X, 3 (influences HLA class II expression) ENST00000438600.1 RPL7 (ribosomal protein L7) pseudogene ENST00000423112.1 novel transcript ENST00000457566.1 putative novel transcript ENST00000430387.1 putative novel transcript ENST00000427722.1 novel transcript ENST00000438147.1 putative novel transcript ENST00000381971.3 NP_001035878.1 ENST00000474483.1 novel transcript ENST00000467497.1 novel protein ENST00000477901.1 alternative 5' UTR ENST00000478844.1 alternative 5' UTR ENST00000481827.1 alternative 5' UTR ENST00000478315.1 alternative 5' UTR ENST00000462164.1 alternative 5' UTR ENST00000498258.1 putative novel transcript ENST00000451340.2 novel transcript (MGC16153) ENST00000457383.1 putative novel transcript ENST00000440674.1 putative novel transcript ENST00000262352.3 solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 ENST00000490167.1 solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 ENST00000422398.1 solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1 ENST00000486047.1 novel transcript ENST00000223517.5 novel protein ENST00000471669.1 novel protein ENST00000429407.1 ribosomal protein S6 (RPS6) pseudogene ENST00000381858.1 novel protein ENST00000479095.1 putative novel transcript ENST00000381809.3 adenylate kinase 3 like 1 (AK3) ENST00000359883.2 adenylate kinase 3 like 1 (AK3) ENST00000402406.2 ribosomal protein S5 (RPS5) pseudogene ENST00000381750.4 RNA cyclase homolog (RNAC) ENST00000381732.3 RNA cyclase homolog (RNAC) ENST00000442869.1 RNA cyclase homolog (RNAC) ENST00000473230.1 RNA cyclase homolog (RNAC) ENST00000381730.1 RNA cyclase homolog (RNAC) ENST00000381728.1 RNA cyclase homolog (RNAC) ENST00000441844.1 RNA cyclase homolog (RNAC) ENST00000412782.1 Kruppel-like factor 4 (gut) (KLF4) pseudogene ENST00000443970.1 miR-101-precursor-9 micro RNA ENST00000445485.1 putative novel transcript ENST00000397777.2 heterogeneous nuclear ribonucleoprotein A1 (HNRPA1) pseudogene ENST00000476574.1 Janus kinase 2 (a protein tyrosine kinase) ENST00000381652.3 Janus kinase 2 (a protein tyrosine kinase) ENST00000472549.1 Janus kinase 2 (a protein tyrosine kinase) ENST00000487310.1 Janus kinase 2 (a protein tyrosine kinase) ENST00000442675.1 casein kinase pseudogene ENST00000422953.1 trans-prenyltransferase (TPT) pseudogene ENST00000448266.1 NADH dehydrogenase 6 (MTND6) pseuodgene ENST00000456661.1 NADH dehydrogenase 1 (MTND1) pseudogene ENST00000429111.1 cytochrome c oxidase I (MTCO1) pseudogene ENST00000431069.1 cytochrome c oxidase II (MTCO2) pseudogene ENST00000428071.1 ATP synthase 6 (MTATP6) pseudogene ENST00000455103.1 cytochrome c oxidase III (MTCO3) pseudogene ENST00000435799.1 NADH dehydrogenase 4 (MTND4)pseudogene ENST00000441481.1 pseudogene similar to part of NADH dehydrogenase 5 (MTND5) ENST00000423021.1 transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47) (TCF3) pseudogene ENST00000519308.1 immunoglobulin heavy constant epsilon pseudogene 2 ENST00000510407.1 novel transcript ENST00000381641.3 insulin-like 6 (RIF1) ENST00000448546.1 insulin-like 4 (placenta) (INSL4) pseudogene ENST00000239316.4 insulin-like 4 (placenta) (PLACENTIN, EPIL) ENST00000381627.3 relaxin 2 (H2) (RLXH2) (variant 1) ENST00000432430.1 high-mobility group nucleosomal binding domain 2 (HMGN2) pseudogene ENST00000412020.1 novel pseudogene ENST00000223862.1 relaxin 1 (H1) (RLXH1) ENST00000487557.1 relaxin 1 (H1) (RLXH1) ENST00000415892.1 novel pseudogene ENST00000223864.2 uncharacterized hematopoietic stem/progenitor cells protein (MDS030) ENST00000482696.1 novel transcript ENST00000472145.1 novel transcript ENST00000473877.1 novel transcript ENST00000397754.2 novel pseudogene (FLJ39176) ENST00000381577.3 B7-H1 protein (PD-L1) ENST00000474218.1 novel transcript ENST00000492923.1 novel transcript ENST00000397747.3 programmed death ligand 2 (PDL2) (PDCD1L2) ENST00000443792.1 putative novel transcript ENST00000251879.6 confirm experimentally ENST00000251879.6 novel protein (contains DKFZp434D105, KIAA1432 and FLJ12580) ENST00000414202.2 KIAA1432 ENST00000414202.2 confirm experimentally ENST00000414202.2 NP_065880.1 ENST00000414202.2 DKFZp434D105 ENST00000414202.2 FLJ12580 ENST00000545243.1 not organism-supported ENST00000426764.1 putative novel transcript ENST00000487088.1 novel protein (FLJ23309) ENST00000419465.1 adenylate kinase 3 (AK3) pseudogene ENST00000443149.2 putative novel transcript ENST00000399933.3 confirm experimentally ENST00000381461.2 confirm experimentally ENST00000540714.1 novel protein similar to K06A9.1b.p (includes FLJ34054) (KIAA2026) ENST00000513355.2 not organism-supported ENST00000381477.3 melan-A (MART-1) ENST00000381476.1 alternatively spliced 5' UTR, shares CDS with bA546N22.3.1 ENST00000381476.1 melan-A (MART-1) ENST00000381476.1 alternative 5' UTR ENST00000381471.1 alternatively spliced 5' UTR, shares CDS with bA546N22.3.1 ENST00000381471.1 melan-A (MART-1) ENST00000381471.1 alternative 5' UTR ENST00000482341.1 melan-A (MART-1) ENST00000490518.1 melan-A (MART-1) ENST00000485372.1 novel protein similar to RAN binding protein 6 (RANBP6) ENST00000437881.1 putative novel transcript ENST00000416942.1 general transcription factor IIIA (GTF3A) pseudogene ENST00000381434.3 novel protein (DVS27) ENST00000463336.1 novel transcript ENST00000445989.1 glycine cleavage system protein H (aminomethyl carrier) (GCSH) pseudogene ENST00000456723.1 selenoprotein T (LOC51714) pseudogene ENST00000381428.1 novel protein kinase (NYD-SP25) ENST00000314556.3 novel protein kinase (NYD-SP25) ENST00000468435.1 ubiquitin-like, containing PHD and RING finger domains 2 (URF2) ENST00000469298.1 non-organism_supported ENST00000276893.5 ubiquitin-like, containing PHD and RING finger domains 2 (URF2) ENST00000381373.3 ubiquitin-like, containing PHD and RING finger domains 2 (URF2) ENST00000450508.1 ubiquitin-like, containing PHD and RING finger domains 2 (URF2) ENST00000484159.1 FLJ16243 ENST00000477183.1 novel transcript ENST00000485617.1 novel transcript ENST00000479000.1 novel transcript ENST00000492853.1 novel transcript ENST00000481243.1 novel transcript ENST00000411561.1 putative novel transcript ENST00000477960.1 glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P) ENST00000467946.1 glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P) ENST00000460457.1 glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P) ENST00000463305.1 glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P) ENST00000451028.1 pseudogene similar to part of RP42 homolog ENST00000332361.5 ribosomal protein L23a (RPL23A) pseudogene ENST00000413145.1 novel transcript ENST00000435535.1 ribosomal protein S3A (RPS3A) pseudogene ENST00000442955.1 ring finger protein 2 (RNF2) pseudogene ENST00000427308.1 60S ribosomal protein L35a (RPL35A) pseudogene ENST00000412339.1 putative novel transcript ENST00000452643.1 novel transcript ENST00000451142.1 novel transcript ENST00000443688.1 novel transcript ENST00000381306.3 KIAA0780 ENST00000476075.1 non-canonical splice donor between exon 3 and 4 ENST00000496464.1 non-canonical splice donor between exon 1 and 2 ENST00000490806.1 novel transcript ENST00000414230.1 chromosome 20 open reading frame 45 (C20orf45) pseudogene ENST00000338402.5 similar to small nuclear ribonucleoprotein polypeptide E (SNRPE) ENST00000457102.1 putative novel transcript ENST00000446382.1 actin pseudogene ENST00000413888.1 ribosomal protein L4 (HRPL4) (RPL4) pseudogene ENST00000441944.1 cyclophilin pseudogene ENST00000358227.4 novel protein ENST00000484082.1 novel transcript ENST00000469050.1 novel transcript ENST00000413066.1 putative novel transcript ENST00000435444.1 putative novel transcript ENST00000486161.1 NP_569075.2 ENST00000471274.1 protein tyrosine phosphatase, receptor type, D (HPTP, PTPD, HPTPD) ENST00000481079.1 alternative 5' UTR ENST00000418571.1 putative novel transcript ENST00000391389.3 ribosomal protein 18 (RPL18) pseudogene ENST00000447950.1 putative novel transcript ENST00000430766.1 putative novel transcript ENST00000419824.1 novel transcript ENST00000449531.1 novel transcript ENST00000437701.1 ribosomal protein S12 (RPS12) pseudogene ENST00000429581.1 novel transcript ENST00000427161.1 putative novel transcript ENST00000441805.1 pseudogene similar to part of ribosomal protein S3A (RPS3A) ENST00000427532.1 novel pseudogene ENST00000434743.1 pseudogene similar to part of A kinase (PRKA) anchor protein 8 (AKAP8) ENST00000437471.1 putative novel transcript ENST00000452685.1 novel transcript ENST00000413804.1 novel pseudogene ENST00000473763.1 alternative 5' UTR ENST00000381136.2 tyrosinase-related protein 1 ENST00000473504.1 this variant and a variant 3 could be part of the same variant ENST00000473504.1 tyrosinase-related protein 1 ENST00000417638.1 novel transcript ENST00000319264.3 novel protein (FLJ38505, FLJ90271) ENST00000489107.1 putative novel transcript ENST00000449329.1 peroxiredoxin 1 (PRDX1) pseudogene ENST00000414531.1 Sjogren syndrome antigen B (autoantigen La) (SSB) pseudogene ENST00000319217.7 multiple PDZ domain protein ENST00000319217.7 not organism-supported ENST00000381017.2 multiple PDZ domain protein ENST00000438511.1 multiple PDZ domain protein ENST00000319198.6 multiple PDZ domain protein ENST00000545857.1 multiple PDZ domain protein ENST00000546205.1 not organism-supported ENST00000494251.1 multiple PDZ domain protein ENST00000442428.1 novel transcript ENST00000433817.1 inhibitor of growth family, member 1 (ING1) pseudogene ENST00000428006.1 putative novel transcript ENST00000381010.3 novel protein ENST00000449745.1 pescadillo homolog 1, containing BRCT domain (zebrafish) (PES1) pseudogene ENST00000442260.1 novel transcript ENST00000434028.1 ribosomal protein L3 (RPL3) pseudogene ENST00000396994.2 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d (ATP5H) (ATPQ, ATP5JD) pseudogene ENST00000380959.3 nuclear factor I/B (NFIB2, NRFIB3, NFI-RED) ENST00000380959.3 nuclear factor I/B (NFIB2, NFIB3, NFI-RED) ENST00000380953.1 nuclear factor I/B (NFIB2, NRFIB3, NFI-RED) ENST00000380953.1 nuclear factor I/B (NFIB2, NFIB3, NFI-RED) ENST00000397575.3 nuclear factor I/B (NFIB2, NRFIB3, NFI-RED) ENST00000397575.3 nuclear factor I/B (NFIB2, NFIB3, NFI-RED) ENST00000397581.2 nuclear factor I/B (NFIB2, NRFIB3, NFI-RED) ENST00000397581.2 nuclear factor I/B (NFIB2, NFIB3, NFI-RED) ENST00000397579.2 nuclear factor I/B (NFIB2, NRFIB3, NFI-RED) ENST00000397579.2 nuclear factor I/B (NFIB2, NFIB3, NFI-RED) ENST00000380924.1 nuclear factor I/B (NFIB2, NFIB3, NFI-RED) ENST00000380921.3 nuclear factor I/B (NFIB2, NRFIB3, NFI-RED) ENST00000380921.3 proetin translation at 3' end extended compared to that published in EM:U70862.1 ENST00000493697.1 nuclear factor I/B (NFIB2, NRFIB3, NFI-RED) ENST00000435137.1 ribosomal protein L7a (RPL7A) pseudogene ENST00000416996.1 putative novel transcript ENST00000440947.1 putative novel transcript ENST00000421119.1 pseudogene similar to part of nuclear factor I/A (NFIA) ENST00000442667.1 pseudogene similar to part of cell division cycle associated 4 (CDCA4) (HEPP, FLJ20764) ENST00000380916.3 novel protein similar to mouse 9130404H11Rik protein ENST00000497966.1 novel transcript ENST00000380911.3 cerberus 1 homolog, cysteine knot superfamily (Xenopus laevis) ENST00000380894.1 called TILRR in PMID: 19940113 ENST00000497634.1 novel protein ENST00000397561.3 lactate dehdrogenase A (LDHA) (LOC158222) pseudogene ENST00000502889.1 novel pseudogene (FLJ20543) ENST00000423965.1 pseudogene similar to part of chloride channel 3 (CLCN3) (CLC3) ENST00000512701.1 NP_689787.2 ENST00000444159.1 ribosomal protein L7 (RPL7) pseudogene ENST00000380821.3 small nuclear RNA activating complex, polypeptide 3, 50kDa (SNAP50) ENST00000467062.1 small nuclear RNA activating complex, polypeptide 3, 50kDa (SNAP50) ENST00000490969.1 small nuclear RNA activating complex, polypeptide 3, 50kDa (SNAP50) ENST00000421710.1 small nuclear RNA activating complex, polypeptide 3, 50kDa (SNAP50) ENST00000461041.1 small nuclear RNA activating complex, polypeptide 3, 50kDa (SNAP50) ENST00000380799.1 small nuclear RNA activating complex, polypeptide 3, 50kDa (SNAP50) ENST00000380733.4 PC4 and SFRS1 interacting protein 2 (LEDGF) ENST00000380738.4 PC4 and SFRS1 interacting protein 2 (LEDGF) ENST00000380715.1 PC4 and SFRS1 interacting protein 2 ENST00000380716.4 PC4 and SFRS1 interacting protein 2 (p52) ENST00000481862.1 PC4 and SFRS1 interacting protein 2 (LEDGF) ENST00000495873.1 PC4 and SFRS1 interacting protein 2 (LEDGF) ENST00000487363.1 PC4 and SFRS1 interacting protein 2 ENST00000463712.1 PC4 and SFRS1 interacting protein 2 ENST00000488797.1 PC4 and SFRS1 interacting protein 2 ENST00000484265.1 PC4 and SFRS1 interacting protein 2 ENST00000432137.1 ferritin heavy polypeptide 1 (FTH1) pseudogene ENST00000474193.1 novel transcript ENST00000449575.1 novel protein (FLJ39267) ENST00000470191.1 novel transcript ENST00000498725.1 novel transcript ENST00000486641.1 novel transcript ENST00000472806.1 novel transcript ENST00000478913.1 putative novel transcript ENST00000443838.1 putative novel transcript ENST00000380685.1 novel protein ENST00000357468.2 alternatively spliced in 5' UTR, shares CDS with Em:AL513424.1.1 ENST00000357468.2 novel protein ENST00000357468.2 alternative 5' UTR ENST00000380683.1 novel protein ENST00000433347.1 novel protein ENST00000484726.1 novel protein similar to basonuclin (BNC) (FLJ34928) ENST00000411752.1 novel protein ENST00000380667.1 Made from mouse cDNA. ENST00000451290.1 novel transcript ENST00000471301.1 novel transcript ENST00000468187.1 novel transcript ENST00000430640.1 putative novel transcript ENST00000439447.1 putative novel transcript ENST00000450445.1 novel transcript ENST00000438629.1 LSM1 homolog, U6 small nuclear RNA associated (S. cerevisiae) pseudogene ENST00000430545.1 putative novel transcript ENST00000456717.1 ribosomal protein S29 (RPS29) pseudogene ENST00000435405.1 ribosomal protein L31 (RPL31) pseudogene ENST00000484374.1 novel transcript ENST00000461247.1 novel transcript ENST00000455403.1 CGI-51 protein pseudogene ENST00000467085.1 SH3-domain GRB2-like 2 (CNSA2, SH3P4, EEN-B1, SH3D2A) ENST00000380607.4 SH3-domain GRB2-like 2 (CNSA2, SH3P4, EEN-B1, SH3D2A) ENST00000428966.1 poly(A)-binding protein pseudogene ENST00000443359.1 putative novel transcript ENST00000380548.4 confirm experimentally ENST00000380570.4 not organism-supported ENST00000276935.5 confirm experimentally ENST00000380559.3 not organism-supported ENST00000542621.1 FLJ35283 ENST00000489062.2 FLJ46891 ENST00000412709.1 ras-related protein family pseudogene ENST00000380534.4 novel protein similar to mouse RIKEN cDNA 4930500O09 gene ENST00000380530.1 novel protein similar to mouse RIKEN cDNA 4930500O09 gene ENST00000441073.1 proteasome (prosome, macropain) 26S subunit, ATPase, 3 (PSMC3) (TBP1) pseudogene ENST00000380502.3 novel protein (FLJ20060) (contains FLJ12902, KIAA1574) ENST00000380496.1 novel protein (FLJ20060) (contains FLJ12902, KIAA1574) ENST00000276914.2 adipose differentiation-related protein (ADRP) ENST00000434144.1 alternatively splice 5' UTR, CDS as bA151J10.2.1, but only partial ENST00000434144.1 alternative 5' UTR ENST00000434144.1 adipose differentiation-related protein (ADRP) ENST00000380465.3 adipose differentiation-related protein (ADRP) ENST00000380464.3 adipose differentiation-related protein (ADRP) ENST00000475923.1 adipose differentiation-related protein (ADRP) ENST00000472715.1 adipose differentiation-related protein (ADRP) ENST00000494753.1 adipose differentiation-related protein (ADRP) ENST00000464326.1 adipose differentiation-related protein (ADRP) ENST00000397390.3 ribosomal protein S6 (RPS6) pseudogene ENST00000434457.1 novel pseudogene ENST00000494124.1 non-canonical donor splice site at 4th exon ENST00000494124.1 novel transcript ENST00000380432.1 novel protein ENST00000380427.1 novel protein (FLJ20686) ENST00000361024.2 novel protein (FLJ20686) ENST00000380424.1 novel protein (FLJ20686) ENST00000417577.1 putative novel transcript ENST00000380394.4 ribosomal protein S6 ENST00000498815.1 ribosomal protein S6 ENST00000380384.1 ribosomal protein S6 ENST00000315377.4 ribosomal protein S6 ENST00000380381.3 ribosomal protein S6 ENST00000449348.1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5, 13kDa (NDUFA5) (NUFM, FLJ12147)pseudogene ENST00000340967.2 novel protein, possible ortholog of mouse cancer related gene-liver 1(CRG-L1) ENST00000417653.1 microtubule-associated protein pseudogene ENST00000341998.1 solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 (NCKX2) ENST00000286344.3 solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 (NCKX2) ENST00000446114.1 pseudogene similar to part of a novel gene. ENST00000414056.1 survival of motor neuron 1, telomeric (SMN1) pseudogene ENST00000380338.4 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9) ENST00000380338.4 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3,(AF9) ENST00000380323.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9) ENST00000380323.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3,(AF9) ENST00000469261.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3,(AF9) ENST00000488705.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3,(AF9) ENST00000380321.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); variant 4 ENST00000380321.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3,(AF9) ENST00000468513.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3,(AF9) ENST00000491137.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3,(AF9) ENST00000475957.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3,(AF9) ENST00000444895.1 ribosomal protein L7a (RPL7A) pseudogene ENST00000439876.1 putative novel transcript ENST00000445051.1 putative novel transcript ENST00000495827.1 novel protein, possible otholog of mouse RIKEN cDNA 4933428I03 gene ENST00000488436.1 novel transcript ENST00000429219.1 interferon, beta 1, fibroblast (IFNB1) pseudogene ENST00000453148.1 interferon, omega 1 (IFNW1) pseudogene ENST00000380225.1 interferon, alpha 21 ENST00000442022.1 interferon, omega 1 (IFNW1) pseudogene ENST00000448683.1 interferon, omega 1 (IFNW1) pseudogene ENST00000239347.3 interferon, alpha 7 ENST00000357374.2 interferon, alpha 10 ENST00000437472.1 interferon, omega 1 (IFNW1) pseudogene ENST00000380216.1 interferon, alpha 16 ENST00000413767.2 interferon, alpha 17 ENST00000445100.1 interferon, omega 1 (IFNW1) pseudogene ENST00000458710.1 interferon pseudogene ENST00000436840.1 interferon pseudogene ENST00000359039.4 novel protein (KIAA1354) (FLJ13568) ENST00000380210.1 interferon, alpha 6 ENST00000446352.1 interferon pseudogene ENST00000413147.1 interferon alpha pseudogene ENST00000380205.1 interferon, alpha 8 ENST00000431203.1 interferon, omega 1 (IFNW1) pseudogene ENST00000438727.1 interferon pseudogene ENST00000304425.3 novel transcript ENST00000424386.1 histone H3 pseudogene ENST00000427983.1 pseudogene similar to part of KH-type splicing regulatory protein (FUSE binding protein 2) (KHSRP) ENST00000380172.3 methylthioadenosine phosphorylase (MSAP) ENST00000460874.1 methylthioadenosine phosphorylase (MSAP) ENST00000484957.1 methylthioadenosine phosphorylase (MSAP) ENST00000427788.1 putative novel transcript ENST00000447235.1 pseudogene similar to part of beta tubulin ENST00000530628.1 NMD exception ENST00000479692.1 ) ENST00000470819.1 cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4) ENST00000428597.1 based on antisense RNA DQ485453 ENST00000422420.1 putative novel transcript ENST00000276925.5 cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) ENST00000380142.4 cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4) ENST00000399822.2 ubiquitin A-52 residue ribosomal protein fusion product 1 (UBA52) (RPL40) pseudogene ENST00000435092.1 putative novel transcript ENST00000325870.1 DMRT-like family A1 (DMO) ENST00000436786.1 novel transcript ENST00000433645.1 novel transcript ENST00000453177.1 pseudogene similar to part of chloride intracellular channel 4 (CLIC4) ENST00000448570.1 putative novel transcript ENST00000456482.1 SMT3 suppressor of mif two 3 homolog 2 (yeast) (SMT3H2) pseudogene ENST00000440888.1 putative novel transcript ENST00000447491.1 pseudogene similar to part of nucleolar protein 5A (56kDa with KKE/D repeat) (NOL5A) (NOP56) ENST00000223951.5 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) (HUB, HELN1) ENST00000380117.1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) (HUB, HELN1) ENST00000359598.4 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) (HUB, HELN1) ENST00000423281.1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) (HUB, HELN1) ENST00000440102.1 alternatively spliced 5' UTR, shares CDS with bA31K16.2.1 (partial) ENST00000440102.1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) (HUB, HELN1) ENST00000440102.1 alternative 5' UTR ENST00000440102.1 alternatively spliced 5' UTR, shares CDS with Em:AL445623.4.1 (partial) ENST00000462649.1 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) (HUB, HELN1) ENST00000457037.1 non-canonical donor splice site at 3rd exon ENST00000457037.1 novel transcript ENST00000423440.1 novel transcript ENST00000446754.1 putative novel transcript ENST00000412335.1 novel protein ENST00000423326.1 putative novel transcript ENST00000333916.5 novel protein (FLJ13657) ENST00000520187.1 not organism-supported ENST00000495958.1 probable NMD candidate ENST00000397292.3 phospholipase A2-activating protein (PLAP) ENST00000520641.1 not organism-supported ENST00000519968.1 alternative 5' UTR ENST00000517444.1 alternative 5' UTR ENST00000380062.5 capillary morphogenesis protein 1(CMG1) (CMG-1, FLJ22621) ENST00000518614.1 non-canonical donor splice site between exons 5 and 6 ENST00000429045.2 CCDS47955.1 ENST00000429045.2 NP_001092694.1 ENST00000456198.1 putative novel transcript ENST00000380036.4 tyrosine kinase, endothelial (venous malformations, multiple cutaneous and mucosal) (TIE2, VMCM, TIE-2, VMCM1) ENST00000380031.1 chromosome 9 open reading frame 11 ENST00000484994.1 chromosome 9 open reading frame 11 ENST00000262244.5 novel protein (FLJ13204) ENST00000443737.1 novel protein ENST00000448858.1 novel transcript ENST00000380003.3 novel protein, includes FLJ25077 and FLJ11109 (MGC23980) ENST00000488117.1 novel protein ENST00000379997.3 novel protein (FLJ25077) ENST00000379995.1 alternative 5' UTR ENST00000379995.1 novel protein (FLJ25077) ENST00000379995.1 alternatively spliced 5' UTR shares CDS with bA27J8.2.3 ENST00000461679.1 novel protein ENST00000400348.2 meningioma expressed antigen 6 (coiled-coil proline-rich) (MGEA6) pseudogene ENST00000379992.1 novel protein (FLJ31810) ENST00000493941.1 novel protein (FLJ31810) ENST00000478520.1 novel pseudogene (FLJ37424) ENST00000434203.1 pseudogene similar to part of tumor necrosis factor, alpha-induced protein 1 (endothelial) (TNFAIP1) (EDP1) ENST00000450912.1 NHP2 non-histone chromosome protein 2-like 1 (S. cerevisiae) (NHP2L1) pseudogene ENST00000458047.1 pseudogene similar to part of non-metastatic cells 4, protein expressed in (NME4) ENST00000426028.1 malic enzyme pseudogene ENST00000419995.1 pseudogene similar to part of solute carrier family 4 (anion exchanger), member 1, adaptor protein (SLC4A1AP) ENST00000438438.1 CMT1A duplicated region transcript 15 (CDRT15) pseudogene ENST00000430671.1 novel pseudogene ENST00000434705.1 RNA binding motif protein, X chromosome (RBMX) (HNRPG) pseudogene ENST00000452970.1 keratin 18 (KRT18) (CYK18, K18) pseudogene ENST00000411618.1 keratin 18 (KRT18) (CYK18, K18) pseudogene ENST00000430740.1 ferritin, light polypeptide-like pseudogene ENST00000427029.1 heat shock cognate 71 KDA protein pseudogene ENST00000455940.1 pseudogene similar to part of a novel protein (KIAA1688) ENST00000497974.1 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (SLC25A6) (ANT3) pseudogene ENST00000443540.1 ATPase synthase 6 (MTATP6) pseudogene ENST00000426425.1 cytochrome c oxidase III (MTCO3) (COIII) pseudogene ENST00000414981.1 high-mobility group protein pseudogene ENST00000422717.1 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 (SLC25A5) (ANT2) pseudogene ENST00000309951.5 aconitase 1, soluble ENST00000379923.1 aconitase 1, soluble ENST00000379923.1 alternatively spliced 5' UTR, shares CDS with bA334P12.1.1 ENST00000379923.1 alternative 5' UTR ENST00000379921.1 aconitase 1, soluble ENST00000379921.1 Non-canonical splice site at final exon. ENST00000379883.2 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide (RIG-I), ENST00000360538.2 tumor protein p53-binding protein (TP53BPL) ENST00000379858.1 tumor protein p53-binding protein (TP53BPL) ENST00000453396.1 novel protein ENST00000450093.1 novel transcript ENST00000458036.1 novel transcript ENST00000425533.1 novel transcript ENST00000379847.3 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa (B17) ENST00000350021.2 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 6, 17kDa (B17) ENST00000433250.1 DNA fragmentation factor, 40kDa, beta polypeptide (caspase-activated DNase) (DFFB) (CAD, CPAN, DFF40) pseudogene ENST00000451672.1 novel protein (FLJ25547) ENST00000430787.1 novel transcript ENST00000413291.1 putative novel transcript ENST00000433292.1 heterogeneous nuclear ribonucleoprotein C (C1/C2) (HNRPC) pseudogene ENST00000424561.1 ribosomal protein S11 (RPS11) pseudogene ENST00000448273.1 pseudogene similar to part of membrane guanylyl cyclase ENST00000424177.1 putative novel transcript ENST00000418151.1 novel pseudogene ENST00000452496.1 argininosuccinate synthetase (ASS) (CTLN1) pseudogene ENST00000379825.2 NP_778239.1 ENST00000463596.1 alternative 5' UTR ENST00000415066.1 transcription elongation factor A (SII), 1 pseudogene (GTF2SP) ENST00000425356.1 cancer/testis antigen 1 (CTAG1) (LAGE2B) pseudogene ENST00000495015.1 DnaJ (Hsp40) homolog, subfamily A, member 1 ENST00000465677.1 DnaJ (Hsp40) homolog, subfamily A, member 1 ENST00000379731.4 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 (GGTB2) ENST00000442432.1 putative novel transcript ENST00000426270.1 putative novel transcript ENST00000379725.1 serine protease inhibitor, Kazal type 4 (PEC-60) ENST00000379721.3 serine protease inhibitor, Kazal type 4 (PEC-60) ENST00000493917.1 BCL2-associated athanogene ENST00000473464.1 continued from bA344B24.1.5 in Em:AL356472 ENST00000473464.1 BCL2-associated athanogene ENST00000223500.7 novel protein (HSPC177) ENST00000487080.1 novel transcript ENST00000379540.3 nuclear transcription factor, X-box binding 1 ENST00000379521.4 nuclear transcription factor, X-box binding 1 ENST00000466359.1 nuclear transcription factor, X-box binding 1 ENST00000466971.1 nuclear transcription factor, X-box binding 1 ENST00000463421.1 nuclear transcription factor, X-box binding 1 ENST00000379507.3 aquaporin 7 ENST00000447660.1 aquaporin 7 ENST00000297988.1 aquaporin 7 ENST00000481906.1 aquaporin 7 ENST00000439678.1 aquaporin 7 ENST00000379506.3 aquaporin 7 ENST00000379503.4 aquaporin 7 ENST00000297991.4 aquaporin 3 ENST00000494193.1 aquaporin 3 ENST00000494313.1 aquaporin 3 ENST00000473153.1 aquaporin 3 ENST00000290943.6 KIAA2015 ENST00000484634.1 novel protein similar to KIAA1074 ENST00000357927.3 KIAA1074 ENST00000379435.3 novel immunoglobulin domain containing protein ENST00000379435.3 TRBV20/OR9-2*01 allele ENST00000331828.4 TRBV21/OR9-2*01 allele ENST00000331828.4 novel immunoglobulin domain containing protein ENST00000390389.3 TRBV23/OR9-2*01 allele ENST00000390389.3 novel protein similar to T-cell receptor beta chain V region proteins ENST00000416632.1 TRBV24/OR9-2*03 allele which is a pseudogene ENST00000438417.1 TRBV25/OR9-2*01 ENST00000438417.1 T cell receptor beta variable 25/OR9-2 ENST00000468152.1 protease, serine, 3 (mesotrypsin) ENST00000361005.5 protease, serine, 3 (mesotrypsin) ENST00000457896.1 protease, serine, 3 (mesotrypsin) ENST00000379405.3 protease, serine, 3 (mesotrypsin) ENST00000477653.1 protease, serine, 3 (mesotrypsin) ENST00000495682.1 protease, serine, 3 (mesotrypsin) ENST00000263228.3 Ubiquitin-conjugating enzyme (UBC3B) ENST00000379225.1 Posssible SNP in exon 1 at base 311 in Em:AY358682.1 from a to g. This thus has a different translation from that in TR:Q6UWR4. ENST00000361264.3 novel protein, variant 1 (DKFZP434O125, KIAA1892, FLJ20347) ENST00000466402.1 putative novel transcript ENST00000396990.2 novel protein ENST00000450964.1 novel protein ENST00000463286.1 novel transcript ENST00000359544.2 alternatively spliced 5' UTR, shares CDS with bA571F15.1.1 ENST00000359544.2 alternative 5' UTR ENST00000439099.1 ribosomal protein L35A (RPL35A) pseudogene ENST00000372214.3 ribosomal protein S8 (RPS8) pseudogene ENST00000419794.1 serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)(SERPINH1) pseudogene ENST00000379158.1 alternatively spliced 5' UTR; shares CDS with objects bA573M23.1.2 to bA573M23.1.4 ENST00000379158.1 nudix (nucleoside diphosphate linked moiety X)-type motif 2 (APAH1) ENST00000379158.1 alternative 5' UTR ENST00000346365.4 alternatively spliced 5' UTR; shares CDS with bA573M23.1.1, bA573M23.1.3 and bA573M23.1.4 ENST00000346365.4 nudix (nucleoside diphosphate linked moiety X)-type motif 2 (APAH1) ENST00000346365.4 alternative 5' UTR ENST00000379155.5 nudix (nucleoside diphosphate linked moiety X)-type motif 2 (APAH1) ENST00000379155.5 alternatively spliced 5' UTR; shares CDS with bA573M23.1.1, bA573M23.1.2 and bA573M23.1.4 ENST00000379155.5 alternative 5' UTR ENST00000379154.1 alternatively spliced 5' UTR; shares CDS with objects bA573M23.1.1 to bA573M23.1.3 ENST00000379154.1 nudix (nucleoside diphosphate linked moiety X)-type motif 2 (APAH1) ENST00000379154.1 alternative 5' UTR ENST00000297625.7 novel glycoprotein (KIAA1161) ENST00000379142.2 novel glycoprotein ENST00000379089.1 chromosome 9 open reading frame 25 (FLJ39031) ENST00000379087.1 chromosome 9 open reading frame 25 (FLJ39031) ENST00000379084.1 chromosome 9 open reading frame 25 (FLJ39031) ENST00000379081.1 chromosome 9 open reading frame 25 (FLJ39031) ENST00000379080.1 chromosome 9 open reading frame 25 (FLJ39031) ENST00000422409.1 chromosome 9 open reading frame 25 (FLJ39031) ENST00000379078.1 chromosome 9 open reading frame 25 (FLJ39031) ENST00000470982.1 this variant fragment and one or more of variant fragments bA296L22.2.5 to bA296L22.2.8 could be part of a single variant ENST00000470982.1 dynein, axonemal, intermediate polypeptide 1 (ICS, PCD, CILD1, dynein, axonemal, intermediate chain 1) ENST00000242317.4 dynein, axonemal, intermediate polypeptide 1 (ICS, PCD, CILD1, dynein, axonemal, intermediate chain 1) ENST00000437363.1 this variant fragment and one or more of variant fragments bA296L22.2.5 to bA296L22.2.7 could be part of a single variant ENST00000437363.1 dynein, axonemal, intermediate polypeptide 1 (ICS, PCD, CILD1, dynein, axonemal, intermediate chain 1) ENST00000488369.1 this variant fragment and one or more of variant fragments bA296L22.2.5 to bA296L22.2.7 could be part of a single variant ENST00000488369.1 dynein, axonemal, intermediate polypeptide 1 (ICS, PCD, CILD1, dynein, axonemal, intermediate chain 1) ENST00000488790.1 this variant fragment and one or more of variant fragments bA296L22.2.3 or bA296L22.2.5 to bA296L22.2.7 could be part of a single variant ENST00000488790.1 dynein, axonemal, intermediate polypeptide 1 (ICS, PCD, CILD1, dynein, axonemal, intermediate chain 1) ENST00000470169.1 this variant fragment and one or more of variant fragments bA296L22.2.8 or bA296L22.2.2 to bA296L22.2.4 could be part of a single variant ENST00000470169.1 dynein, axonemal, intermediate polypeptide 1 (ICS, PCD, CILD1, dynein, axonemal, intermediate chain 1) ENST00000442556.1 this variant fragment and one or more of variant fragments bA296L22.2.8 or bA296L22.2.2 to bA296L22.2.4 could be part of a single variant ENST00000442556.1 dynein, axonemal, intermediate polypeptide 1 (ICS, PCD, CILD1, dynein, axonemal, intermediate chain 1) ENST00000485580.1 this variant fragment and one or more of variant fragments bA296L22.2.8 or bA296L22.2.2 to bA296L22.2.4 could be part of a single variant ENST00000485580.1 dynein, axonemal, intermediate polypeptide 1 (ICS, PCD, CILD1, dynein, axonemal, intermediate chain 1) ENST00000378980.3 alternatively spliced 5' UTR; shares CDS with bA296L22.3.2 ENST00000378980.3 alternative 5' UTR ENST00000378980.3 ciliary neurotrophic factor receptor ENST00000351266.4 alternatively spliced 5' UTR; shares CDS with bA296L22.3.1 ENST00000351266.4 alternative 5' UTR ENST00000351266.4 ciliary neurotrophic factor receptor ENST00000417345.1 alternatively spliced 5' UTR; shares partial CDS with bA296L22.3.1 and bA296L22.3.2 ENST00000417345.1 alternative 5' UTR ENST00000417345.1 ciliary neurotrophic factor receptor ENST00000472418.1 dynactin 3 (p22) ENST00000479399.1 dynactin 3 (p22) ENST00000421919.1 dynactin 3 (p22) ENST00000259632.7 dynactin 3 (p22) ENST00000341694.2 dynactin 3 (p22) ENST00000477738.1 non-canonical splice site at 3rd exon (ttt) ENST00000477738.1 dynactin 3 (p22) ENST00000481438.1 dynactin 3 (p22) ENST00000472074.1 dynactin 3 (p22) ENST00000378913.1 dynactin 3 (p22) ENST00000378911.3 dynactin 3 (p22) ENST00000378892.1 sigma receptor (SR31747 binding protein 1) ENST00000353468.4 sigma receptor (SR31747 binding protein 1) ENST00000277010.4 sigma receptor (SR31747 binding protein 1) ENST00000476705.1 sigma receptor (SR31747 binding protein 1) ENST00000461426.1 sigma receptor (SR31747 binding protein 1) ENST00000497006.1 sigma receptor (SR31747 binding protein 1) ENST00000478146.1 sigma receptor (SR31747 binding protein 1) ENST00000554638.1 galactose-1-phosphate uridylytransferase ENST00000555003.1 alternative 5' UTR ENST00000555247.1 not organism-supported ENST00000441545.2 alternative 5' UTR ENST00000556792.1 alternative 5' UTR ENST00000556531.1 alternative 5' UTR ENST00000555981.1 alternative 5' UTR ENST00000466082.1 interleukin 11 receptor, alpha ENST00000311925.2 small inducible cytokine subfamily A (Cys-Cys), member 19 ENST00000485502.1 small inducible cytokine subfamily A (Cys-Cys), member 19 ENST00000378800.3 small inducible cytokine subfamily A (Cys-Cys), member 19 ENST00000259607.2 small iducible cytokine subfamily A (Cys-Cys), member 21 ENST00000378792.1 small iducible cytokine subfamily A (Cys-Cys), member 21 ENST00000419383.1 novel pseudogene ENST00000324731.6 glutamate-ammonia ligase (glutamine synthase) (GLUL) (GLNS) pseudogene ENST00000399764.2 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (YWHAZ) (KCIP-1) pseudogene ENST00000476115.1 novel protein (KIAA1045) ENST00000242315.3 novel protein (KIAA1045) ENST00000440503.1 putative novel transcript ENST00000453597.3 DnaJ (Hsp40) homolog, subfamily B, member 5 (Hsc40) ENST00000538278.1 DnaJ (Hsp40) homolog, subfamily B, member 5 (Hcs40) ENST00000469798.1 DnaJ (Hsp40) homolog, subfamily B, member 5 (Hcs40) ENST00000541010.1 not organism-supported ENST00000541010.1 alternative 5' UTR ENST00000454002.2 NP_001128477.1 ENST00000454002.2 DnaJ (Hsp40) homolog, subfamily B, member 5 (Hcs40) ENST00000545841.1 not organism-supported ENST00000443266.1 DnaJ (Hsp40) homolog, subfamily B, member 5 (Hcs40) ENST00000443266.1 alternative 5' UTR ENST00000417620.1 GCIP-interacting protein p29 (DKFZP564O2082) pseudogene ENST00000421362.2 confirm experimentally ENST00000421362.2 NP_001035502.1 ENST00000354479.5 confirm experimentally ENST00000354479.5 NP_001035501.1 ENST00000417448.1 alternative 5' UTR ENST00000448890.1 alternative 5' UTR ENST00000298004.5 phosphatidylinositol glycan class O (PIGO) ENST00000474436.1 novel transcript ENST00000378617.3 phosphatidylinositol glycan class O (PIGO) ENST00000465745.1 novel transcript ENST00000472208.1 novel transcript ENST00000431804.1 putative novel transcript ENST00000467919.1 stomatin (EPB72)-like 2 (SLP-2) ENST00000356493.5 stomatin (EPB72)-like 2 (SLP-2) ENST00000488050.1 stomatin (EPB72)-like 2 (SLP-2) ENST00000487490.1 stomatin (EPB72)-like 2 (SLP-2) ENST00000378566.1 novel protein (KIAA1539) (FLJ11560) ENST00000322813.5 alternatively spliced 5' UTR, shares CDS with bA182N22.6.1 ENST00000322813.5 novel protein (KIAA1539) (FLJ11560) ENST00000322813.5 alternative 5' UTR ENST00000378561.1 novel protein (KIAA1539) (FLJ11560) ENST00000378557.1 alternatively spliced 5' UTR, shares CDS with bA182N22.6.1 ENST00000378557.1 novel protein (KIAA1539) (FLJ11560) ENST00000378557.1 alternative 5' UTR ENST00000378554.1 novel protein (KIAA1539) (FLJ11560) ENST00000378554.1 non-canonical donor splice site in 7th exon ENST00000488109.1 novel transcript ENST00000439134.1 zinc finger protein pseudogene ENST00000396787.1 unc-13-like (C. elegans) (hmunc13) ENST00000396787.1 unc-13-like (C. elegans) (MUNC13, hmunc13) ENST00000378495.3 unc-13-like (C. elegans) (hmunc13) ENST00000378495.3 unc-13-like (C. elegans) (MUNC13, hmunc13) ENST00000485086.1 unc-13-like (C. elegans) (MUNC13, hmunc13) ENST00000481299.1 unc-13-like (C. elegans) (MUNC13, hmunc13) ENST00000329395.8 novel transcript ENST00000430846.1 novel transcript ENST00000449009.1 novel transcript ENST00000434138.1 protein associated with PRK1 (AWP1) pseudogene ENST00000361226.3 novel protein (KIAA0375) ENST00000468041.1 novel transcript ENST00000450395.1 ribosomal protein L36a (L44L, RPL44) (RPL36A) pseudogene ENST00000492890.1 novel transcript ENST00000480287.1 novel transcript ENST00000478246.1 novel transcript ENST00000430795.1 ribosomal protein S29 (RPS29) pseudogene ENST00000336395.5 testis-specific kinase 1 ENST00000498522.1 testis-specific kinase 1 ENST00000467424.1 testis-specific kinase 1 ENST00000463897.1 testis-specific kinase 1 ENST00000480077.1 testis-specific kinase 1 ENST00000396757.1 CD72 antigen (LYB2) ENST00000490239.1 CD72 antigen (LYB2) ENST00000463720.1 CD72 antigen (LYB2) ENST00000477364.1 CD72 antigen (LYB2) ENST00000378431.1 CD72 antigen (LYB2) ENST00000465754.1 CD72 antigen (LYB2) ENST00000470387.1 CD72 antigen (LYB2) ENST00000482121.1 CD72 antigen (LYB2) ENST00000378430.3 CD72 antigen (LYB2) ENST00000457044.1 putative novel transcript ENST00000428948.1 putative novel transcript ENST00000259608.3 SHP2 interacting transmembrane adaptor (SIT) ENST00000486859.1 SHP2 interacting transmembrane adaptor (SIT) ENST00000474403.1 SHP2 interacting transmembrane adaptor (SIT) ENST00000378407.3 novel protein (MGC31967) ENST00000378406.1 novel protein (MGC31967) ENST00000426546.2 novel protein (MGC31967) ENST00000327351.2 novel protein (MGC31967) ENST00000421582.2 novel protein (MGC31967) ENST00000490638.1 novel protein (FLJ14642) ENST00000475323.1 novel protein (FLJ14642) ENST00000378387.3 novel protein (FLJ14642) ENST00000490970.1 novel transcript ENST00000488918.1 novel transcript ENST00000468876.1 novel transcript ENST00000378357.4 carbonic anhydrase IX (MN) ENST00000493245.1 carbonic anhydrase IX (MN) ENST00000485665.1 carbonic anhydrase IX (MN) ENST00000378300.5 tropomyosin 2 (beta) (DA1, TMSB, AMCD1) ENST00000378292.3 tropomyosin 2 (beta) (DA1, TMSB, AMCD1) ENST00000329305.2 tropomyosin 2 (beta) (DA1, TMSB, AMCD1) ENST00000360958.2 tropomyosin 2 (beta) (DA1, TMSB, AMCD1) ENST00000471212.1 tropomyosin 2 (beta) (DA1, TMSB, AMCD1) ENST00000486018.1 tropomyosin 2 (beta) (DA1, TMSB, AMCD1) ENST00000489255.1 talin 1 (TLN, KIAA1027) ENST00000464379.1 talin 1 (TLN, KIAA1027) ENST00000486788.1 talin 1 (TLN, KIAA1027) ENST00000495712.1 talin 1 ENST00000353704.2 cAMP responsive element binding protein 3 (luman) (LZIP, LUMAN, MGC15333, MGC19782) ENST00000486056.1 cAMP responsive element binding protein 3 (luman) (LZIP, LUMAN, MGC15333, MGC19782) ENST00000378103.3 glucosidase, beta (bile acid) 2 (AD035, KIAA1605, MGC16895, DKFZp762K054) ENST00000378088.1 glucosidase, beta (bile acid) 2 (AD035, KIAA1605, MGC16895, DKFZp762K054) ENST00000378094.4 glucosidase, beta (bile acid) 2 (AD035, KIAA1605, MGC16895, DKFZp762K054) ENST00000467252.1 glucosidase, beta (bile acid) 2 (AD035, KIAA1605, MGC16895, DKFZp762K054) ENST00000486797.1 glucosidase, beta (bile acid) 2 (AD035, KIAA1605, MGC16895, DKFZp762K054) ENST00000488292.1 glucosidase, beta (bile acid) 2 (AD035, KIAA1605, MGC16895, DKFZp762K054) ENST00000485259.1 glucosidase, beta (bile acid) 2 (AD035, KIAA1605, MGC16895, DKFZp762K054) ENST00000489025.1 glucosidase, beta (bile acid) 2 ENST00000414286.1 putative novel transcript ENST00000425499.1 putative novel transcript ENST00000431981.1 putative novel transcript ENST00000340291.2 NP_758516.1 ENST00000489063.1 sperm associated antigen 8 (SMP1, BS-84, HSD-1, hSMP-1, MGC26201) ENST00000396638.2 NP_001034681.1 ENST00000490578.1 Histidine triad nucleotide binding protein 2 ENST00000472085.1 Histidine triad nucleotide binding protein 2 ENST00000259667.5 Histidine triad nucleotide binding protein 2 ENST00000474908.1 Histidine triad nucleotide binding protein 2 ENST00000471774.1 Histidine triad nucleotide binding protein 2 ENST00000461169.1 Histidine triad nucleotide binding protein 2 ENST00000474848.1 Histidine triad nucleotide binding protein 2 ENST00000377991.4 novel protein ENST00000464519.1 NAG-5 protein (LOC51754) ENST00000473947.1 NAG-5 protein (LOC51754) ENST00000472010.1 NAG-5 protein (LOC51754) ENST00000490199.2 NAG-5 protein (LOC51754) ENST00000377984.2 alternative 5' UTR ENST00000472182.1 alternative 5' UTR ENST00000417104.1 olfactory receptor pseudogene ENST00000417104.1 unitary_pseudogene ENST00000436704.1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 5,13kDa (B13, NUFM, UQOR13, FLJ12147, CI-13KD-B) (NDUFA5) pseudogene ENST00000443779.1 novel transcript ENST00000433838.1 putative novel transcript ENST00000436071.1 phosphoglycerate mutase 1 (brain) (PGAMA) (PGAM1) psueodgene ENST00000341959.2 olfactory receptor family 2 subfamily S member 2 ENST00000444752.1 nuclease sensitive element binding protein 1 (YB1, BP-8, CSDB, DBPB, YB-1, YBX1, NSEP-1, MDR-NF1) (NSEP1) pseudogene ENST00000433495.1 seven transmembrane helix receptor pseudogene ENST00000424348.1 seven transmembrane helix receptor pseudogene ENST00000447226.1 seven transmembrane helix receptor pseudogene ENST00000422137.1 pseudogene similar to part of a seven transmembrane helix receptor ENST00000377966.3 reversion-inducing-cysteine-rich protein with kazal motifs (ST15, hRECK) ENST00000475774.1 reversion-inducing-cysteine-rich protein with kazal motifs (ST15, hRECK) ENST00000479053.1 reversion-inducing-cysteine-rich protein with kazal motifs (ST15, hRECK) ENST00000497814.1 chromosome 9 open reading frame 19 (GAPR-1, GLIPR2) ENST00000377959.1 chromosome 9 open reading frame 19 (GAPR-1, GLIPR2) ENST00000377960.4 chromosome 9 open reading frame 19 (GAPR-1, GLIPR2) ENST00000474050.1 chromosome 9 open reading frame 19 (GAPR-1, GLIPR2) ENST00000345519.5 clathrin, light polypeptide (LCA) ENST00000242285.6 clathrin, light polypeptide (LCA) ENST00000377902.4 UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase (NM, DMRV, IBM2, GLCNE)(GNE) ENST00000396594.3 NP_001121699.1 ENST00000433260.1 high-mobility group box pseudogene ENST00000417311.1 putative novel transcript ENST00000426015.1 putative novel transcript ENST00000259605.6 ring finger protein 38 ENST00000353739.4 ring finger protein 38 ENST00000377870.1 ring finger protein 38 ENST00000491349.1 ring finger protein 38 ENST00000484621.1 ring finger protein 38 ENST00000488058.1 ring finger protein 38 ENST00000489766.1 maternal embryonic leucine zipper kinase (KIAA0175) ENST00000495529.1 maternal embryonic leucine zipper kinase (KIAA0175) ENST00000487398.1 maternal embryonic leucine zipper kinase (KIAA0175) ENST00000480021.1 maternal embryonic leucine zipper kinase (KIAA0175) ENST00000354277.4 ribosomal protein L32 (RPL32) pseudogene ENST00000426358.1 putative novel transcript ENST00000429493.1 novel transcript ENST00000430809.1 novel transcript ENST00000426946.1 putative novel transcript ENST00000336755.5 novel protein (FLJ22611) ENST00000322831.6 novel protein (FLJ22611) ENST00000461038.1 novel transcript ENST00000488607.1 novel transcript ENST00000463625.1 novel transcript ENST00000497924.1 novel transcript ENST00000481507.1 novel transcript ENST00000496099.1 novel transcript ENST00000470185.1 novel transcript ENST00000404812.2 ribosomal protein L21 (RPL21) pseudogene ENST00000452923.1 putative novel transcript ENST00000493368.1 glyoxylate reductase/hydroxypyruvate reductase ENST00000377824.3 glyoxylate reductase/hydroxypyruvate reductase ENST00000318158.6 glyoxylate reductase/hydroxypyruvate reductase ENST00000460882.1 glyoxylate reductase/hydroxypyruvate reductase ENST00000487399.1 glyoxylate reductase/hydroxypyruvate reductase ENST00000491488.1 glyoxylate reductase/hydroxypyruvate reductase ENST00000497693.1 glyoxylate reductase/hydroxypyruvate reductase ENST00000480596.1 glyoxylate reductase/hydroxypyruvate reductase ENST00000494290.1 glyoxylate reductase/hydroxypyruvate reductase ENST00000482603.1 glyoxylate reductase/hydroxypyruvate reductase ENST00000512404.1 putative novel transcript ENST00000455954.1 novel pseudogene ENST00000307750.4 novel protein (KIAA0354) ENST00000434597.1 novel pseudogene ENST00000377798.4 RNA polymerase I associated factor 53 (FLJ13390, FLJ13970)(PAF53) ENST00000377792.3 RNA polymerase I associated factor 53 (FLJ13390, FLJ13970)(PAF53) ENST00000434871.1 novel transcript ENST00000422509.1 ribosomal protein L21 (RPL21) pseudogene ENST00000413915.1 putative novel transcript ENST00000432825.2 F-box only protein 10 (FBX10) ENST00000276960.7 not organism-supported ENST00000541607.1 alternative 5' UTR ENST00000537239.1 subject to nonsense-mediated decay ENST00000377773.5 NP_001127957.1 ENST00000544379.1 NP_001127956.1 ENST00000540557.1 subject to nonsense-mediated decay ENST00000539465.1 alternative 5' UTR ENST00000359927.3 alternative 5' UTR ENST00000488673.2 novel transcript ENST00000377754.2 novel protein (FLJ31455) ENST00000396521.3 NP_001002269.1 ENST00000461549.1 novel protein (MGC10765,FLJ23201) ENST00000483167.1 novel transcript (MGC10765) ENST00000478453.1 novel protein (MGC10765,FLJ23201) ENST00000452964.1 mitochondrial ribosomal protein S10 (MRP-S10, FLJ10567, PNAS-122) (MRPS10) psueodgene ENST00000425324.1 phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase (PAICS) pseudogene ENST00000496760.1 FLJ40866 ENST00000496760.1 novel transcript ENST00000436507.1 novel pseudogene ENST00000377707.3 SHB (Src homology 2 domain containing) adaptor protein B ENST00000422554.1 non-canonical donor splice site at 3rd exon ENST00000422554.1 putative novel transcript ENST00000377698.3 novel protein similar to aldehyde dehydrogenase 1 family, member B1 (ALDH5, ALDHX, MGC2230) (ALDH1B1) ENST00000377694.1 novel protein, possible ortholog of mouse insulin-like growth factor binding protein 7 (IGFBP7) ENST00000443069.1 novel pseudogene ENST00000443005.1 transcription elongation factor A (SII), 1 (SII, TCEA, TF2S, GTF2S, TFIIS) (TCEA1) pseudogene ENST00000420145.1 pseudogene similar to part of growth arrest-specific 2 like 1 (GAR22, MGC17243) (GAS2L1) ENST00000448149.1 FKSG83 pseudogene ENST00000377689.1 possible pseudogene ENST00000377689.1 novel protein, possible ortholog of mouse RIKEN cDNA 2810453I06 gene ENST00000451357.1 novel pseudogene ENST00000399703.4 novel protein (KIAA2015) ENST00000475234.1 novel transcript ENST00000504791.1 novel pseudogene ENST00000424993.1 pseudogene similar to sorting nexin associated golgi protein 1 (SNAG1) ENST00000484285.2 novel transcript ENST00000445359.1 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide (YWHAB) pseudogene ENST00000444791.1 putative novel transcript ENST00000297668.6 cell recognition molecule CASPR3 (FLJ14195, KIAA1714) ENST00000493965.1 novel transcript ENST00000477002.1 novel transcript ENST00000358144.2 cell recognition molecule CASPR3 (FLJ14195, KIAA1714) ENST00000483502.1 novel transcript ENST00000448573.2 novel transcript ENST00000443583.2 cell recognition molecule CASPR3 (FLJ14195, KIAA1714) ENST00000495573.1 novel transcript ENST00000377659.1 cell recognition molecule CASPR3 (FLJ14195, KIAA1714) ENST00000469061.1 novel transcript ENST00000377653.1 non-canonical acceptor splice site at second exon in 5' UTR. ENST00000377653.1 cell recognition molecule CASPR3 (FLJ14195, KIAA1714) ENST00000423634.1 S-phase kinase-associated protein 1A (p19A) (OCP2, SKP1, EMC19, OCP-II, TCEB1L) (SKP1A) pseudogene ENST00000503949.1 pseudogene similar to part of cell recognition molecule CASPR3 ENST00000454645.1 Possiable unprocessed pseudogene similar to part of fibroblast growth factor 7 (keratinocyte growth factor) (FGF7) ENST00000454645.1 Translation from TrEml entry Tr:Q8NFD4 looks unlikey. ENST00000450520.1 Looks a bit of an unlikely translation (but no stop codons) as splicing after the stop codon and also over a large repeat area. ENST00000421686.1 Translation from TrEmbl entry Tr:Q96LT0 looks unlikely ENST00000455995.1 The translation in Tr:Q6ZUA7 looks unlikely so not used. ENST00000433629.1 novel pseudogene ENST00000467192.1 Non-canonical dodor splice site at exon 7 ENST00000496146.1 Non-canonical donor splice site at exon 6 ENST00000494538.1 Non-canonical dodor splice site at exon 7 ENST00000428759.1 Unprocessed pseudogene, see reference PMID:11952783 ENST00000417703.1 Translation from Tr:Q96LT0 looks unlikely ENST00000439824.1 Possible duplication of RP11-475I24.8-001 ENST00000425493.1 Possible duplication of RP11-175I6.5-001 ENST00000377548.1 Alternatively spliced 5' UTR, shares CDS with RP11-160N1.10-001. ENST00000377548.1 alternative 5' UTR ENST00000377457.5 Non-canonical acceptor splice site at exon 5 ENST00000377449.1 non-canonical acceptor splice site at exon 6 ENST00000468763.1 Translation from corresponding TrEmbl entry Q8N7U8 looks unlikely ENST00000473839.1 non-canonical acceptor splice site at exon 7 ENST00000495626.1 1bp missing at acceptor splice site at exon 5 ENST00000377445.5 non-canonical acceptor splice site at exon 5 ENST00000425587.1 putative novel transcript ENST00000449778.1 novel protein similar to COBW-like protein (LOC55871) ENST00000449778.1 alternatively spliced 5' UTR, shares CDS with bA561O23.1.2 ENST00000449778.1 alternative 5' UTR ENST00000360171.6 novel protein similar to COBW-like protein (LOC55871) ENST00000360171.6 non-canonical acceptor splice site at 5th exon ENST00000377349.1 novel protein similar to COBW-like protein (LOC55871) ENST00000479104.1 novel protein similar to COBW-like protein (LOC55871) ENST00000479104.1 non-canonical acceptor splice site at 5th exon ENST00000377344.1 novel protein similar to COBW-like protein (LOC55871) ENST00000377344.1 non-canonical acceptor splice site at 5th exon ENST00000478048.1 novel transcript ENST00000479888.1 novel transcript ENST00000487936.1 non-canonical acceptor splice site at 2nd exon ENST00000487936.1 novel transcript ENST00000469687.1 novel transcript ENST00000461973.1 novel transcript ENST00000377339.1 novel protein similar to COBW-like protein (LOC55871) ENST00000377338.1 novel protein similar to COBW-like protein (LOC55871) ENST00000377337.1 novel protein similar to COBW-like protein (LOC55871) ENST00000419576.1 putative novel transcript ENST00000429953.1 putative novel transcript ENST00000414223.1 putative novel transcript ENST00000417887.1 putative novel transcript ENST00000420855.1 putative novel transcript ENST00000496758.1 DKFZp434C1915 ENST00000446984.1 putative novel transcript ENST00000377311.3 novel protein (MGC34760) ENST00000413269.2 novel transcript ENST00000432148.1 novel transcript ENST00000446290.1 novel transcript ENST00000436315.1 squamous cell carcinoma antigen recognized by T cell (SART2) pseudogene ENST00000377290.1 phosphatidylinositol-4-phosphate 5-kinase, type I, beta (MSS4, STM7) ENST00000472907.1 phosphatidylinositol-4-phosphate 5-kinase, type I, beta (MSS4, STM7) ENST00000474356.1 phosphatidylinositol-4-phosphate 5-kinase, type I, beta (MSS4, STM7) ENST00000377284.1 phosphatidylinositol-4-phosphate 5-kinase, type I, beta (MSS4, STM7) ENST00000377284.1 alternatively spliced 5' UTR, shares CDS with bA203L2.1.1 (partial) ENST00000377284.1 alternative 5' UTR ENST00000437200.1 phosphatidylinositol-4-phosphate 5-kinase, type I, beta (MSS4, STM7) ENST00000437200.1 alternatively spliced 5' UTR, shares CDS with bA203L2.1.1 (partial) ENST00000437200.1 alternative 5' UTR ENST00000478500.1 phosphatidylinositol-4-phosphate 5-kinase, type I, beta (MSS4, STM7) ENST00000440050.1 phosphatidylinositol-4-phosphate 5-kinase, type I, beta (MSS4, STM7) ENST00000440050.1 alternatively spliced 5' UTR, shares CDS with bA203L2.1.1 (partial) ENST00000440050.1 alternative 5' UTR ENST00000424795.1 adaptor-related protein complex 3, mu 2 subunit (P47B, AP47B, CLA20) (AP3M2) pseudogene ENST00000442103.1 putative novel transcript ENST00000396366.2 NP_852090.1 ENST00000413932.1 putative novel transcript ENST00000377259.1 tight junction protein 2 (zona occludens 2) (X104, ZO-2) ENST00000423935.1 tight junction protein 2 (zona occludens 2) (X104, ZO-2) ENST00000423935.1 protein different to that given in Em:AF083893.1 as no stop codon found. ENST00000377245.4 tight junction protein 2 (zona occludens 2) (X104, ZO-2) ENST00000265384.7 tight junction protein 2 (zona occludens 2) (X104, ZO-2) ENST00000498204.1 tight junction protein 2 (zona occludens 2) (X104, ZO-2) ENST00000257515.8 Friedreich ataxia region gene X123 ENST00000303068.7 Friedreich ataxia region gene X123 ENST00000469179.1 novel transcript ENST00000377216.3 Friedreich ataxia region gene X123 ENST00000457328.1 putative novel transcript ENST00000265381.3 myloid beta (A4) precursor protein-binding, family A, member 1 (X11) ENST00000470082.1 myloid beta (A4) precursor protein-binding, family A, member 1 (X11) ENST00000429567.1 putative novel transcript ENST00000472967.2 novel transcript ENST00000439418.1 putative novel transcript ENST00000377197.3 novel protein, possible ortholog of mouse RIKEN cDNA 1700028P14 gene ENST00000466872.2 novel transcript ENST00000495399.1 novel transcript ENST00000480564.1 novel protein, possible ortholog of mouse RIKEN cDNA 1700028P14 gene ENST00000377182.4 novel protein (MGC21981) ENST00000377182.4 continued from bA195E11.1.1 in Em:AL392044 ENST00000460688.1 novel transcript ENST00000414515.1 putative novel transcript ENST00000451488.1 putative novel transcript ENST00000361138.5 SMC5 structural maintenance of chromosomes 5-like 1 (yeast) (SMC5, KIAA0594) ENST00000475540.1 SMC5 structural maintenance of chromosomes 5-like 1 (yeast) (SMC5, KIAA0594) ENST00000471372.1 SMC5 structural maintenance of chromosomes 5-like 1 (yeast) (SMC5, KIAA0594) ENST00000377126.2 basic transcription element binding protein 1 (BTEB, KLF9) ENST00000357533.2 Made from a mouse cDNA ENST00000396283.1 transient receptor potential cation channel subfamily M member 3 ENST00000361823.4 transient receptor potential cation channel subfamily M member 3 ENST00000354500.2 transient receptor potential cation channel subfamily M member 3 (DKFZp761A19121) ENST00000377097.3 transient receptor potential cation channel subfamily M member 3 ENST00000437699.2 transient receptor potential cation channel subfamily M member 3 ENST00000436491.1 putative novel transcript ENST00000415119.1 putative novel transcript ENST00000423148.1 pseudogene similar to part of CDC91 cell division cycle 91-like 1 (S. cerevisiae) (CDC91L1) ENST00000377044.4 transmembrane protein 2 ENST00000377057.1 transmembrane protein 2 ENST00000377066.5 NP_001129292.1 ENST00000396272.3 transmembrane protein 2 ENST00000474495.1 transmembrane protein 2 ENST00000377055.1 transmembrane protein 2 ENST00000377043.2 transmembrane protein 2 ENST00000545719.1 alternative 5' UTR ENST00000377041.2 novel protein (CGI-67) ENST00000333421.6 novel protein (CGI-67) ENST00000486911.1 novel protein ENST00000377024.3 novel protein (LOC138240) ENST00000418852.1 basic transcription factor 3 (BTF3) pseudogene ENST00000376986.1 guanine deaminase ENST00000358399.3 guanine deaminase, (KIAA1258) ENST00000358399.3 guanine deaminase, (KIAA1258) (contains FLJ13667) ENST00000475764.1 guanine deaminase ENST00000477618.1 guanine deaminase (FLJ40221) ENST00000414671.1 guanine deaminase ENST00000489618.1 guanine deaminase ENST00000436438.1 guanine deaminase ENST00000427901.1 putative novel transcript ENST00000446146.1 non-metastatic cells 2, protein (NM23B) expressed in (NME2) pseudogene ENST00000436054.1 novel transcript (FLJ37891) ENST00000451596.1 novel transcript ENST00000451152.1 novel transcript ENST00000376960.4 zinc finger protein 216 ENST00000376962.5 alternatively spliced in 5' UTR, shares CDS with bA63P12.1.1 ENST00000376962.5 zinc finger protein 216 (FLJ22129) ENST00000376962.5 alternative 5' UTR ENST00000343431.2 alternatively spliced in 5' UTR, shares CDS with bA63P12.1.1 ENST00000343431.2 zinc finger protein 216 ENST00000343431.2 alternative 5' UTR ENST00000471197.1 zinc finger protein 216 ENST00000376956.3 zinc finger protein 216 ENST00000487330.1 zinc finger protein 216 ENST00000431784.1 pseudogene similar to part of RAB7, member RAS oncogene family (RAB7) ENST00000415024.1 ribosomal protein S12 (RPS12) pseudogene ENST00000297784.5 transmembrane, cochlear expressed, 1 ENST00000497073.1 transmembrane, cochlear expressed, 1 ENST00000492418.1 transmembrane, cochlear expressed, 1 ENST00000486417.1 transmembrane, cochlear expressed, 1 ENST00000469455.1 transmembrane, cochlear expressed, 1 ENST00000457473.1 ribosomal protein S20 (RPS20) pseudogene ENST00000447672.1 ribosomal protein S27a (RPS27A) pseudogene ENST00000449235.1 novel transcript ENST00000423171.1 novel transcript ENST00000453787.1 novel transcript ENST00000297785.3 aldehyde dehydrogenase 1 family, member A1 (FLJ22998, FLJ20111) ENST00000376939.1 aldehyde dehydrogenase 1 family, member A1 ENST00000482210.1 aldehyde dehydrogenase 1 family, member A1 ENST00000419959.1 alternatively spliced in 5' UTR, shares partial CDS with bA151D14.2.1 ENST00000419959.1 aldehyde dehydrogenase 1 family, member A1 ENST00000419959.1 alternative 5' UTR ENST00000446946.1 alternatively spliced in 5' UTR, shares partial CDS with bA151D14.2.1 ENST00000446946.1 aldehyde dehydrogenase 1 family, member A1 ENST00000446946.1 alternative 5' UTR ENST00000493113.1 aldehyde dehydrogenase 1 family, member A1 ENST00000493311.1 aldehyde dehydrogenase 1 family, member A1 ENST00000416662.1 cytochrome P450, family 1, subfamily A, polypeptide 1 (CYP1A1) pseudogene ENST00000257497.6 annexin I (ANX1, LPC1) ENST00000456643.1 annexin I (ANX1, LPC1) ENST00000468639.1 annexin I (ANX1, LPC1) ENST00000415424.1 alternatively spliced in 5' UTR, shares partial CDS with bA71A24.1.1 ENST00000415424.1 alternative 5' UTR ENST00000415424.1 annexin I (ANX1, LPC1) ENST00000376911.1 annexin I (ANX1, LPC1) (FLJ23900) ENST00000495713.1 annexin I (ANX1, LPC1) ENST00000489109.1 annexin I (ANX1, LPC1) ENST00000491192.1 annexin I (ANX1, LPC1) ENST00000416030.1 pseudogene similar to part of dipeptidylpeptidase 3 (DPP3) ENST00000422909.1 putative novel transcript ENST00000447378.1 pseudogene similar to part of a GTPase-activating protein ENST00000450410.1 uncharacterized hypothalamus protein HT007 pseudogene ENST00000423681.1 putative novel transcript ENST00000417576.1 putative novel transcript ENST00000376896.2 RAR-related orphan receptor B (RZRB, ROR-BETA) ENST00000360774.1 transient receptor potential cation channel, subfamily M, member 6 (CHAK2, FLJ20087, FLJ22628) ENST00000312449.3 transient receptor potential cation channel, subfamily M, member 6 (CHAK2, FLJ20087, FLJ22628) ENST00000312449.3 non-canonical donor splice site at exon twenty and non-canonical acceptor splice site at exon twenty-one ENST00000483186.1 transient receptor potential cation channel, subfamily M, member 6 (CHAK2, FLJ20087, FLJ22628) ENST00000359047.2 transient receptor potential cation channel, subfamily M, member 6 (CHAK2, FLJ20087, FLJ22628) ENST00000414735.1 novel pseudogene ENST00000376854.5 novel protein (FLJ10110) ENST00000455609.1 novel transcript ENST00000376834.3 novel protein (FLJ25795) ENST00000451153.1 novel protein (FLJ25795) ENST00000376830.3 novel protein (FLJ25795) ENST00000455336.1 putative novel transcript ENST00000376811.1 novel protein (FLJ20559) ENST00000361092.4 novel protein (FLJ20559) ENST00000376808.4 novel protein (FLJ20559) ENST00000482537.1 novel transcript ENST00000494066.1 novel protein (FLJ20559) ENST00000466137.1 novel transcript ENST00000490321.1 novel protein (FLJ20559) ENST00000346234.6 osteoclast stimulating factor 1 (OSF, SH3P2) ENST00000426848.1 cell division cycle associated 7 (JPO1, FLJ14722) (CDCA7) pseudogene ENST00000455583.1 putative novel transcript ENST00000450956.1 orthodenticle homolog 2 (Drosophila) (OTX2) pseudogene ENST00000376767.3 proprotein convertase subtilisin/kexin type 5 (PC5, PC6, SPC6) (FLJ31640) ENST00000376752.4 proprotein convertase subtilisin/kexin type 5 (PC5, PC6, SPC6) (contains FLJ13034) ENST00000376752.4 proprotein convertase subtilisin/kexin type 5 (PC5, PC6, SPC6) ENST00000424854.1 proprotein convertase subtilisin/kexin type 5 (PC5, PC6, SPC6) ENST00000455778.1 proprotein convertase subtilisin/kexin type 5 ENST00000449536.1 novel (FLJ10290) pseudogene ENST00000376736.1 novel protein (FLJ11149) ENST00000483155.1 novel transcript ENST00000488136.1 glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) (C2GNT, NAGCT2) ENST00000480311.1 glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) (C2GNT, NAGCT2) ENST00000376730.4 glucosaminyl (N-acetyl) transferase 1, core 2 (beta-1,6-N-acetylglucosaminyltransferase) (C2GNT, NAGCT2) ENST00000448065.1 H3 histone, family 3A (H3F3A) pseudogene ENST00000441480.1 peptidylprolyl isomerase A (cyclophilin A) (PPIA) pseudogene ENST00000466266.1 non-canonical splice sites between exons 5 and 6 ENST00000426088.1 DKFZp726K117 ENST00000376713.3 novel protein ENST00000492157.1 novel protein (LOC158471) ENST00000489555.1 novel transcript ENST00000412654.1 prostate cancer antigen 3 (DD3) ENST00000454004.1 DnaJ (Hsp40) homolog, subfamily B, member 5 (DNAJB5) pseudogene ENST00000417429.1 lysophospholipase II (LYPLA2) pseudogene ENST00000451571.1 eukaryotic translation initiation factor 3, subunit 1, 35kDa (EIF3S1) pseudogene ENST00000376708.1 possible pseudogene ENST00000376708.1 NP_001013757 ENST00000376708.1 novel protein similar to forkhead box B1 (FOXB1) ENST00000454419.1 replication factor C (activator 1) 5, 36.5 kDa (RFC5) pseudogene ENST00000415172.1 putative novel transcript ENST00000376634.4 chorea acanthocytosis ENST00000360280.3 chorea acanthocytosis (FLJ12905, FLJ23370) ENST00000360280.3 chorea acanthocytosis ENST00000357409.5 chorea acanthocytosis (KIAA0986) ENST00000357409.5 chorea acanthocytosis ENST00000471439.1 chorea acanthocytosis ENST00000493341.1 chorea acanthocytosis (FLJ20266) ENST00000419472.1 chorea acanthocytosis ENST00000484581.2 chorea acanthocytosis ENST00000376646.3 not organism-supported ENST00000376646.3 alternative 5' UTR ENST00000467124.1 chorea acanthocytosis ENST00000341700.6 guanine nucleotide binding protein (G protein), alpha 14 ENST00000464095.1 guanine nucleotide binding protein (G protein), alpha 14 ENST00000439145.1 novel transcript ENST00000448540.1 nuclear transport factor 2 (NUTF2) pseudogene ENST00000286548.4 guanine nucleotide binding protein (G protein), q polypeptide ENST00000411677.1 guanine nucleotide binding protein (G protein), q polypeptide ENST00000428243.1 synaptogyrin 2 (SYNGR2) pseudogene ENST00000418694.1 argininosuccinate synthetase (ASS) pseudogene ENST00000433468.1 ribosomal protein L21 (RPL21) pseudogene ENST00000449661.1 CDC28 protein kinase regulatory subunit 2 (CKS2) pseudogene ENST00000424347.2 FLJ12643 ENST00000415759.2 NP_115547.1 ENST00000415759.2 NAGNAG splice site ENST00000376597.4 NAGNAG splice site ENST00000277082.5 NAGNAG splice site ENST00000277082.5 not organism-supported ENST00000376598.2 confirm experimentally ENST00000487108.2 novel transcript ENST00000347159.2 phosphoserine aminotransferase (PSA) ENST00000376588.3 phosphoserine aminotransferase (PSA) ENST00000450555.1 NADH dehydrogenase 2 (MTND2) pseudogene ENST00000344739.5 keratin pseudogene ENST00000424980.1 putative novel transcript ENST00000413352.1 putative novel transcript ENST00000376552.2 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) (ESG4) ENST00000435650.1 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) (ESG4) ENST00000414465.1 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) (ESG4) ENST00000376525.1 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) (ESG4) ENST00000425506.1 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) (ESG4) ENST00000485159.1 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) (ESG4) ENST00000428713.1 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) (ESG4) ENST00000455913.1 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) (ESG4) ENST00000493163.1 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) (ESG4) ENST00000478290.1 transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila) (ESG4) ENST00000440700.1 novel pseudogene (BCE-1) ENST00000440671.1 novel pseudogene ENST00000448475.1 putative novel transcript ENST00000417801.1 putative novel transcript ENST00000443325.1 novel pseudogene ENST00000427672.1 pseudogene similar to part of cytochrome c oxidase I (MTCO3) ENST00000422293.1 NADH dehydrogenase 2 (MTND2) pseudogene ENST00000441327.1 ribosomal protein S19 (RPS19) pseudogene ENST00000397864.2 putatitive novel transcript ENST00000412447.1 ribosomal protein S20 (RPS20) pseudogene ENST00000457409.1 novel pseudogene ENST00000376499.3 transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) (ESG, GRG1) ENST00000376484.1 transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) (ESG, GRG1) ENST00000491534.1 transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) (ESG, GRG1) ENST00000464999.1 transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) (ESG, GRG1) ENST00000418319.1 transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) (ESG, GRG1) ENST00000376463.1 transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila) (ESG, GRG1) ENST00000437181.1 novel transcript ENST00000413050.1 novel transcript ENST00000527857.1 novel transcript ENST00000429999.1 putative novel pseudogene ENST00000344803.2 FLJ46321 ENST00000434692.1 novel pseudogene ENST00000376458.1 novel protein ENST00000417796.1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 10 (RNA helicase) (HRH-J8) (DDX10) pseudogene ENST00000445918.1 ribosomal protein S2 (LLREP3) (RPS2) pseudogene ENST00000457558.1 novel transcript ENST00000436084.1 putative novel transcript ENST00000392516.3 cytochrome c oxidase III (COIII) (MTCO3) pseudogene ENST00000438986.1 novel pseudogene ENST00000422010.1 putative novel transcript ENST00000432491.1 ribosomal protein S6 (RPS6) pseudogene ENST00000416473.1 putative novel transcript ENST00000376438.1 novel protein (MGC20553) ENST00000376434.1 novel protein (MGC20553) ENST00000328788.1 novel protein (MGC20553) ENST00000465485.1 novel transcript ENST00000431299.1 novel protein (MGC20553) ENST00000458111.1 putative novel transcript ENST00000533522.1 novel protein ENST00000376371.2 protein kinase anchoring protein GKAP42 (FKSG21) ENST00000376365.3 protein kinase anchoring protein GKAP42 (FKSG21) ENST00000376362.1 protein kinase anchoring protein GKAP42 (FKSG21) ENST00000388782.4 protein kinase anchoring protein GKAP42 (FKSG21) ENST00000491634.1 novel transcript ENST00000485742.1 alternative 5' UTR ENST00000458016.1 novel transcript ENST00000417672.1 novel transcript ENST00000439378.1 novel transcript ENST00000412069.1 novel transcript ENST00000376347.1 novel protein (DKFZp434D0917) ENST00000495062.1 novel protein (DKFZp434D0917) ENST00000421734.1 putative novel transcript ENST00000376344.3 novel protein (MGC10999) ENST00000314700.1 novel protein (MGC10999) ENST00000376340.1 novel protein (MGC10999) ENST00000376281.4 heterogeneous nuclear ribonucleoprotein K (CSBP, TUNP, HNRNPK) ENST00000376268.1 non-canonical donor splice site in first exon in 5' UTR ENST00000376268.1 heterogeneous nuclear ribonucleoprotein K (CSBP, TUNP, HNRNPK) ENST00000351839.3 heterogeneous nuclear ribonucleoprotein K (CSBP, TUNP, HNRNPK) ENST00000435158.2 heterogeneous nuclear ribonucleoprotein K (CSBP, TUNP, HNRNPK) ENST00000360384.5 heterogeneous nuclear ribonucleoprotein K (CSBP, TUNP, HNRNPK) ENST00000493362.1 heterogeneous nuclear ribonucleoprotein K (CSBP, TUNP, HNRNPK) ENST00000492865.1 heterogeneous nuclear ribonucleoprotein K (CSBP, TUNP, HNRNPK) ENST00000481820.1 heterogeneous nuclear ribonucleoprotein K (CSBP, TUNP, HNRNPK) ENST00000457156.1 heterogeneous nuclear ribonucleoprotein K (CSBP, TUNP, HNRNPK) ENST00000376256.1 heterogeneous nuclear ribonucleoprotein K (CSBP, TUNP, HNRNPK) ENST00000472778.1 heterogeneous nuclear ribonucleoprotein K (CSBP, TUNP, HNRNPK) ENST00000483135.1 heterogeneous nuclear ribonucleoprotein K (CSBP, TUNP, HNRNPK) ENST00000448389.1 putative novel transcript ENST00000445877.1 novel protein (FLJ12888) ENST00000445877.1 alternatively spliced 5' UTR, shares cds with bA346I8.1.1 (partial) ENST00000445877.1 alternative 5' UTR ENST00000325875.3 novel protein (FLJ12888) ENST00000423515.1 putative novel transcript ENST00000414950.1 novel pseudogene ENST00000376238.4 solute carrier family 28 (sodium-coupled nucleoside transporter), member 3, (CNT3) ENST00000495823.1 solute carrier family 28 (sodium-coupled nucleoside transporter), member 3, (CNT3) ENST00000419815.1 putative novel transcript ENST00000423044.1 novel pseudogene ENST00000376208.1 Neurotrophic tyrosine kinase, receptor, type 2 (TRKB) ENST00000304053.6 Neurotrophic tyrosine kinase, receptor, type 2 (TRKB) ENST00000277120.3 Neurotrophic tyrosine kinase, receptor, type 2 (TRKB) ENST00000323115.4 Neurotrophic tyrosine kinase, receptor, type 2 (TRKB) ENST00000359847.3 Neurotrophic tyrosine kinase, receptor, type 2 (TRKB) ENST00000414685.1 pseudogene similar to part of ubiquitin-conjugating enzyme E2 ENST00000423835.1 pseudogene similar to part of serine/threonine kinase 33 (STK33) ENST00000357081.3 ATP/GTP binding protein 1 (NNA1, KIAA1035) ENST00000376083.3 ATP/GTP binding protein 1 (NNA1, KIAA1035) ENST00000489265.1 ATP/GTP binding protein 1 (NNA1, KIAA1035) ENST00000376081.4 ATP/GTP binding protein 1 (NNA1, KIAA1035) ENST00000491784.1 ATP/GTP binding protein 1 (NNA1, KIAA1035) ENST00000376080.1 ATP/GTP binding protein 1 (NNA1, KIAA1035) ENST00000422653.1 pseudogene similar to part of a novel protein (DKFZp434D0917) ENST00000447148.1 putative novel transcript ENST00000439544.1 putative novel transcript ENST00000418478.1 putative novel transcript ENST00000443630.1 putative novel transcript ENST00000456242.1 putative novel transcript ENST00000431724.1 pseudogene similar to part of a novel protein (DKFZp434D0917) ENST00000415677.1 prohibitin pseudogene (PHB) ENST00000442109.1 novel pseudogene (DFKZP564M182) ENST00000361671.5 novel protein (FLJ21613) similar to rat corneal wound healing related protein (includes FLJ22634) ENST00000416045.1 novel protein (FLJ21613) similar to rat corneal wound healing related protein (includes FLJ22634) ENST00000376040.1 novel protein (FLJ21613) similar to rat corneal wound healing related protein (includes FLJ22634) ENST00000388712.3 golgi phosphoprotein 2 (GP73) ENST00000388711.3 golgi phosphoprotein 2 (GP73) ENST00000388711.3 alternatively spliced 5' UTR, shares CDs with bA379P1.2.1 ENST00000388711.3 alternative 5' UTR ENST00000486130.1 alternative 5' UTR ENST00000466178.1 alternative 5' UTR ENST00000427811.1 novel pseudogene ENST00000339137.2 novel protein ENST00000469914.1 novel transcript ENST00000376001.3 novel protein ENST00000375991.4 novel protein (MGC4276) ENST00000311534.6 novel protein (MGC4276) ENST00000326094.4 novel protein (MGC4276) ENST00000277141.6 novel protein (FLJ13409) ENST00000375960.2 novel protein (FLJ13409) ENST00000375957.1 novel protein (FLJ13409) ENST00000375963.3 novel protein (FLJ13409) ENST00000469004.1 novel transcript ENST00000375948.1 novel protein (FLJ13409) ENST00000375947.1 novel protein (FLJ13409) ENST00000422735.1 ribosomal protein S6 (RPS6) pseudogene ENST00000434631.1 novel pseudogene ENST00000438582.1 putative novel transcript ENST00000443163.1 putative novel transcript ENST00000415801.1 novel transcript ENST00000434455.1 novel pseudogene ENST00000437925.1 nuclear transcription factor Y, gamma (HSM, CBFC, HAP5) (NFYC) pseudogene ENST00000454946.1 NADH dehydrogenase (ubiquinone) 1 alpha (MLRQ) (NDUFA4) pseudogene ENST00000472284.1 alternative 5' UTR ENST00000408954.3 alternative 5' UTR ENST00000496522.1 continues as bA249H20.1.2 in Em:AL591852 ENST00000496522.1 death-assodeath-associated protein kinase 1 ENST00000497743.1 death-associated protein kinase 1 ENST00000468482.1 death-associated protein kinase 1 ENST00000401543.2 ribosomal protein S29 (RPS29) pseudogene ENST00000431813.1 putative novel transcript ENST00000343150.5 cathepsin L ENST00000340342.6 cathepsin L ENST00000340342.6 alternatively spliced 5' UTR, shares CDS with bA65B23.2.1 ENST00000340342.6 alternative 5' UTR ENST00000375894.5 cathepsin L ENST00000495822.1 cathepsin L ENST00000342020.5 cathepsin L ENST00000482054.1 cathepsin L ENST00000425861.1 eukaryotic translation initiation factor 3, subunit 1 alpha, 35kDa (EIF3S1) pseudogene ENST00000412179.1 cathepsin pseudogene ENST00000445099.1 pseudogene similar to part of E74-like factor 2 (ets domain transcription factor) (EU32, NERF, NERF-2, NERF-1A,NERF-1B) (ELF2) ENST00000424473.1 pseudogene similar to part a fructose-1,6-bisphosphatase protein ENST00000413075.1 cathepsin L (MEP, CATL) (CTSL) pseudogene ENST00000411992.1 putative novel transcript ENST00000447524.1 putative novel transcript ENST00000325643.5 novel protein (FLJ35866) ENST00000420021.1 novel pseudogene ENST00000427728.1 pseudogene similar to part of a novel protein ENST00000459720.1 cell cycle related kinase (CCRK,CDCH) ENST00000375883.3 cell cycle related kinase (CCRK,CDCH) ENST00000486228.1 novel transcript ENST00000442490.1 novel pseudogene ENST00000324915.4 novel pseudogene ENST00000375867.3 novel pseudogene ENST00000429076.1 mitofusin 1 (FLJ20693) (MFN1) psueodgene ENST00000375859.3 spindlin ENST00000485804.1 spindlin ENST00000462844.1 spindlin ENST00000485565.1 spindlin ENST00000483785.1 spindlin ENST00000469017.1 spindlin ENST00000440352.1 heterogeneous nuclear ribonucleoprotein A1 (HNRPA1) pseudogene ENST00000418343.1 novel transcript ENST00000441651.1 PEST-containing nuclear protein (PEST) pseudogene ENST00000421482.1 putative novel transcript ENST00000375851.2 novel protein (FLJ37523) ENST00000375850.3 novel protein (FLJ37523) ENST00000375846.3 endothelial differentiation, sphingolipid G-protein-coupled receptor, 3 ENST00000439796.1 putative novel transcript ENST00000375835.4 novel protein (SHC3) ENST00000375831.1 novel protein (SHC3) ENST00000429700.1 putative novel transcript ENST00000456944.1 putative novel trasncript ENST00000314355.6 CDC28 protein kinase regulatory subunit 2 (CKSHS2) ENST00000375807.3 SECIS binding protein 2 (SBP2) ENST00000425851.1 SECIS binding protein 2 (SBP2) ENST00000440898.1 SECIS binding protein 2 (SBP2) ENST00000339861.4 confirm experimentally ENST00000339861.4 not organism-supported ENST00000339861.4 alternative 5' UTR ENST00000455551.2 not organism-supported ENST00000450295.1 alternative 5' UTR ENST00000422704.2 alternative 5' UTR ENST00000420681.2 alternative 5' UTR ENST00000433650.1 alternative 5' UTR ENST00000540475.1 alternative 5' UTR ENST00000418828.1 alternative 5' UTR ENST00000420670.1 alternative 5' UTR ENST00000464051.1 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D ENST00000438325.1 proliferation-associated 2G4, 38kDa (PA2G4) pseuodgene ENST00000430017.1 ubiquitin-conjugating enzyme E2 pseudogene ENST00000252506.6 growth arrest and DNA-damage-inducible, gamma (CR6, DDIT2, GRP17) ENST00000375769.1 growth arrest and DNA-damage-inducible, gamma (CR6, DDIT2, GRP17) ENST00000494726.1 growth arrest and DNA-damage-inducible, gamma (CR6, DDIT2, GRP17) ENST00000444374.1 putative novel transcript ENST00000421297.1 Non-canonical donor splice site at second exon. ENST00000446201.1 putative novel transcript ENST00000426593.1 novel transcript ENST00000417848.1 interleukin 6 receptor (IL6R) pseudogene ENST00000426212.1 olfactory receptor pseudogene ENST00000448529.1 olfactory receptor pseudogene ENST00000425666.1 novel transcript ENST00000436671.1 novel transcript ENST00000427523.1 novel transcript ENST00000449990.1 novel transcript ENST00000429044.1 novel transcript ENST00000375765.3 DIRAS family, GTP-binding RAS-like 2 (DKFZp761C07121) ENST00000445529.1 olfactory receptor pseudogene ENST00000375754.4 spleen tyrosine kinase ENST00000375751.4 spleen tyrosine kinase ENST00000375751.4 alternatively spliced in 5' UTR, shares CDS with bA83L6.1.3 ENST00000375751.4 alternative 5' UTR ENST00000375747.1 spleen tyrosine kinase ENST00000476708.1 spleen tyrosine kinase ENST00000476708.1 alternative 5' end ENST00000375746.1 spleen tyrosine kinase ENST00000375746.1 alternative 5' UTR ENST00000375746.1 alternatively spliced in 5' UTR, shares CDS with bA83L6.1.1 ENST00000427745.1 putative novel transcript ENST00000423380.1 novel transcript ENST00000439438.1 novel transcript ENST00000414768.1 novel transcript ENST00000437389.1 novel transcript ENST00000421595.1 novel transcript ENST00000457976.1 novel transcript ENST00000423719.1 novel transcript (LOC286371) (FLJ37813) ENST00000430315.1 peptidylpolyl isomerase A (cyclophilin A) (PPIA) pseudogene ENST00000375731.4 AU RNA binding protein/enoyl-Coenzyme A hydratase ENST00000303617.5 AU RNA binding protein/enoyl-Coenzyme A hydratase (AUH) ENST00000303617.5 AU RNA binding protein/enoyl-Coenzyme A hydratase ENST00000473695.1 AU RNA binding protein/enoyl-Coenzyme A hydratase (AUH) ENST00000478465.1 AU RNA binding protein/enoyl-Coenzyme A hydratase ENST00000475023.1 AU RNA binding protein/enoyl-Coenzyme A hydratase ENST00000375724.1 nuclear factor, interleukin 3 regulated ENST00000442072.1 putative novel transcript ENST00000429118.1 phosphoribosylaminoimidazole carboxylase (PAICS) pseudogene ENST00000422570.1 ribosomal protein L21 (RPL21) pseudogene ENST00000456856.1 heat shock 10kDa protein 1 (chaperonin 10) (HSPE1) pseudogene ENST00000486910.1 non-canonical splice donor site adjacent to exon 3 ENST00000486910.1 non-canonical splice acceptor site at 5' end ENST00000486910.1 serine palmitoyltransferase, long chain base subunit 1 ENST00000262554.2 serine palmitoyltransferase, long chain base subunit 1 ENST00000469778.1 serine palmitoyltransferase, long chain base subunit 1 ENST00000482632.1 serine palmitoyltransferase, long chain base subunit 1 ENST00000337841.4 serine palmitoyltransferase, long chain base subunit 1 ENST00000477888.1 serine palmitoyltransferase, long chain base subunit 1 ENST00000488921.1 serine palmitoyltransferase, long chain base subunit 1 ENST00000461132.1 serine palmitoyltransferase, long chain base subunit 1 ENST00000415057.1 pseudogene similar to part of ATP synthase 6 (MTATP6) ENST00000432119.1 cytochrome c oxidase III (MTCO3) pseudogene ENST00000431980.1 NADH dehydrogenase 3 (MTND3) pseudogene ENST00000431728.1 NADH dehydrogenase 4L (MTND4L) pseudogene ENST00000437913.1 NADH dehydrogenase 4 (MTND4) pseudogene ENST00000412768.1 protein tyrosine phosphatase (similar to rodent ESP) pseudogene ENST00000367276.4 novel transcript ENST00000417983.1 novel transcript ENST00000416438.1 novel transcript (FLJ13600) (LOC158314) ENST00000438322.1 novel transcript ENST00000430945.1 novel transcript ENST00000421234.1 novel transcript ENST00000444476.1 novel transcript ENST00000434944.1 novel transcript ENST00000415471.1 putative novel transcript ENST00000414425.1 novel pseudogene (similar to KIAA1553) ENST00000457003.1 novel transcript ENST00000375643.3 isoleucine-tRNA synthetase (ILRS) ENST00000421189.1 isoleucine-tRNA synthetase (ILRS) ENST00000436450.1 isoleucine-tRNA synthetase (ILRS) ENST00000375627.1 isoleucine-tRNA synthetase (ILRS) ENST00000474340.1 isoleucine-tRNA synthetase (ILRS) ENST00000473915.1 isoleucine-tRNA synthetase (ILRS) ENST00000449893.1 isoleucine-tRNA synthetase (ILRS) ENST00000467876.1 isoleucine-tRNA synthetase (ILRS) ENST00000472894.1 isoleucine-tRNA synthetase (ILRS) ENST00000395554.3 isoleucine-tRNA synthetase (ILRS) ENST00000395554.3 alternative 5' UTR ENST00000498025.1 isoleucine-tRNA synthetase (ILRS) ENST00000490438.1 isoleucine-tRNA synthetase (ILRS) ENST00000430417.1 isoleucine-tRNA synthetase (ILRS) ENST00000442668.2 alternative 5' UTR ENST00000536593.1 alternative 5' UTR ENST00000545558.1 not organism-supported ENST00000545558.1 alternative 5' UTR ENST00000360868.3 (FLJ20736) (contains FLJ21133, FLJ14183, FLJ12693) ENST00000535387.1 confirm experimentally ENST00000542053.1 confirm experimentally ENST00000432670.2 novel protein (FLJ10187) ENST00000432670.2 alternative 5' UTR ENST00000434228.1 alternative 3' UTR ENST00000434228.1 alternative 5' UTR ENST00000433029.2 not organism-supported ENST00000433029.2 alternative 5' UTR ENST00000421075.2 alternative 5' UTR ENST00000411621.2 alternative 5' UTR ENST00000535807.1 alternative 5' UTR ENST00000536624.1 alternative 5' UTR ENST00000542613.1 alternative 5' UTR ENST00000542573.1 alternative 5' UTR ENST00000543260.1 alternative 5' UTR ENST00000543985.1 NAGNAG splice site ENST00000544321.1 alternative 3' UTR ENST00000544321.1 NAGNAG splice site ENST00000544321.1 alternative 5' UTR ENST00000375587.3 novel protein (FLJ35284) (contains FLJ36981) ENST00000375587.3 novel protein (FLJ35284) ENST00000375579.3 novel protein (FLJ33928) ENST00000375576.1 novel protein (DKFZp667I039) ENST00000456945.1 UPF0183 protein pseudogene ENST00000262551.4 alternative 5' UTR ENST00000375561.5 DKFZp586P2421 ENST00000375550.4 osteomodulin ENST00000344604.5 extracellular matrix protein 2, female organ and adipocyte specific ENST00000375540.1 extracellular matrix protein 2, female organ and adipocyte specific ENST00000395534.2 alternatively spliced in 5' UTR, shares CDS with bA19J3.1.1 ENST00000395534.2 extracellular matrix protein 2, female organ and adipocyte specific ENST00000395534.2 alternative 5' UTR ENST00000447622.1 pseudogene similar to part of cytochrome c oxidase I (MTCO1) ENST00000287996.3 chromosome 9 open reading frame 12 (INSP5K2, FLJ13163) ENST00000486841.1 chromosome 9 open reading frame 12 novel transcript (FLJ39073) ENST00000375522.1 chromosome 9 open reading frame 12 ENST00000442640.1 ribosomal protein L21 (RPL21) pseudogene ENST00000356884.6 coiled-coil protein (BICD2) (KIAA0699) ENST00000375512.3 coiled-coil protein (BICD2) ENST00000464387.1 FLJ36178 ENST00000375495.3 DKFZp667F196 ENST00000332591.6 FLJ33884 ENST00000391550.2 melanoma antigen pseudogene ENST00000375482.3 FGD1 family, member 3 ENST00000468206.1 FGD1 family, member 3 ENST00000494669.1 FGD1 family, member 3 ENST00000467786.1 FGD1 family, member 3 ENST00000467786.1 FGD1 family, member 3 (FLJ00004) ENST00000494553.1 FGD1 family, member 3 ENST00000488407.1 FGD1 family, member 3 ENST00000375472.3 novel protein (MGC26847) ENST00000465709.1 novel transcript ENST00000471462.1 novel transcript ENST00000428958.1 putative novel transcript ENST00000375464.2 novel protein (MGC11115) ENST00000466409.1 novel protein (FLJ33154) ENST00000495641.1 novel transcript ENST00000466929.1 novel transcript ENST00000468781.1 novel transcript ENST00000490488.1 novel transcript ENST00000498243.1 novel transcript ENST00000475574.1 novel transcript ENST00000488630.1 novel transcript ENST00000375446.4 ninjurin 1 ENST00000489274.1 ninjurin 1 ENST00000470314.1 ninjurin 1 ENST00000461162.1 ninjurin 1 ENST00000490564.1 ninjurin 1 ENST00000366188.2 putative novel transcript ENST00000411624.1 chimearic cDNA, 5' end found on chromosome 1 ENST00000462595.1 protein kinase, lysine deficient 2 (WNK2, NY-CO-43, SDCCAG43, P/OKcl.13) ENST00000474009.1 protein kinase, lysine deficient 2 (WNK2, NY-CO-43, SDCCAG43, P/OKcl.13) ENST00000460335.1 protein kinase, lysine deficient 2 (WNK2, NY-CO-43, SDCCAG43, P/OKcl.13) ENST00000471076.1 protein kinase, lysine deficient 2 (WNK2, NY-CO-43, SDCCAG43, P/OKcl.13) ENST00000375419.1 novel protein similar to chromosome 9 open reading frame 10 (C9orf10) ENST00000443716.1 putative novel transcript ENST00000445280.1 putative novel transcript ENST00000479094.1 novel transcript ENST00000479094.1 continues as bA165J3.4.2 in Em:AL583839 ENST00000423591.1 novel protein ENST00000375412.5 continues as bA165J3.4.3 in Em:AL583839 ENST00000375412.5 novel protein (FLJ31534) ENST00000483149.2 putative novel transcript ENST00000483056.1 continues as bA165J3.4.5 in Em:AL583839 ENST00000483056.1 novel transcript ENST00000476484.1 continues as bA165J3.4.4 in Em:AL583839 ENST00000476484.1 novel protein ENST00000428152.1 novel protein ENST00000428152.1 continues as bA165J3.4.7 in Em:AL583839 ENST00000428378.1 continues as bA165J3.4.6 in Em:AL583839 ENST00000428378.1 novel protein ENST00000375389.3 chromosome 9 open reading frame 10 ENST00000277165.5 chromosome 9 open reading frame 10 (KIAA0183) ENST00000446420.1 chromosome 9 open reading frame 10 ENST00000475933.1 chromosome 9 open reading frame 10 ENST00000427765.1 chromosome 9 open reading frame 10 ENST00000434312.1 putative novel transcript ENST00000359246.4 PHD finger protein 2 (GRC5, KIAA0662) ENST00000443771.1 putative novel transcript ENST00000454594.1 novel transcript ENST00000453045.1 putative novel transcript ENST00000288976.3 protein tyrosine phosphatase PTP9Q22 ENST00000445119.1 cytochrome C pseudogene ENST00000492115.1 novel transcript ENST00000481550.1 novel transcript ENST00000340911.3 zinc finger protein 169 ENST00000480716.1 novel transcript ENST00000458323.1 voltage-dependent anion channel 1 (VDAC1) pseudogene ENST00000253262.4 novel protein (DKFZp434I1117) ENST00000454869.1 novel transcript ENST00000419456.1 novel pseudogene ENST00000375344.3 novel protein similar to mouse hippocampus abundant gene transcript 1 (HIAT1) ENST00000417264.1 novel transcript ENST00000448030.1 leishmanolysin-like (metallopeptidase M8 family)(LMLN) pseudogene ENST00000452148.1 novel transcript ENST00000375337.3 Fructose-1,6-bisphosphatase 2 ENST00000375326.4 fructose-1,6-bisphosphatase 1 ENST00000414122.1 fructose-1,6-bisphosphatase 1 ENST00000375325.1 novel protein ENST00000277198.2 novel protein (FLJ14675) ENST00000277198.2 continued as bA54O15.1.2 in Em:AL353768 ENST00000297979.5 novel protein (FLJ14675) ENST00000427193.1 novel protein (FLJ14675) ENST00000489318.1 novel transcript ENST00000424143.1 novel protein (FLJ14675) ENST00000428313.1 novel protein (FLJ14675) ENST00000488186.1 novel transcript ENST00000473778.1 novel transcript ENST00000462125.1 novel transcript ENST00000479161.1 continued as bA80I15.3.5 in Em:AL354893 ENST00000479161.1 novel transcript ENST00000451893.1 novel protein (FLJ14675) ENST00000460573.1 novel transcript ENST00000478603.1 novel transcript ENST00000471978.1 novel transcript ENST00000445181.1 ncontinued from bA54O15.1.11 in Em:AL353768 ENST00000445181.1 novel protein (FLJ14675) ENST00000478473.1 novel protein (FLJ14675) ENST00000496567.1 novel transcript ENST00000463372.1 novel transcript ENST00000482056.1 novel transcript ENST00000489562.1 novel transcript ENST00000468164.1 novel transcript ENST00000437846.1 novel transcript ENST00000416455.1 novel transcript ENST00000439872.1 novel transcript ENST00000289081.3 fanconi anemia, complementation group C ENST00000375305.1 variant 2; alternatively spliced in 5' UTR ENST00000375305.1 fanconi anemia, complementation group C ENST00000464627.1 fanconi anemia, complementation group C ENST00000480712.1 fanconi anemia, complementation group C ENST00000477942.1 fanconi anemia, complementation group C ENST00000490972.1 fanconi anemia, complementation group C ENST00000464653.1 fanconi anemia, complementation group C ENST00000493098.1 fanconi anemia, complementation group C ENST00000474949.1 fanconi anemia, complementation group C ENST00000433829.1 variant 3; alternatively spliced in 5' UTR ENST00000433829.1 fanconi anemia, complementation group C ENST00000423075.1 putative novel transcript ENST00000433735.1 ribosomal protein S26 (RPS26) pseudogene ENST00000445995.1 KIAA0431 pseudogene ENST00000433644.1 putative novel transcript ENST00000331920.6 patched homolog (Drosophila) ENST00000430669.2 patched homolog (Drosophila) ENST00000430669.2 NP_001077071.1 ENST00000430669.2 not organism-supported ENST00000429896.2 NP_001077075.1 ENST00000429896.2 patched homolog (Drosophila) ENST00000375274.2 NP_001077072.1 ENST00000375271.4 patched homolog (Drosophila) ENST00000488809.2 patched homolog (Drosophila) ENST00000553011.1 alternative 5' UTR ENST00000551845.1 not organism-supported ENST00000551845.1 alternative 5' UTR ENST00000547672.1 alternative 5' UTR ENST00000546820.1 alternative 5' UTR ENST00000419620.1 novel transcript ENST00000422343.1 putative novel transcript ENST00000445213.1 proteasome subunit, alpha type, 7 (PSMA7) pseudogene ENST00000427259.1 novel transcript ENST00000448465.1 novel transcript ENST00000288985.7 novel protein containing SNF2 family N-terminal and Helicase conserved C-terminal domains ENST00000446226.1 parkinson disease 7 (PARK7) pseudogene ENST00000432783.1 novel transcript ENST00000432132.1 eukaryotic translation initiation factor 4B (EIF4B) pseudogene ENST00000464104.1 this variant and fragment .3.2 and could be part of one single variant ENST00000464104.1 hydroxysteroid (17-beta) dehydrogenase 3 ENST00000494814.1 this variant and fragment .3.2 and could be part of one single variant ENST00000494814.1 hydroxysteroid (17-beta) dehydrogenase 3 ENST00000467499.1 this variant and fragment .3.2 and could be part of one single variant ENST00000467499.1 hydroxysteroid (17-beta) dehydrogenase 3 ENST00000375263.3 hydroxysteroid (17-beta) dehydrogenase 3 ENST00000484816.1 this variant and fragment .3.2 and could be part of one single variant ENST00000484816.1 hydroxysteroid (17-beta) dehydrogenase 3 ENST00000463517.1 this variant and one or more of variant fragments .3.3, .3.4, .3.5 and .3.6 could be part of one single variant ENST00000463517.1 hydroxysteroid (17-beta) dehydrogenase 3 ENST00000463517.1 2 ENST00000448857.1 novel transcript ENST00000253270.7 nucleotide-sugar transporter similar to C. elegans sqv-7 (SQV7L) ENST00000490599.1 novel transcript ENST00000375257.1 nucleotide-sugar transporter similar to C. elegans sqv-7 (SQV7L) ENST00000482643.1 novel transcript ENST00000375256.4 novel zinc finger protein ENST00000457472.1 TINP1 pseudogene ENST00000375251.3 hyaluronan binding protein 4 ENST00000375249.4 hyaluronan binding protein 4 ENST00000466976.1 hyaluronan binding protein 4, (IHABP4, Ki-1/57) ENST00000375242.3 NP_001070649.1 ENST00000422818.1 novel transcript ENST00000446045.1 novel protein ENST00000375234.3 novel protein ENST00000411939.1 novel protein ENST00000464512.1 novel transcript ENST00000423924.1 putative novel transcript ENST00000445872.1 makorin, ring finger protein, 2 (MKRN2) pseudogene ENST00000375231.1 novel protein (KIAA0972) ENST00000472201.1 novel transcript ENST00000374641.3 novel protein (KIAA0972) ENST00000478850.1 alternative 5' UTR ENST00000506067.1 novel transcript ENST00000435150.1 novel pseudogene ENST00000416300.1 novel pseudogene ENST00000354649.2 novel protein similar to DKFZP434I1117 ENST00000375230.1 possible pseudogene ENST00000375230.1 novel protein similar to DKFZP434I1117 ENST00000375223.3 novel protein similar to MGC12954 ENST00000424606.1 novel pseudogene (FLJ23476) ENST00000259470.5 cathepsin L2 (CTSU, CTSV, CATL2) ENST00000479932.1 cathepsin L2 (CTSU, CTSV, CATL2) ENST00000449716.1 transcription elongation factor A (SII), 1 (TFS2, GTFS2) (TCEA1) pseudogene ENST00000436355.1 pseudogene similar to part of growth arrest-specific 2 like 1 (GAS2L1) ENST00000442849.1 putative novel transcript ENST00000411675.1 vomeronasal 1 pseudogene ENST00000395253.2 novel pseudogene ENST00000354752.4 novel transcript ENST00000416066.1 putative novel transcript ENST00000420204.1 putative novel transcript ENST00000366109.2 putative novel transcript ENST00000471314.1 novel transcript ENST00000430691.1 pseudogene similar to part of ral guanine nucleotide dissociation stimulator (RALGDS) ENST00000355295.4 tudor repeat associator with PCTAIRE 2 (PCTAIRE2BP) ENST00000492428.1 tudor repeat associator with PCTAIRE 2 (PCTAIRE2BP) ENST00000259365.3 tropomodulin (ETMOD, D9S57E) ENST00000375175.1 tropomodulin (ETMOD, D9S57E) ENST00000451595.1 putative novel transcript ENST00000375173.1 novel protein PP4189 (LOC158427) ENST00000375172.1 novel protein PP4189 (LOC158427) ENST00000341170.4 novel protein PP4189 (LOC158427) ENST00000375165.1 novel protein PP4189 (LOC158427) ENST00000375163.1 novel protein PP4189 (LOC158427) ENST00000484708.1 novel transcript ENST00000375147.3 continues from bA244N9.3.1 in Em:AL162385 ENST00000375147.3 nuclear cap binding protein subunit 1, 80kDa (NCBP, CBP80) ENST00000478100.1 nuclear cap binding protein subunit 1, 80kDa (NCBP, CBP80) ENST00000375130.1 nuclear cap binding protein subunit 1, 80kDa (NCBP, CBP80) ENST00000491445.1 nuclear cap binding protein subunit 1, 80kDa (NCBP, CBP80) ENST00000437864.1 putative novel transcript ENST00000375128.4 xeroderma pigmentosum, complementation group A (XP1, XPAC) ENST00000462523.1 xeroderma pigmentosum, complementation group A (XP1, XPAC) ENST00000485042.1 xeroderma pigmentosum, complementation group A (XP1, XPAC) ENST00000496104.1 xeroderma pigmentosum, complementation group A (XP1, XPAC) ENST00000400056.2 keratin 18 (KRT18) pseudogene ENST00000430058.1 putative novel transcript ENST00000375119.3 Nef associated protein 1 (NAP1) ENST00000375118.1 Nef associated protein 1 (NAP1) ENST00000478126.1 Nef associated protein 1 (NAP1) ENST00000375117.4 Nef associated protein 1 (NAP1) ENST00000471580.1 Nef associated protein 1 (NAP1) ENST00000455506.1 Nef associated protein 1 (NAP1) ENST00000375112.1 hemogen (EDAG, EDAG-1) ENST00000447173.1 acidic (leucine-rich) nuclear phosphoprotein 32 family, member B (APRIL, SSP29, PHAPI2) ENST00000339399.4 acidic (leucine-rich) nuclear phosphoprotein 32 family, member B (APRIL, SSP29, PHAPI2) ENST00000473205.1 acidic (leucine-rich) nuclear phosphoprotein 32 family, member B (APRIL, SSP29, PHAPI2) ENST00000486769.1 acidic (leucine-rich) nuclear phosphoprotein 32 family, member B (APRIL, SSP29, PHAPI2) ENST00000411981.1 putative novel transcript ENST00000210444.5 N-acetylneuraminic acid synthase (sialic acid synthase) (SAS) ENST00000495319.1 N-acetylneuraminic acid synthase (sialic acid synthase) (SAS) ENST00000480925.1 N-acetylneuraminic acid synthase (sialic acid synthase) (SAS) ENST00000461452.1 N-acetylneuraminic acid synthase (sialic acid synthase) (SAS) ENST00000415280.1 N-acetylneuraminic acid synthase (sialic acid synthase) (SAS) ENST00000427646.1 N-acetylneuraminic acid synthase (sialic acid synthase) (SAS) ENST00000375098.3 alternative 3' UTR ENST00000478530.1 tripartite motif-containing 14 (KIAA0129) ENST00000342043.3 alternative 3' UTR ENST00000343933.5 Coronin, actin-binding protein, 2A (IR10,WDR2) ENST00000375077.4 Coronin, actin-binding protein, 2A (IR10,WDR2) ENST00000375064.1 TBC1 domain family, member 2 (PARIS1, PARIS-1,DKFZP761D1823, DKFZp761D1823) ENST00000375066.5 TBC1 domain family, member 2 (PARIS1, PARIS-1,DKFZP761D1823, DKFZp761D1823) ENST00000342112.5 TBC1 domain family, member 2 (PARIS1, PARIS-1,DKFZP761D1823, DKFZp761D1823) ENST00000375063.1 TBC1 domain family, member 2 (PARIS1, PARIS-1,DKFZP761D1823, DKFZp761D1823) ENST00000493589.1 TBC1 domain family, member 2 (PARIS1, PARIS-1,DKFZP761D1823, DKFZp761D1823) ENST00000465784.1 TBC1 domain family, member 2 (PARIS1, PARIS-1,DKFZP761D1823, DKFZp761D1823) ENST00000465784.1 non-canonical donor splice site at 1st exon ENST00000428299.1 (FLJ10702) pseudogene ENST00000259455.2 G protein-coupled receptor 51 (HG20, GABBR2, GPRC3B, GABABR2) ENST00000477471.1 G protein-coupled receptor 51 (HG20, GABBR2, GPRC3B, GABABR2) ENST00000420492.1 CDC10 cell division cycle 10 homolog (S. cerevisiae) (SEPT7) pseudogene ENST00000353234.4 DKFZp686D24121 ENST00000493393.1 novel transcript ENST00000466120.1 novel transcript ENST00000375011.3 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12) ENST00000470473.1 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12) ENST00000433997.1 putative novel transcript ENST00000449172.1 non-metastatic cells 2, protein (NM23B) expressed in (NME2) pseudogene ENST00000547314.1 alternative 5' UTR ENST00000374994.4 transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kDa) ENST00000374990.2 NP_001124388.1 ENST00000549766.1 not organism-supported ENST00000552516.1 not organism-supported ENST00000548365.1 alternative 5' UTR ENST00000450399.1 putative novel transcript ENST00000498603.1 protein translocation complex beta (SEC61B) ENST00000223641.4 protein translocation complex beta (SEC61B) ENST00000481573.1 protein translocation complex beta (SEC61B) ENST00000409686.1 novel protein similar to KRT8 ENST00000413271.1 putative novel transcript ENST00000427039.1 novel transcript (FLJ32899) ENST00000395097.2 nuclear receptor subfamily 4, group A, member 3 ENST00000338488.4 nuclear receptor subfamily 4, group A, member 3 ENST00000330847.1 nuclear receptor subfamily 4, group A, member 3 ENST00000259400.6 syntaxin 17 ENST00000531035.1 alternative 5' UTR ENST00000525640.1 alternative 5' UTR ENST00000534052.1 alternative 5' UTR ENST00000526607.1 alternative 5' UTR ENST00000262455.6 thioredoxin domain containing 4 (endoplasmic reticulum) (ERP44, ERp44,KIAA0573) ENST00000420996.1 pseuodgene similar to part of UPF3 regulator of nonsense transcripts homolog A (yeast) (HUPF3A, RENT3A) (UPF3A) ENST00000262457.2 inversin ENST00000496467.1 inversin ENST00000480309.1 inversin ENST00000262456.2 inversin ENST00000374921.3 inversin ENST00000466647.1 inversin ENST00000460636.1 inversin ENST00000443417.1 ribosomal protein S2 (RPS2) pseudogene ENST00000424456.1 novel pseudogene ENST00000477648.1 novel transcript ENST00000429235.1 novel protein (FLJ20287) ENST00000398977.2 alternative 5' UTR ENST00000374886.3 alternative 5' UTR ENST00000489377.1 novel transcript ENST00000418987.1 actin, beta (ACTB) pseudogene ENST00000457882.1 ribosomal protein L24 (RPL24) pseudogene ENST00000436818.2 glyceraldehyde-3-phosphate dehydrogenase (GAPD) pseudogene ENST00000456287.1 continues from bA70K10.1.5 in Em:AL161631 ENST00000456287.1 continued as bA35N6.1.5 in Em:AL359893 ENST00000456287.1 novel protein (FLJ20300) ENST00000374871.1 continues from bA70K10.1.2 in Em:AL161631 ENST00000374871.1 continued as bA35N6.1.2 in Em:AL359893 ENST00000374871.1 novel protein (FLJ20300) ENST00000374871.1 alternatively spliced 5' UTR, shares CDS with bA70K10.1.1 ENST00000374871.1 alternative 5' UTR ENST00000494890.1 novel transcript ENST00000463206.1 novel transcript ENST00000491474.1 novel transcript ENST00000417933.1 pseudogene similar to part of the transient receptor potential cation channel (TRP) family of proteins ENST00000429016.1 novel pseudogene ENST00000447628.1 RINZF zinc finger protein pseudogene ENST00000395051.3 bile acid Coenzyme A: amino acid N-acyltransferase (glycine N-choloyltransferase) (BAT) ENST00000424250.1 novel pseudogene ENST00000374865.4 mitochondrial ribosomal protein L50 (MRP-L50, FLJ20493) (mitochondrial 39S ribosomal protein L50) ENST00000374861.3 zinc finger protein 189 ENST00000339664.2 zinc finger protein 189 ENST00000259395.4 zinc finger protein 189 ENST00000374855.4 aldolase B, fructose-bisphosphate ENST00000374853.1 aldolase B, fructose-bisphosphate ENST00000468981.1 aldolase B, fructose-bisphosphate ENST00000425734.1 novel transcript ENST00000450109.1 novel transcript ENST00000424154.1 novel transcript ENST00000431507.1 novel transcript ENST00000374848.3 novel protein ENST00000374847.1 alternatively spliced 5' UTR, shares CDS with bA490D19.7.1 ENST00000374847.1 novel protein ENST00000374847.1 alternative 5' UTR ENST00000374851.1 alternatively spliced 5' UTR, shares CDS with bA490D19.7.1 ENST00000374851.1 novel protein ENST00000374851.1 alternative 5' UTR ENST00000482920.1 novel transcript ENST00000418219.1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa (NDUFA4) pseudogene ENST00000374819.2 alternative 5' UTR ENST00000479306.1 alternative 5' UTR ENST00000466817.1 alternative 5' UTR ENST00000361820.3 glutamate receptor, ionotropic, N-methyl-D-aspartate 3A (NR3A, NMDAR-L) ENST00000479772.1 glutamate receptor, ionotropic, N-methyl-D-aspartate 3A (NR3A, NMDAR-L) ENST00000374806.1 protein phosphatase 3 (formerly 2B), regulatory subunit B, 19kDa, beta isoform (calcineurin B, type II) ENST00000453537.1 NADH dehydrogenase 3, mitochondrial (MTND3) pseudogene ENST00000446421.1 a binder of Arl Two (BART1) pseudogene ENST00000448515.1 novel transcript ENST00000454390.1 novel pseudogene ENST00000374801.3 novel protein ENST00000430329.1 novel pseudogene ENST00000430854.1 phosphoribosyl pyrophosphate synthetase 2 (PRPS2) pseudogene ENST00000374798.3 NMD exception ENST00000487798.1 NMD exception ENST00000429577.1 pseudogene similar to part of NADH dehydrogenase 5 (MTND5) ENST00000411575.1 novel transcript ENST00000455051.1 novel transcript ENST00000425157.1 putative novel transcript ENST00000421507.1 putative novel transcript ENST00000440179.1 SMC2 structural maintenance of chromosomes 2-like 1 (yeast) (CAPE, CAP-E, hCAP-E) ENST00000374793.3 SMC2 structural maintenance of chromosomes 2-like 1 (yeast) (CAPE, CAP-E, hCAP-E) ENST00000374787.3 alternatively spliced 5' UTR, shares CDS with bA82L2.1.1 ENST00000374787.3 SMC2 structural maintenance of chromosomes 2-like 1 (yeast) (CAPE, CAP-E, hCAP-E) ENST00000374787.3 alternative 5' UTR ENST00000493955.1 SMC2 structural maintenance of chromosomes 2-like 1 (yeast) (CAPE, CAP-E, hCAP-E) ENST00000269395.5 novel pseudogene ENST00000277216.3 novel olfactory (seven transmembrane helix) receptor ENST00000335040.1 novel olfactory (seven transmembrane helix) receptor ENST00000430667.1 pseudogene similar to part of novel olfactory (seven transmembrane helix) receptor ENST00000259362.1 novel olfactory (seven transmembrane helix) receptor ENST00000457612.1 olfactory receptor, family 1, subfamily A, member 1 (OR17-1) (OR1A1) pseudogene ENST00000412501.1 novel olfactory (seven transmembrane helix) receptor pseudogene ENST00000374767.4 novel protein (DKFZp564D177) ENST00000471001.1 novel transcript ENST00000460936.1 novel protein (FLJ11275) ENST00000374762.3 novel protein (FLJ11275) ENST00000461177.1 novel transcript ENST00000374736.3 ATP-binding cassette, sub-family A (ABC1), member 1 (TGD, CERP, HDLDT1) ENST00000494467.1 ATP-binding cassette, sub-family A (ABC1), member 1 (TGD, CERP, HDLDT1) ENST00000423487.2 ATP-binding cassette, sub-family A (ABC1), member 1 (FLJ14266, TGD, CERP, HDLDT1) ENST00000374733.1 ATP-binding cassette, sub-family A (ABC1), member 1 (TGD, CERP, HDLDT1) ENST00000435915.1 putative novel transcript ENST00000457720.1 putative novel transcript ENST00000423731.1 pseudogene similar to reverse transcriptase proteins ENST00000374723.1 CDw92 antigen (CDW92) (CTL1, choline transporter-like protein) ENST00000470972.1 CDw92 antigen (CDW92) (CTL1, choline transporter-like protein) ENST00000374720.3 alternatively spliced in 3' UTR, shares CDS with bA287A8.1.2 ENST00000374720.3 alternative 3' UTR ENST00000374720.3 CDw92 antigen (CDW92) (FLJ12487, CTL1, choline transporter-like protein) ENST00000374724.1 CDw92 antigen (CDW92) (CTL1, choline transporter-like protein) ENST00000436716.1 putative novel transcript ENST00000374707.1 cystatin and DUF19 domain containing 1 (similar to fibronectin type 3 and SPRY domain-containing protein (FSD1)) ENST00000443361.1 pseudogene similar to KIAA1272, KIAA0884, Drosophila CG5521 and rat Tulip 1 and 2 proteins ENST00000421614.1 putative novel transcript ENST00000223528.2 Fukuyama type congenital muscular dystrophy protein (fukutin) ENST00000448551.1 alternatively spliced in 5' UTR; shares CDS with bA235C23.2.1 ENST00000448551.1 Fukuyama type congenital muscular dystrophy protein (fukutin) ENST00000448551.1 alternative 5' UTR ENST00000490134.1 Fukuyama type congenital muscular dystrophy protein (fukutin) ENST00000479846.1 Fukuyama type congenital muscular dystrophy protein (fukutin) ENST00000374705.4 Fukuyama type congenital muscular dystrophy protein (fukutin) ENST00000457847.1 Fukuyama type congenital muscular dystrophy protein (fukutin) ENST00000374692.3 novel protein (FLJ10493) ENST00000434214.1 alternatively spliced 5' UTR, shares CDS with bA169B16.1.2 ENST00000434214.1 novel protein ENST00000434214.1 alternative 5' UTR ENST00000374688.1 novel protein ENST00000435034.1 novel protein ENST00000451560.1 novel protein ENST00000443781.1 FUS interacting protein (serine-arginine rich) 1 (FUSIP1) pseudogene ENST00000421655.1 novel (FLJ20483) pseudogene ENST00000435663.1 solute carrier family 25 (mitochondrial carrier; adenine nucleotide transclocator), member 6 (SLC25A6) pseudogene ENST00000445897.1 novel transcript ENST00000425709.1 novel transcript ENST00000435485.1 novel transcript ENST00000430534.1 novel transcript ENST00000446206.1 novel transcript ENST00000411451.1 novel transcript (FLJ36044) ENST00000444985.1 novel transcript (FLJ36044) ENST00000428997.1 pseudogene similar to part of constitutive photomorphogenic protein, (COP1) ENST00000277225.5 novel zinc finger protein (FLJ14960, KIAA1803) ENST00000374686.2 novel zinc finger protein (FLJ14960, KIAA1803) ENST00000441147.2 NAGNAG splice site ENST00000497489.1 this variant and one or more of variant fragments .1.3 .1.6 and .1.7 could be part of one single variant ENST00000497489.1 novel transcript ENST00000469433.1 this variant and one or more of variant fragments .1.6 and .1.7 could be part of one single variant ENST00000469433.1 novel transcript ENST00000479166.1 this variant and one or more of variant fragments .1.5, .1.6 and .1.7 could be part of one single variant ENST00000479166.1 novel transcript ENST00000427098.1 this variant and one or more of variant fragments .1.5 and .1.6 could be part of one single variant ENST00000427098.1 novel zinc finger protein (FLJ14960, KIAA1803) ENST00000482115.1 this variant and one or more of variant fragments .1.4, .1.5, .1.6 and .1.8 could be part of one single variant ENST00000482115.1 novel transcript ENST00000483287.1 this variant and one or more of variant fragments .1.3, .1.4, .1.5, .1.7 and .1.8 could be part of one single variant ENST00000483287.1 novel transcript ENST00000451160.1 novel transcript ENST00000439901.1 novel transcript (FLJ40387) ENST00000418656.1 novel transcript (FLJ40387) ENST00000444758.1 ribosomal protein L7a (RPL7A) pseudogene ENST00000417622.1 novel pseudogene ENST00000422849.1 MMRP19 pseudogene ENST00000427833.1 novel transcript ENST00000415694.1 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) (KPNA2) pseudogene ENST00000419616.1 RA23B homolog B (S. cerevisiae) (P58, HR23B, HHR23B) ENST00000419616.1 alternative 5' UTR ENST00000419616.1 alternatively spliced in 5' UTR, shares CDS with bA131A5.1.1 ENST00000358015.3 RA23B homolog B (S. cerevisiae) (P58, HR23B, HHR23B) ENST00000442587.1 RA23B homolog B (S. cerevisiae) (P58, HR23B, HHR23B) ENST00000457811.1 RA23B homolog B (S. cerevisiae) (P58, HR23B, HHR23B) ENST00000457811.1 this variant and either of variant fragments .1.3 or .1.2 could be part of one single variant ENST00000423523.1 novel transcript ENST00000415302.1 novel transcript ENST00000444648.1 high-mobility group nucleosomal binding domain 2 (HMGN2) pseudogene ENST00000374672.4 NP_004226.3 ENST00000439281.1 alternative 5' UTR ENST00000420475.1 alternative 5' UTR ENST00000454576.1 ribosomal protein S16 (RPS16) pseudogene ENST00000422463.1 peptidylprolyl isomerase A (cyclophilin A) (PPIA) pseudogene ENST00000449233.1 small EDRK-rich factor 2 (SERF2) pseudogene ENST00000449183.1 ribosomal protein S15a (RPS15A) pseudogene ENST00000394891.3 ribosomal protein L31 (RPL31) pseudogene ENST00000431135.1 novel (FLJ31709) pseudogene ENST00000453455.1 putative novel transcript ENST00000306634.3 ribosomal protein L36 (RPL36) pseudogene ENST00000415465.1 putative novel transcript ENST00000426082.1 ribosomal protein L36A (RPL36A) pseudogene ENST00000451069.1 ATP synthase F chain (mitochondrial) pseudogene ENST00000374647.5 inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein ENST00000495759.1 inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein ENST00000467959.1 inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein ENST00000443348.1 novel protein ENST00000322940.6 chromosome 9 open reading frame 6 ENST00000466200.1 chromosome 9 open reading frame 6 ENST00000374624.3 chromosome 9 open reading frame 6 ENST00000445175.1 chromosome 9 open reading frame 6 ENST00000325551.4 catenin (cadherin-associated protein), alpha-like 1 ENST00000374595.4 catenin (cadherin-associated protein), alpha-like 1 ENST00000374594.1 catenin (cadherin-associated protein), alpha-like 1 ENST00000488130.1 catenin (cadherin-associated protein), alpha-like 1 ENST00000374593.4 catenin (cadherin-associated protein), alpha-like 1 ENST00000374586.3 NP_114401.2 ENST00000482868.1 chromosome 9 open reading frame 5 ENST00000374581.3 chromosome 9 open reading frame 4 ENST00000374566.3 erythrocyte membrane protein band 4.1 like 4B ENST00000374566.3 frame shift in exon 25 changes proetin translation from that in Tr:Q9H329 ENST00000374557.3 erythrocyte membrane protein band 4.1 like 4B ENST00000423638.1 NADH dehydrogenase subunit 2 pseudogene ENST00000447271.1 putative novel transcript ENST00000374541.1 protein tyrosine phosphatase, non-receptor type 3 ENST00000497739.1 protein tyrosine phosphatase, non-receptor type 3 ENST00000435027.1 putative novel transcript ENST00000442962.1 pseudogene similar to mouse Ybox transcription factor ENST00000374531.2 NP_001032370.1 ENST00000314527.4 NP_443749.4 ENST00000449258.1 putative novel transcript ENST00000374530.3 NP_009134.1 ENST00000302798.7 NP_671492.1 ENST00000374525.1 NP_001004065.2 ENST00000485762.1 A kinase (PRKA) anchor protein 2 ENST00000418441.1 ribosomal protein L21 (RPL21) pseudogene ENST00000400613.4 novel protein ENST00000374517.5 thioredoxin (TRX) ENST00000374515.5 thioredoxin (TRX) ENST00000487892.1 thioredoxin (TRX) ENST00000374510.4 novel protein similar to thioredoxin (TXN) ENST00000461950.1 novel transcript ENST00000374507.4 novel protein similar to thioredoxin (TXN) ENST00000374469.1 likely ortholog of mouse polydom (POLYDOM) (contains FLJ90753, FLJ90719, DKFZp667O1713) ENST00000374469.1 likely ortholog of mouse polydom (POLYDOM) ENST00000297826.5 likely ortholog of mouse polydom (POLYDOM) (FLJ90754) ENST00000476205.1 novel transcript ENST00000467821.1 novel transcript (FLJ14964) ENST00000374461.1 likely ortholog of mouse polydom (POLYDOM) (contains FLJ13529) ENST00000374461.1 likely ortholog of mouse polydom (POLYDOM) ENST00000451108.1 putative novel transcript ENST00000189978.4 muscle, skeletal, receptor tyrosine kinase ENST00000416899.1 muscle, skeletal, receptor tyrosine kinase ENST00000374439.1 muscle, skeletal, receptor tyrosine kinase ENST00000374438.1 muscle, skeletal, receptor tyrosine kinase ENST00000446460.1 ribosomal protein S21 (RPS21) pseudogene ENST00000374430.1 alternative 5' UTR ENST00000358883.4 alternative 5' UTR ENST00000441240.1 alternative 5' UTR ENST00000426204.1 putative novel transcript ENST00000302681.1 novel olfactory (seven transmembrane helix) receptor ENST00000338205.4 novel protein (includes KIAA0368) ENST00000374383.1 novel protein (includes KIAA0368) ENST00000465499.1 novel transcript ENST00000358151.4 KIAA1962 protein similar to zinc finger protein HIT-10 ENST00000374374.3 KIAA1962 protein similar to zinc finger protein HIT-10 ENST00000309235.5 KIAA1962 protein similar to zinc finger protein HIT-10 ENST00000466771.1 leukotriene B4 12-hydroxydehydrogenase (MGC34943) ENST00000309195.5 leukotriene B4 12-hydroxydehydrogenase (MGC34943) ENST00000374324.1 leukotriene B4 12-hydroxydehydrogenase (MGC34943) ENST00000422125.1 leukotriene B4 12-hydroxydehydrogenase (MGC34943) ENST00000374313.1 leukotriene B4 12-hydroxydehydrogenase (MGC34943) ENST00000374308.1 leukotriene B4 12-hydroxydehydrogenase (MGC34943) ENST00000485319.1 leukotriene B4 12-hydroxydehydrogenase (MGC34943) ENST00000450154.1 putative novel transcript ENST00000374306.1 novel protein similar to KIAA0563-related gene (LOC286331) ENST00000374304.1 novel protein similar to KIAA0563-related gene (LOC286331) ENST00000463589.1 non-organsim_supported ENST00000394779.3 FLJ44067 ENST00000374283.5 FLJ32779 ENST00000374279.3 UDP-glucose ceramide glucosyltransferase ENST00000489355.1 UDP-glucose ceramide glucosyltransferase ENST00000490110.1 UDP-glucose ceramide glucosyltransferase ENST00000495085.1 UDP-glucose ceramide glucosyltransferase ENST00000474306.1 UDP-glucose ceramide glucosyltransferase ENST00000366375.2 novel transcript ENST00000355396.3 novel protein (contains DKFZP761E1824) ENST00000415074.1 novel protein ENST00000482851.1 novel transcript ENST00000451825.1 ribosomal protein L29 (RPL29) pseudogene ENST00000374257.1 regulator of differentiation 1 ENST00000374255.2 regulator of differentiation 1 ENST00000343327.2 regulator of differentiation 1 ENST00000487997.1 regulator of differentiation 1 ENST00000210227.4 regulator of differentiation 1 ENST00000450374.1 regulator of differentiation 1 ENST00000443139.1 heat shock 10kDa protein 1 (chaperonin 10) (HSPE1) pseudogene ENST00000448036.1 ribosomal protein L32 (RPL32) pseudogene ENST00000398805.3 novel protein ENST00000398803.1 novel protein (MGC10940) ENST00000488101.1 novel protein ENST00000467434.1 novel transcript ENST00000480881.1 novel transcript ENST00000412934.2 novel transcript ENST00000457681.1 novel protein ENST00000460965.1 novel transcript ENST00000463223.1 putative novel transcript ENST00000337530.6 novel protein ENST00000374244.3 novel protein ENST00000502685.1 vacuolar protein sorting 33B (VPS33B) pseudogene ENST00000374242.3 novel gene (HSPC043) ENST00000374236.1 novel protein ENST00000481146.1 novel transcript ENST00000374234.1 novel protein ENST00000497712.1 novel transcript ENST00000476599.1 novel transcript ENST00000440009.1 putative novel transcript ENST00000374232.3 novel protein similar to sorting nexin 7 (SNX7) ENST00000416585.1 novel protein similar to sorting nexin 7 (SNX7) ENST00000374228.4 thymic stromal co-transporter ENST00000491462.1 thymic stromal co-transporter ENST00000427548.1 novel transcript (FLJ38524) ENST00000374227.3 zinc finger protein 37 homolog (mouse) ENST00000423546.1 novel transcript ENST00000453010.1 novel transcript (DKFZp686A0127) ENST00000446284.1 novel protein (KIAA0674) ENST00000489645.1 this variant and one of variant fragments .3 or .4 could be part of one single variant ENST00000489645.1 novel transcript ENST00000414250.1 novel protein (KIAA0674) ENST00000493847.1 this variant and variant fragment .5 could be part of one single variant ENST00000493847.1 novel transcript ENST00000462889.1 this variant and variant fragment .5 could be part of one single variant ENST00000462889.1 novel transcript ENST00000374212.4 solute carrier family 31 (copper transporters), member 1 (CTR1, COPT1) ENST00000496650.1 solute carrier family 31 (copper transporters), member 1 (CTR1, COPT1) ENST00000374210.5 solute carrier family 31 (copper transporters), member 1 (CTR1, COPT1) ENST00000490408.1 novel transcript ENST00000374206.3 CDC26 subunit of anaphase promoting complex (CDC26) ENST00000374199.3 PRP4 pre-mRNA processing factor 4 homolog (yeast) (HPRP4, Prp4p, HPRP4P) ENST00000374198.3 PRP4 pre-mRNA processing factor 4 homolog (yeast) (HPRP4, Prp4p, HPRP4P) ENST00000488937.1 PRP4 pre-mRNA processing factor 4 homolog (yeast) (HPRP4, Prp4p, HPRP4P) ENST00000441031.2 alternative 5' UTR ENST00000416588.2 alternative 5' UTR ENST00000478815.1 alternative 5' UTR ENST00000374183.4 novel protein similar to B-box and SPRY-domain containing protein (BSPRY) (FLJ20150) ENST00000462085.1 novel transcript ENST00000238379.5 novel protein (FLJ39748) ENST00000374180.3 novel protein (FLJ39748) ENST00000374180.3 alternatively spliced 5' UTR, shares CDS with bA10I9.3.1 ENST00000374180.3 alternative 5' UTR ENST00000485934.1 novel transcript ENST00000448137.1 alternative 5' UTR ENST00000452726.1 alternative 5' UTR ENST00000445750.1 alternative 5' UTR ENST00000374171.4 alternatively spliced 5' UTR, shares CDS with bA10I9.5.1 ENST00000374171.4 alternative 5' UTR ENST00000490544.1 novel transcript ENST00000374165.1 novel protein ENST00000288462.4 novel protein ENST00000288462.4 alternatively spliced 5' UTR, shares CDS with bA10I9.6.1 ENST00000288462.4 alternative 5' UTR ENST00000488259.1 regulator of G-protein signalling 3 (C2PA, RGP3, FLJ20370, PDZ-RGS3) ENST00000343817.5 NP_570613.2 ENST00000462143.1 alternative 5' UTR ENST00000496275.1 regulator of G-protein signalling 3 (C2PA, RGP3, FLJ20370, PDZ-RGS3) ENST00000471324.1 alternative 5' UTR ENST00000467805.1 alternative 5' UTR ENST00000462403.1 confirm experimentally ENST00000428429.1 novel transcript ENST00000437712.1 novel transcript (FLJ31516) ENST00000428292.1 novel transcript ENST00000398764.2 novel pseudogene ENST00000437852.1 programmed cell death 2 (PDCD2) pseudogene ENST00000374126.5 novel C2H2 type zinc finger protein ENST00000452710.1 contiued from bA534I8.2.3 in Em:AL162393 ENST00000452710.1 novel C2H2 type zinc finger protein ENST00000374124.4 novel C2H2 type zinc finger protein ENST00000374124.4 contiued from bA534I8.2.2 in Em:AL162393 ENST00000481558.1 novel transcript ENST00000470105.1 novel transcript ENST00000498016.1 novel transcript ENST00000374118.3 novel protein similar to mouse kinesin 12 (LOC113220) ENST00000259410.7 novel protein similar to mouse kinesin 12 (LOC113220) ENST00000468460.1 novel transcript ENST00000473174.1 novel transcript ENST00000479670.1 novel transcript ENST00000491059.1 novel transcript ENST00000494090.2 novel transcript ENST00000259396.8 orosomucoid 1 (AGP1, AGP-A) ENST00000477456.1 orosomucoid 1 (AGP1, AGP-A) ENST00000431067.2 orosomucoid 2 (AGP2, AGP-B) ENST00000374088.3 AT-hook transcription factor AKNA ENST00000492875.1 AT-hook transcription factor AKNA ENST00000223791.3 AT-hook transcription factor AKNA ENST00000491133.1 novel transcript ENST00000312033.3 AT-hook transcription factor AKNA ENST00000448674.1 putative novel transcript ENST00000265134.6 novel protein (DKFZP434N014) ENST00000374059.3 novel protein (DKFZP434N014) ENST00000362057.3 novel protein (DKFZP434N014) ENST00000374057.3 novel protein (DKFZP434N014) ENST00000480518.1 novel transcript ENST00000423876.1 pseudogene similar to part of ARP3 actin-related protein 3 homolog (yeast) (ACTR3) ENST00000374050.3 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 1 (ATP6G, ATP6GL) ENST00000473413.1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 1 (ATP6G, ATP6GL) ENST00000374049.4 novel protein (DKFZp547P234) ENST00000288502.4 novel protein (DKFZp547P234) ENST00000471206.1 novel transcript ENST00000482552.1 novel transcript ENST00000423632.1 putative novel transcript ENST00000415101.1 putative novel transcript ENST00000436752.1 putative novel transcript ENST00000412010.1 pseudogene similar to part of ribosomal protein L7 (RPL7) ENST00000374045.3 tumor necrosis factor (ligand) superfamily, member 15 (TL1, VEG1) ENST00000374044.1 Protein translation differs to that published in Tr:O95150, with the third amino acid changed form R to H. ENST00000374044.1 tumor necrosis factor (ligand) superfamily, member 15 (TL1, VEG1) ENST00000380194.3 PRP4 pre-mRNA processing factor 4 homolog B (PR4H, Prp4, PRP4H, PRP4K, KIAA0536) (PRPF4B) pseudogene ENST00000474301.1 tumor necrosis factor (ligand) superfamily, member 8 (CD153, CD30L, CD30LG) ENST00000223795.2 tumor necrosis factor (ligand) superfamily, member 8 (CD153, CD30L, CD30LG) ENST00000341037.4 not organism-supported ENST00000537320.1 confirm experimentally ENST00000537320.1 not organism-supported ENST00000544972.1 not organism-supported ENST00000460345.1 tenascin C (hexabrachion) (TN, HXB) ENST00000498724.1 tenascin C (hexabrachion) (TN, HXB) ENST00000476680.1 tenascin C (hexabrachion) (TN, H3B) ENST00000473855.1 tenascin C (hexabrachion) (TN, HXB) ENST00000481475.1 tenascin C (hexabrachion) (TN, HXB) ENST00000534839.1 alternative 5' UTR ENST00000423637.1 novel transcript ENST00000374016.1 deleted in esophageal cancer 1 (DEC1) ENST00000477580.1 novel transcript ENST00000484171.1 novel transcript ENST00000444701.1 putative novel transcript ENST00000433546.1 novel transcript ENST00000374014.3 EST-YD1 protein ENST00000416507.1 putative novel transcript ENST00000328252.3 pregnancy-associated plasma protein A ENST00000460463.1 pregnancy-associated plasma protein A ENST00000483254.1 pregnancy-associated plasma protein A ENST00000436470.1 putative novel transcript ENST00000438048.1 putative novel transcript ENST00000288520.5 NP_937829.3 ENST00000417725.1 astrotactin2 (KIAA0634) ENST00000358637.4 astrotactin 2 (KIAA0634) ENST00000418250.1 novel transcript ENST00000423715.1 novel transcript ENST00000373983.1 tripartite motif-containing 32 ENST00000411410.1 tripartite motif-containing 32 ENST00000436524.1 putative novel transcript ENST00000450938.1 novel transcript ENST00000436855.1 ribosomal protein L35a (RPL35A) pseudogene ENST00000394487.4 toll-like receptor 4 ENST00000355622.6 toll-like receptor 4 ENST00000472304.1 toll-like receptor 4 ENST00000490685.1 toll-like receptor 4 ENST00000421509.1 novel transcript ENST00000449730.1 novel transcript ENST00000413759.1 tumor protein, translationally-controlled 1 (TPT1) pseudogene ENST00000450292.1 putative novel transcript ENST00000456032.1 putative novel transcript ENST00000437576.1 pseudogene similar to part of tubulin beta chain ENST00000482797.1 deleted in bladder cancer chromosome region candidate 1 (IB3089A) ENST00000373969.1 deleted in bladder cancer chromosome region candidate 1 (IB3089A) ENST00000373964.1 deleted in bladder cancer chromosome region candidate 1 (IB3089A) ENST00000454204.1 putative novel transcript ENST00000360190.4 NP_001011649 ENST00000430630.1 S-adenosylhomocysteine hydrolase (AHCY) pseudogene ENST00000493559.1 F-box and WD-40 domain protein 2 (FBW2) ENST00000373926.3 F-box and WD-40 domain protein 2 (FBW2) ENST00000453291.1 F-box and WD-40 domain protein 2 (FBW2) ENST00000474117.1 F-box and WD-40 domain protein 2 (FBW2) ENST00000476481.1 F-box and WD-40 domain protein 2 (FBW2) ENST00000437707.1 putative novel transcript ENST00000464488.1 UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 3 (B3GALT3) pseudogene ENST00000373920.1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 (S5B, KIAA0072, MGC23145) ENST00000210313.2 proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 (S5B, KIAA0072, MGC23145) ENST00000373903.1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 (S5B, KIAA0072, MGC23145) ENST00000496688.1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 (S5B, KIAA0072, MGC23145) ENST00000476949.1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 (S5B, KIAA0072, MGC23145) ENST00000471789.1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 5 (S5B, KIAA0072, MGC23145) ENST00000447891.1 novel transcript ENST00000442982.1 novel transcript ENST00000450803.1 novel transcript ENST00000432640.1 novel transcript ENST00000373896.3 novel protein (DKFZP727G051) ENST00000487555.1 novel protein (DKFZP727G051) ENST00000462229.1 noel transcript ENST00000436309.1 alternative 5' UTR ENST00000312189.6 DKFZP727G051 ENST00000456291.1 alternative 5' UTR ENST00000373887.3 TNF receptor-associated factor 1 ENST00000491018.1 centrosomal protein 1 (FAN, CEP110) ENST00000373845.1 centrosomal protein 1 (FAN, CEP110) ENST00000373844.1 centrosomal protein 1 (FAN, CEP110) ENST00000431571.1 centrosomal protein 1 (FAN, CEP110) ENST00000373865.1 novel protein ENST00000468952.1 novel transcript ENST00000373851.1 centrosomal protein 1 (FAN, CEP110) ENST00000373850.1 centrosomal protein 1 (FAN, CEP110) ENST00000373847.1 centrosomal protein 1 (FAN, CEP110) ENST00000452885.1 novel pseudogene ENST00000373840.4 RAB14, member RAS oncogene family (DKFZp762K0911) ENST00000451303.1 RAB14, member RAS oncogene family (DKFZp762K0911) ENST00000451303.1 Alternatively spliced 5' UTR, shares CDS with bA165P4.3.1 (partial) ENST00000451303.1 alternative 5' UTR ENST00000434663.1 novel transcript ENST00000455437.1 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2 (HO57, VATB, VPP3, Vma2, ATP6B2, ATP6B1B2 (ATP6V1B2) pseudogene ENST00000437135.1 putative novel transcript ENST00000414544.1 novel protein (MOST2) ENST00000286713.2 stomatin (BND7, EPB7, EPB72) ENST00000347359.2 stomatin (BND7, EPB7, EPB72) ENST00000440807.1 putative novel transcript ENST00000373793.3 Might code for a severely truncated form of the enzyme ENST00000481799.1 Might code for a severely truncated form of the enzyme ENST00000439613.1 high-mobility group box 1 (HMG1, HMG3, SBP-1) (HMGB1) psueodgene ENST00000436835.1 DAB2 interacting protein (AF9Q34, DIP1/2, KIAA1743) ENST00000489314.1 DAB2 interacting protein (AF9Q34, DIP1/2, KIAA1743) ENST00000465078.1 DAB2 interacting protein (AF9Q34, DIP1/2, KIAA1743) ENST00000309989.1 DAB2 interacting protein (AF9Q34, DIP1/2, KIAA1743) ENST00000487716.1 DAB2 interacting protein (AF9Q34, DIP1/2, KIAA1743) ENST00000459906.1 DAB2 interacting protein (AF9Q34, DIP1/2, KIAA1743) ENST00000434375.1 putative novel transcript ENST00000486362.1 putative novel transcript ENST00000373778.1 novel protein (LOC158135) ENST00000373778.1 novel transcript (LOC158135) ENST00000373776.3 novel protein (LOC158135) ENST00000487468.1 novel protein (LOC158135) ENST00000487468.1 novel transcript (LOC158135) ENST00000411790.1 novel transcript (LOC253142) ENST00000373768.3 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 8, 19kDa ENST00000373764.3 novel transcript (LOC254956) ENST00000373764.3 novel protein (LOC254956) ENST00000418632.1 novel protein (LOC254956) ENST00000418632.1 novel transcript (LOC254956) ENST00000486801.1 novel transcript ENST00000477017.1 putative novel transcript ENST00000340587.3 not organism-supported ENST00000560485.1 alternative 5' UTR ENST00000559529.1 alternative 5' UTR ENST00000417201.2 novel protein (MGC2734) ENST00000491850.1 novel transcript ENST00000483428.1 novel transcript ENST00000344641.3 mitochondrial ribosome recycling factor (MRRF) ENST00000441707.1 mitochondrial ribosome recycling factor (MRRF) (RRF, MRFF, MTRRF) ENST00000373729.1 mitochondrial ribosome recycling factor (MRRF) (RRF, MRFF, MTRRF) ENST00000373727.1 mitochondrial ribosome recycling factor (MRRF) (RRF, MRFF, MTRRF) ENST00000373728.1 mitochondrial ribosome recycling factor (MRRF) (RRF, MRFF, MTRRF) ENST00000470366.1 mitochondrial ribosome recycling factor (MRRF) (RRF, MRFF, MTRRF) ENST00000373724.1 mitochondrial ribosome recycling factor (MRRF) (RRF, MRFF, MTRRF) ENST00000467864.1 mitochondrial ribosome recycling factor (MRRF) (RRF, MRFF, MTRRF) ENST00000489572.1 mitochondrial ribosome recycling factor (MRRF) (RRF, MRFF, MTRRF) ENST00000223423.4 prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) ENST00000362012.2 prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) ENST00000426608.1 prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) ENST00000439471.1 putative novel transcript ENST00000433572.1 novel transcript ENST00000412262.1 novel transcript ENST00000335302.5 novel olfactory (seven transmembrane helix) receptor ENST00000340750.1 novel olfactory (seven transmembrane helix) receptor ENST00000304880.2 novel olfactory (seven transmembrane helix) receptor ENST00000373688.2 novel olfactory (seven transmembrane helix) receptor ENST00000448731.1 novel olfactory (seven transmembrane helix) receptor ENST00000431442.1 novel transcript ENST00000419604.1 novel transcript ENST00000304833.3 confirm experimentally ENST00000304833.3 NP_001004450.1 ENST00000309623.1 novel olfactory (seven transmembrane helix) receptor ENST00000456760.1 tousled-like kinase 1 (TLK1) pseudogene ENST00000259466.1 novel olfactory (seven transmembrane helix) receptor ENST00000304720.2 novel olfactory (seven transmembrane helix) receptor ENST00000425592.1 probable pseudogene ENST00000425592.1 novel protein ENST00000436632.1 phosducin-like ENST00000259467.4 phosducin-like ENST00000394285.3 phosducin-like ENST00000432816.1 keratin 18 (KRT18) pseudogene ENST00000373670.1 membrane-associated nucleic acid binding protein (MNAB) (FLJ23389) ENST00000498479.1 novel transcript ENST00000454740.1 membrane-associated nucleic acid binding protein (MNAB) (FLJ23389) ENST00000495727.1 novel transcript ENST00000373663.1 membrane-associated nucleic acid binding protein (MNAB) (FLJ20301, FLJ20713) ENST00000373663.1 translation start site further upstream than that in Tr:Q9NXE1 ENST00000373663.1 membrane-associated nucleic acid binding protein (MNAB) (FLJ23389) ENST00000398671.2 membrane-associated nucleic acid binding protein (MNAB) ENST00000475161.1 novel transcript ENST00000335387.5 membrane-associated nucleic acid binding protein (MNAB) (FLJ23389) ENST00000335387.5 non-canonical acceptor splice site st final exon ENST00000478216.1 novel transcript ENST00000471874.1 novel transcript ENST00000373659.3 zinc finger protein with interaction domain (ZID) ENST00000373656.3 zinc finger protein bioref (KIAA1572) ENST00000373654.1 zinc finger protein bioref (KIAA1572) ENST00000402311.1 alternative 5' UTR ENST00000392902.2 ribosomal protein S25 (RPS25) pseudogene ENST00000373642.1 G protein-coupled receptor 21 ENST00000422282.1 pseudogene similar to part of thyroid receptor interacting protein 15 (TRIP15) ENST00000449175.1 carries microRNA 600 ENST00000478973.2 not organism-supported ENST00000479114.2 alternative 5' UTR ENST00000373624.2 novel protein (KIAA1608, FLJ21129) ENST00000473039.1 novel transcript ENST00000373620.3 novel protein (KIAA1608, FLJ21129) ENST00000475421.1 this variant and one or more of variant fragments .6, .7, .8 and .11 could be part of one single variant ENST00000475421.1 putative novel transcript ENST00000491650.1 this variant and variant fragment .11 could be part of one single variant ENST00000491650.1 novel transcript ENST00000497135.1 novel transcript (KIAA1608, FLJ21129) ENST00000497135.1 this variant and one or more of variant fragments .5 and .11 could be part of one single variant ENST00000497135.1 this variant and one or more of variant fragments .11 and .5 could be part of one single variant ENST00000497135.1 novel transcript ENST00000373618.1 continued in Em:AC006450.1.2 in Em:AC006450; continues as bA558L8.1.2 in Em:AL161790 ENST00000373618.1 novel protein (KIAA1608, FLJ21129) ENST00000479305.1 this variant and one or more of variant fragments .5 and .11 could be part of one single variant ENST00000479305.1 novel transcript ENST00000462245.1 this variant and one or more of variant fragments .5 and .11 could be part of one single variant ENST00000462245.1 novel transcript ENST00000474676.1 novel transcript ENST00000475615.1 this variant and one or more of variant fragments .5 through .9 could be part of one single variant ENST00000475615.1 putative novel transcript ENST00000458025.1 putative novel transcript ENST00000423942.1 putative novel transcript ENST00000411924.1 LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) pseudogene (LSM5) ENST00000421400.1 phosphatidylinositol glycan, class F (PIGF) pseudogene ENST00000373603.1 alternatively spliced 5' UTR shares CDS with bA121A14.1.1 ENST00000373603.1 alternative 5' UTR ENST00000373603.1 NIMA (never in mitosis gene a)-related kinase 6 ENST00000373600.3 NIMA (never in mitosis gene a)-related kinase 6 ENST00000320246.5 NIMA (never in mitosis gene a)-related kinase 6 ENST00000444973.1 NIMA (never in mitosis gene a)-related kinase 6 ENST00000454453.1 NIMA (never in mitosis gene a)-related kinase 6 ENST00000373596.1 NIMA (never in mitosis gene a)-related kinase 6 ENST00000425237.1 NIMA (never in mitosis gene a)-related kinase 6 ENST00000423785.1 NIMA (never in mitosis gene a)-related kinase 6 ENST00000422297.1 NIMA (never in mitosis gene a)-related kinase 6 ENST00000447379.1 NIMA (never in mitosis gene a)-related kinase 6 ENST00000426157.1 putative novel transcript ENST00000437461.1 putative novel transcript ENST00000451007.1 putative novel transcript ENST00000259457.3 proteasome (prosome, macropain) subunit, beta type 7 ENST00000498485.1 proteasome (prosome, macropain) subunit, beta type, 7 ENST00000474081.1 proteasome (prosome, macropain) subunit, beta type, 7 ENST00000478817.1 proteasome (prosome, macropain) subunit, beta type, 7 ENST00000441097.1 proteasome (prosome, macropain) subunit, beta type 7 ENST00000466951.1 proteasome (prosome, macropain) subunit, beta type, 7 ENST00000373588.4 nuclear receptor subfamily 5, group A, member 1 ENST00000373587.3 nuclear receptor subfamily 5, group A, member 1 ENST00000455734.1 nuclear receptor subfamily 5, group A, member 1 ENST00000455734.1 alternative 5' UTR ENST00000369027.3 putative novel transcript ENST00000487099.1 nuclear receptor subfamily 6, group A, member 1 ENST00000440419.1 RAN binding protein 1 (RANBP1) pseudogene ENST00000446468.1 putative novel transcript ENST00000438380.1 novel transcript ENST00000331715.9 novel protein ENST00000373574.1 novel protein ENST00000373570.3 ribosomal protein L35 ENST00000493018.1 ribosomal protein L35 ENST00000487431.1 ribosomal protein L35 ENST00000348462.3 ribosomal protein L35 ENST00000495728.1 ribosomal protein L35 ENST00000353214.2 hypothetical protein similar to actin related protein 2/3 complex, subunit 5 ENST00000259477.6 hypothetical protein similar to actin related protein 2/3 complex, subunit 5 ENST00000465124.1 hypothetical protein similar to actin related protein 2/3 complex, subunit 5 ENST00000373555.4 golgi autoantigen, golgin subfamily a, 1 ENST00000475407.1 golgi autoantigen, golgin subfamily a, 1 ENST00000485337.1 golgi autoantigen, golgin subfamily a, 1 ENST00000373551.4 golgi autoantigen, golgin subfamily a, 1 ENST00000421514.1 golgi autoantigen, golgin subfamily a, 1 ENST00000336505.5 novel protein ENST00000487795.1 novel transcript ENST00000411625.1 Friedreich ataxia (FRDA) pseudogene ENST00000438206.1 putative novel transcript ENST00000373547.4 protein phosphatase 6, catalytic subunit ENST00000456642.1 protein phosphatase 6, catalytic subunit ENST00000430496.1 phosphoribosyl pyrophosphate synthetase 1 (PRPS1) pseudogene ENST00000444599.1 laminin receptor 1 (LAMR1) pseudogene ENST00000373544.1 Rab9 effector p40 (RAB9P40) ENST00000373538.3 Rab9 effector p40 (RAB9P40) ENST00000416065.1 Rab9 effector p40 (RAB9P40) ENST00000324460.6 heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa) ENST00000461379.1 alternative 5' UTR ENST00000495955.1 alternative 5' UTR ENST00000469498.1 novel transcript ENST00000453641.1 ribosomal protein S10 (RPS10) pseudogene ENST00000457398.1 novel pseudogene ENST00000458261.1 novel transcript ENST00000416693.1 methylation-controlled J protein (MCJ) pseudogene ENST00000373511.2 NP_001006620.1 ENST00000483937.1 mitogen-activated protein kinase associated protein 1 ENST00000444226.1 mitogen-activated protein kinase associated protein 1 ENST00000496658.1 mitogen-activated protein kinase associated protein 1 ENST00000437973.2 mitogen-activated protein kinase associated protein 1 ENST00000373496.3 alternative 5' UTR ENST00000433483.1 mitogen-activated protein kinase associated protein 1 ENST00000433483.1 this variant and variant fragment .1.6 could be part of one single variant ENST00000437097.1 putative novel transcript ENST00000444886.1 heterogeneous nuclear ribonucleoprotein A1 (HNRP1) pseudogene ENST00000373489.5 not organism-supported ENST00000497967.1 pre-B-cell leukemia transcription factor 3 ENST00000441473.1 putative novel transcript ENST00000419853.1 novel transcript ENST00000361171.3 novel protein (FLJ00022, FLJ00031) ENST00000489637.1 novel transcript ENST00000402437.2 novel protein ENST00000470567.1 novel transcript ENST00000489570.1 novel transcript ENST00000485886.1 novel transcript (FLJ00001) ENST00000454034.1 novel transcript ENST00000425153.1 putative novel transcript ENST00000526117.1 NP_002307.2 ENST00000373464.4 zinc finger protein 297B (ZNF297B)(ZNF-X, FLJ22470, KIAA0414) ENST00000373464.4 alternative 5' UTR; shares CDS with bA489N22.2.2 and bA489N22.2.3 ENST00000373464.4 alternative 5' UTR ENST00000450858.1 zinc finger protein 297B (ZNF297B)(ZNF-X, FLJ22470, KIAA0414) ENST00000450858.1 alternative 5' UTR; shares CDS with bA489N22.2.1 and bA489N22.2.3 ENST00000450858.1 alternative 5' UTR ENST00000373457.1 zinc finger protein 297B (ZNF297B)(ZNF-X, FLJ22470, KIAA0414) ENST00000373457.1 alternative 5' UTR; shares CDS with bA489N22.2.1 and bA489N22.2.2 ENST00000373457.1 alternative 5' UTR ENST00000319119.4 novel protein (KIAA1993)(LOC203249) ENST00000259351.5 Ral guanine nucleotide exchange factor RalGPS1A (RALGPS1A)(RALGEF2, KIAA0351) ENST00000394022.3 Ral guanine nucleotide exchange factor RalGPS1A (RALGPS1A)(RALGEF2, KIAA0351) ENST00000373439.1 Ral guanine nucleotide exchange factor RalGPS1A (RALGPS1A)(RALGEF2, KIAA0351) ENST00000394011.3 Ral guanine nucleotide exchange factor RalGPS1A (RALGPS1A)(RALGEF2, KIAA0351) ENST00000319107.4 Ral guanine nucleotide exchange factor RalGPS1A (RALGPS1A)(RALGEF2, KIAA0351) ENST00000472427.1 Ral guanine nucleotide exchange factor RalGPS1A (RALGPS1A)(RALGEF2, KIAA0351) ENST00000373436.1 Ral guanine nucleotide exchange factor RalGPS1A (RALGPS1A)(RALGEF2, KIAA0351) ENST00000480993.1 Ral guanine nucleotide exchange factor RalGPS1A (RALGPS1A)(RALGEF2, KIAA0351) ENST00000373434.1 Ral guanine nucleotide exchange factor RalGPS1A (RALGPS1A)(RALGEF2, KIAA0351) ENST00000477700.1 Ral guanine nucleotide exchange factor RalGPS1A (RALGPS1A)(RALGEF2, KIAA0351) ENST00000467325.1 Ral guanine nucleotide exchange factor RalGPS1A (RALGPS1A)(RALGEF2, KIAA0351) ENST00000438723.1 Ral guanine nucleotide exchange factor RalGPS1A (RALGPS1A)(RALGEF2, KIAA0351) ENST00000471643.1 Ral guanine nucleotide exchange factor RalGPS1A (RALGPS1A)(RALGEF2, KIAA0351) ENST00000373425.3 angiopoietin-like 2 (angiopoietin-related protein 2)(ANGPTL2)(ARP2, HARP) ENST00000373417.1 angiopoietin-like 2 (angiopoietin-related protein 2)(ANGPTL2)(ARP2, HARP) ENST00000470194.1 angiopoietin-like 2 (angiopoietin-related protein 2)(ANGPTL2)(ARP2, HARP) ENST00000491991.1 angiopoietin-like 2 (angiopoietin-related protein 2)(ANGPTL2)(ARP2, HARP) ENST00000453199.1 putative novel transcript ENST00000439286.1 novel protein ENST00000429629.1 novel transcript ENST00000446764.1 novel transcript ENST00000425970.1 novel transcript ENST00000485331.1 novel protein ENST00000495172.1 novel transcript ENST00000478696.1 novel transcript ENST00000496711.1 novel transcript ENST00000497703.1 novel transcript ENST00000463005.1 novel transcript ENST00000452976.1 putative novel transcript ENST00000439400.1 density-regulated protein (DENR)(DRP, DRP1, SMAP-3) pseudogene ENST00000373371.3 solute carrier family 2, (facilitated glucose transporter) member 8 (glucose transporter X1)(SLC2A8)(GLUT8, GLUTX1) ENST00000451404.1 solute carrier family 2, (facilitated glucose transporter) member 8 (glucose transporter X1)(SLC2A8)(GLUT8, GLUTX1) ENST00000476835.1 solute carrier family 2, (facilitated glucose transporter) member 8 (glucose transporter X1)(SLC2A8)(GLUT8, GLUTX1) ENST00000419917.1 solute carrier family 2, (facilitated glucose transporter) member 8 (glucose transporter X1)(SLC2A8)(GLUT8, GLUTX1) ENST00000373352.1 solute carrier family 2, (facilitated glucose transporter) member 8 (glucose transporter X1)(SLC2A8)(GLUT8, GLUTX1) ENST00000373360.3 solute carrier family 2, (facilitated glucose transporter) member 8 (glucose transporter X1)(SLC2A8)(GLUT8, GLUTX1) ENST00000419132.1 solute carrier family 2, (facilitated glucose transporter) member 8 (glucose transporter X1)(SLC2A8)(GLUT8, GLUTX1) ENST00000439597.1 solute carrier family 2, (facilitated glucose transporter) member 8 (glucose transporter X1)(SLC2A8)(GLUT8, GLUTX1) ENST00000423934.1 solute carrier family 2, (facilitated glucose transporter) member 8 (glucose transporter X1)(SLC2A8)(GLUT8, GLUTX1) ENST00000430147.1 solute carrier family 2, (facilitated glucose transporter) member 8 (glucose transporter X1)(SLC2A8)(GLUT8, GLUTX1) ENST00000484617.1 solute carrier family 2, (facilitated glucose transporter) member 8 (glucose transporter X1)(SLC2A8)(GLUT8, GLUTX1) ENST00000489239.1 solute carrier family 2, (facilitated glucose transporter) member 8 (glucose transporter X1)(SLC2A8)(GLUT8, GLUTX1) ENST00000477027.1 solute carrier family 2, (facilitated glucose transporter) member 8 (glucose transporter X1)(SLC2A8)(GLUT8, GLUTX1) ENST00000485806.1 solute carrier family 2, (facilitated glucose transporter) member 8 (glucose transporter X1)(SLC2A8)(GLUT8, GLUTX1) ENST00000484208.1 solute carrier family 2, (facilitated glucose transporter) member 8 (glucose transporter X1)(SLC2A8)(GLUT8, GLUTX1) ENST00000342483.5 zinc finger protein 79 (pT7) (ZNF79)(pT7) ENST00000361436.5 ribosomal protein L12 (60S ribosomal protein L12)(RPL12) ENST00000497825.1 ribosomal protein L12 (60S ribosomal protein L12)(RPL12) ENST00000497322.1 ribosomal protein L12 (60S ribosomal protein L12)(RPL12) ENST00000483598.1 ribosomal protein L12 (60S ribosomal protein L12)(RPL12) ENST00000373324.4 novel protein (LOC90678) ENST00000323301.4 novel protein (LOC90678) ENST00000486587.1 novel transcript ENST00000485704.1 novel transcript ENST00000373322.1 novel protein (LOC90678) ENST00000498513.1 novel transcript ENST00000483302.1 novel transcript ENST00000472068.1 novel transcript ENST00000461164.1 novel transcript ENST00000472592.1 novel transcript ENST00000476755.1 novel transcript ENST00000479957.1 novel transcript ENST00000373314.3 novel protein (DKFZP434H0820)(FLJ13518, FLJ22151, FLJ22298) ENST00000373312.3 novel protein ENST00000478917.1 novel transcript ENST00000468379.1 novel transcript ENST00000484348.1 novel transcript ENST00000465154.1 putative novel transcript ENST00000476091.1 putative novel transcript ENST00000335223.5 novel transcript ENST00000496009.1 novel transcript (LOC286207) ENST00000373295.1 novel protein (LOC286207) ENST00000464092.1 novel transcript ENST00000461104.1 novel transcript ENST00000423807.1 novel transcript ENST00000419060.1 novel transcript (LOC138428) ENST00000456267.1 novel transcript ENST00000414832.1 novel transcript ENST00000416214.1 novel transcript ENST00000429848.1 putative novel transcript ENST00000373289.3 novel protein (FLJ32780) ENST00000489226.1 novel transcript ENST00000488285.1 novel transcript ENST00000336067.6 torsin family 2, member A (TOR2A)(FLJ14771) ENST00000373284.5 torsin family 2, member A (TOR2A)(FLJ14771) ENST00000373281.5 torsin family 2, member A (TOR2A)(FLJ14771) ENST00000463577.1 torsin family 2, member A (TOR2A)(FLJ14771) ENST00000472723.1 torsin family 2, member A (TOR2A)(FLJ14771) ENST00000463256.1 torsin family 2, member A (TOR2A)(FLJ14771) ENST00000496460.1 torsin family 2, member A (TOR2A)(FLJ14771) ENST00000494135.1 torsin family 2, member A (TOR2A)(FLJ14771) ENST00000493439.1 torsin family 2, member A (TOR2A)(FLJ14771) ENST00000373277.4 SH2 domain containing 3C (SH2D3C)(CHAT,NSP3) ENST00000473535.1 SH2 domain containing 3C (SH2D3C)(CHAT,NSP3) ENST00000420366.1 SH2 domain containing 3C (SH2D3C)(CHAT,NSP3) ENST00000314830.8 SH2 domain containing 3C (SH2D3C)(CHAT,NSP3) ENST00000468969.1 SH2 domain containing 3C (SH2D3C)(CHAT,NSP3) ENST00000484160.1 SH2 domain containing 3C (SH2D3C)(CHAT,NSP3) ENST00000471939.1 SH2 domain containing 3C (SH2D3C)(CHAT,NSP3) ENST00000440630.1 SH2 domain containing 3C (SH2D3C)(CHAT,NSP3) ENST00000464239.1 SH2 domain containing 3C (SH2D3C)(CHAT,NSP3) ENST00000488685.1 SH2 domain containing 3C (SH2D3C)(CHAT,NSP3) ENST00000414380.1 SH2 domain containing 3C (SH2D3C)(CHAT,NSP3) ENST00000421939.1 Extends 5' end of gene to start at Met upstream of published Met; annotated as variant as evidence overwhelmingly supports downstream transcriptional start ENST00000421939.1 cyclin-dependent kinase 9 (CDC2-related kinase) (CDK9)(TAK, C-2k, CDC2L4, PITALRE) ENST00000373264.4 cyclin-dependent kinase 9 (CDC2-related kinase) (CDK9)(TAK, C-2k, CDC2L4, PITALRE) ENST00000480353.1 cyclin-dependent kinase 9 (CDC2-related kinase) (CDK9)(TAK, C-2k, CDC2L4, PITALRE) ENST00000496284.1 cyclin-dependent kinase 9 (CDC2-related kinase) (CDK9)(TAK, C-2k, CDC2L4, PITALRE) ENST00000491521.1 cyclin-dependent kinase 9 (CDC2-related kinase) (CDK9)(TAK, C-2k, CDC2L4, PITALRE) ENST00000498339.1 cyclin-dependent kinase 9 (CDC2-related kinase) (CDK9)(TAK, C-2k, CDC2L4, PITALRE) ENST00000479147.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000479375.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000373247.2 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000488307.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000373228.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000481552.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000460181.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000475765.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000496586.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000373225.3 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000431857.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000469468.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000423577.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000469310.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000497386.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000488506.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000489522.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000467826.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000473536.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000475270.1 folylpolyglutamate synthase (folylpolyglutamate synthetase)(FPGS) ENST00000373203.4 endoglin (Osler-Rendu-Weber syndrome 1) (ENG)(END, ORW, HHT1, ORW1, CD105) ENST00000344849.3 endoglin (Osler-Rendu-Weber syndrome 1) (ENG)(END, ORW, HHT1, ORW1, CD105) ENST00000480266.1 endoglin (Osler-Rendu-Weber syndrome 1) (ENG)(END, ORW, HHT1, ORW1, CD105) ENST00000486329.1 endoglin (Osler-Rendu-Weber syndrome 1) (ENG)(END, ORW, HHT1, ORW1, CD105) ENST00000462196.1 endoglin (Osler-Rendu-Weber syndrome 1) (ENG)(END, ORW, HHT1, ORW1, CD105) ENST00000439298.1 novel transcript ENST00000425991.1 novel transcript ENST00000373176.1 adenylate kinase 1 (AK1) ENST00000373176.1 alternatively spliced 5' UTR; shares CDS with bA203J24.2.3 ENST00000373176.1 alternative 5' UTR ENST00000413016.1 adenylate kinase 1 (AK1) ENST00000373156.1 adenylate kinase 1 (AK1) ENST00000373156.1 alternatively spliced 5' UTR; shares CDS with bA203J24.2.1 ENST00000373156.1 alternative 5' UTR ENST00000223836.10 adenylate kinase 1 (AK1) ENST00000373146.1 CMP-NeuAC:(beta)-N-acetylgalactosaminide (alpha)2,6-sialyltransferase member VI (ST6GALNAC6)(ST6GALNACVI) ENST00000491678.1 CMP-NeuAC:(beta)-N-acetylgalactosaminide (alpha)2,6-sialyltransferase member VI (ST6GALNAC6)(ST6GALNACVI) ENST00000373141.1 CMP-NeuAC:(beta)-N-acetylgalactosaminide (alpha)2,6-sialyltransferase member VI (ST6GALNAC6)(ST6GALNACVI) ENST00000373142.1 CMP-NeuAC:(beta)-N-acetylgalactosaminide (alpha)2,6-sialyltransferase member VI (ST6GALNAC6)(ST6GALNACVI) ENST00000373144.3 CMP-NeuAC:(beta)-N-acetylgalactosaminide (alpha)2,6-sialyltransferase member VI (ST6GALNAC6)(ST6GALNACVI) ENST00000485320.1 CMP-NeuAC:(beta)-N-acetylgalactosaminide (alpha)2,6-sialyltransferase member VI (ST6GALNAC6)(ST6GALNACVI) ENST00000463086.1 CMP-NeuAC:(beta)-N-acetylgalactosaminide (alpha)2,6-sialyltransferase member VI (ST6GALNAC6)(ST6GALNACVI) ENST00000480417.1 CMP-NeuAC:(beta)-N-acetylgalactosaminide (alpha)2,6-sialyltransferase member VI (ST6GALNAC6)(ST6GALNACVI) ENST00000447681.1 CMP-NeuAC:(beta)-N-acetylgalactosaminide (alpha)2,6-sialyltransferase member VI (ST6GALNAC6)(ST6GALNACVI) ENST00000494541.1 CMP-NeuAC:(beta)-N-acetylgalactosaminide (alpha)2,6-sialyltransferase member VI (ST6GALNAC6)(ST6GALNACVI) ENST00000483353.1 CMP-NeuAC:(beta)-N-acetylgalactosaminide (alpha)2,6-sialyltransferase member VI (ST6GALNAC6)(ST6GALNACVI) ENST00000481355.1 CMP-NeuAC:(beta)-N-acetylgalactosaminide (alpha)2,6-sialyltransferase member VI (ST6GALNAC6)(ST6GALNACVI) ENST00000478319.1 CMP-NeuAC:(beta)-N-acetylgalactosaminide (alpha)2,6-sialyltransferase member VI (ST6GALNAC6)(ST6GALNACVI) ENST00000494611.1 CMP-NeuAC:(beta)-N-acetylgalactosaminide (alpha)2,6-sialyltransferase member VI (ST6GALNAC6)(ST6GALNACVI) ENST00000335791.5 sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) (SIAT7D)(SIAT3C, ST6GALNAC4, ST6GALNACIV) ENST00000474282.1 sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) (SIAT7D)(SIAT3C, ST6GALNAC4, ST6GALNACIV) ENST00000495983.1 sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) (SIAT7D)(SIAT3C, ST6GALNAC4, ST6GALNACIV) ENST00000467674.1 sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) (SIAT7D)(SIAT3C, ST6GALNAC4, ST6GALNACIV) ENST00000361444.3 sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) (SIAT7D)(SIAT3C, ST6GALNAC4, ST6GALNACIV) ENST00000483438.1 sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) (SIAT7D)(SIAT3C, ST6GALNAC4, ST6GALNACIV) ENST00000479747.1 sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) (SIAT7D)(SIAT3C, ST6GALNAC4, ST6GALNACIV) ENST00000388747.4 non-organism supported ENST00000477191.1 novel transcript ENST00000485562.1 novel transcript ENST00000464759.1 novel transcript ENST00000495448.1 novel transcript ENST00000464108.1 novel transcript ENST00000498783.1 novel transcript ENST00000490773.1 novel transcript ENST00000497234.1 novel transcript ENST00000476624.1 novel transcript ENST00000492296.1 novel transcript ENST00000314392.8 dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit (DPM2)(MGC21559) ENST00000470181.1 dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit (DPM2)(MGC21559) ENST00000473360.1 dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit (DPM2)(MGC21559) ENST00000373110.4 dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit (DPM2)(MGC21559) ENST00000415141.1 putative novel transcript ENST00000373084.4 NP_976050.1 ENST00000479828.1 novel transcript ENST00000493175.1 novel transcript ENST00000494606.1 novel transcript ENST00000414976.1 putative novel transcript ENST00000373078.4 novel protein (LOC203245) ENST00000470245.1 novel transcript ENST00000488519.1 novel transcript ENST00000466139.1 novel transcript ENST00000496649.1 novel transcript ENST00000453870.1 putative novel transcript ENST00000418747.1 novel transcript ENST00000485237.1 prostaglandin E synthase 2 (PTGES2)(GBF1, GBF-1, C9orf15, FLJ14038) ENST00000373017.1 lipocalin 2 (oncogene 24p3) (LCN2)(NGAL) ENST00000470902.1 lipocalin 2 (oncogene 24p3) (LCN2)(NGAL) ENST00000277480.2 lipocalin 2 (oncogene 24p3) (LCN2)(NGAL) ENST00000487719.1 lipocalin 2 (oncogene 24p3) (LCN2)(NGAL) ENST00000372998.1 lipocalin 2 (oncogene 24p3) (LCN2)(NGAL) ENST00000488391.1 lipocalin 2 (oncogene 24p3) (LCN2)(NGAL) ENST00000494317.1 lipocalin 2 (oncogene 24p3) (LCN2)(NGAL) ENST00000372994.1 chromosome 9 open reading frame 16 (C9orf16)(MGC4639, EST00098, FLJ12823) ENST00000492588.1 chromosome 9 open reading frame 16 (C9orf16)(MGC4639, EST00098, FLJ12823) ENST00000489240.1 chromosome 9 open reading frame 16 (C9orf16)(MGC4639, EST00098, FLJ12823) ENST00000486420.1 chromosome 9 open reading frame 16 (C9orf16)(MGC4639, EST00098, FLJ12823) ENST00000372954.1 ) ENST00000467178.1 novel transcript ENST00000494497.1 novel transcript ENST00000475805.1 alternative 3' UTR ENST00000421699.2 NP_004477.3 ENST00000486411.1 ) ENST00000372898.2 novel protein ENST00000320188.4 novel protein ENST00000418976.1 novel protein ENST00000372890.4 novel protein (CLONE24922) ENST00000460320.1 novel protein (CLONE24922) ENST00000461180.1 novel protein (CLONE24922) ENST00000300452.3 coenzyme Q4 homolog (yeast) ENST00000372875.3 coenzyme Q4 homolog (yeast) ENST00000461102.1 coenzyme Q4 homolog (yeast) ENST00000372870.1 solute carrier family 27 (fatty acid transporter), member 4 (FATP4) ENST00000300456.3 solute carrier family 27 (fatty acid transporter), member 4 (FATP4) ENST00000323496.5 novel protein similar to thymosin, beta 4, X chromosome (TMSB4X0) ENST00000323496.5 possible pseudogene ENST00000372853.4 novel protein (MGC2668) ENST00000470840.1 novel protein (2GC2668) ENST00000372850.1 novel protein (2GC2668) ENST00000372847.1 novel protein (2GC2668) ENST00000483206.1 novel transcript ENST00000420034.1 alternative 5' UTR ENST00000372842.1 cerebral cell adhesion molecule (CerCAM) ENST00000447915.1 alternative 5' UTR ENST00000420512.1 alternative 5' UTR ENST00000372838.4 cerebral cell adhesion molecule (CerCAM) ENST00000493788.1 novel transcript ENST00000411852.1 alternative 5' UTR ENST00000487001.1 cerebral cell adhesion molecule (CerCAM) ENST00000449048.1 pseudogene similar to part of a novel gene (FLJ36874) ENST00000372814.3 outer dense fiber of sperm tails 2 (ODF84, ODF2/1, ODF2/2, MGC9034) ENST00000469582.1 outer dense fiber of sperm tails 2 (ODF84, ODF2/1, ODF2/2, MGC9034) ENST00000497812.1 outer dense fiber of sperm tails 2 (ODF84, ODF2/1, ODF2/2, MGC9034) ENST00000444993.1 outer dense fiber of sperm tails 2 (ODF84, ODF2/1, OD52/2, MGC9034) ENST00000372807.3 outer dense fiber of sperm tails 2 (ODF84, ODF2/1, ODF2/2, MGC9034) ENST00000421776.1 outer dense fiber of sperm tails 2 (ODF84, ODF2/1, ODF2/2, MGC9034) ENST00000393527.3 outer dense fiber of sperm tails 2 (ODF84, ODF2/1, ODF2/2, MGC9034) ENST00000444119.1 outer dense fiber of sperm tails 2 (ODF84, ODF2/1, ODF2/2, MGC9034) ENST00000434106.1 outer dense fiber of sperm tails 2 (ODF84, ODF2/1, ODF2/2, MGC9034) ENST00000446274.1 outer dense fiber of sperm tails 2 (ODF84, ODF2/1, ODF2/2, MGC9034) ENST00000432065.1 outer dense fiber of sperm tails 2 (ODF84, ODF2/1, ODF2/2, MGC9034) ENST00000470061.1 outer dense fiber of sperm tails 2 (ODF84, ODF2/1, ODF2/2, MGC9034) ENST00000494663.1 outer dense fiber of sperm tails 2 (ODF84, ODF2/1, ODF2/2, MGC9034) ENST00000483070.1 outer dense fiber of sperm tails 2 (ODF84, ODF2/1, ODF2/2, MGC9034) ENST00000488909.1 outer dense fiber of sperm tails 2 (ODF84, ODF2/1, ODF2/2, MGC9034) ENST00000420801.1 putative novel transcript ENST00000309971.4 GLE1 RNA export mediator-like (yeast) ENST00000372770.4 GLE1 RNA export mediator-like (yeast) ENST00000494417.1 GLE1 RNA export mediator-like (yeast) ENST00000434999.1 novel transcript ENST00000426704.1 novel transcript ENST00000372731.4 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) ((ALPHA)II-SPECTRIN) ENST00000372739.3 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) ((ALPHA)II-SPECTRIN) ENST00000497216.1 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) ((ALPHA)II-SPEC4RIN) ENST00000472211.1 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) ((ALPHA)II-SPECTRIN) ENST00000475367.1 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) ((ALPHA)II-SPECTRIN) ENST00000461855.1 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) ((ALPHA)II-SPECTRIN) ENST00000476825.1 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) ((ALPHA)II-SPECTRIN) ENST00000491712.1 spectrin, alpha, non-erythrocytic 1 (alpha-fodrin) ((ALPHA)II-SPECTRIN) ENST00000483181.1 novel transcript ENST00000473486.1 novel transcript ENST00000427516.1 pseudogene similar to part of vesicle transport through interaction with t-SNAREs homolog 1B (yeast) (VTI1B) ENST00000428643.1 putative novel transcript ENST00000454747.1 alternative 5' UTR ENST00000372692.4 SET translocation (myeloid leukemia-associated) (2PP2A, I2PP2A, PHAPII, TAF-IBETA) ENST00000409104.3 SET translocation (myeloid leukemia-associated) (2PP2A, I2PP2A, PHAPII, TAF-IBETA) ENST00000322030.8 SET translocation (myeloid leukemia-associated) (2PP2A, I2PP2A, PHAPII, TAF-IBETA) ENST00000466009.1 SET translocation (myeloid leukemia-associated) (2PP2A, I2PP2A, PHAPII, TAF-IBETA) ENST00000480217.1 SET translocation (myeloid leukemia-associated) (2PP2A, I2PP2A, PHAPII, TAF-IBETA) ENST00000291906.4 protein kinase PKNbeta (pknbeta), variant 1 ENST00000483521.1 novel transcript, variant 2 ENST00000485301.1 novel transcript, variant 3 ENST00000372663.4 zinc finger, DHHC domain containing 12 (ZNF400, FLJ14524), variant 1 ENST00000372672.1 zinc finger, DHHC domain containing 12 (ZNF400, FLJ14524), variant 2 ENST00000372672.1 non-canonical donor splice site at 5th exon and non-canonical acceptor splice site at 6th exon. ENST00000372667.5 zinc finger, DHHC domain containing 12 (ZNF400, FLJ14524), variant 6 ENST00000467312.1 zinc finger, DHHC domain containing 12 (ZNF400, FLJ14524), variant 3 ENST00000452105.1 zinc finger, DHHC domain containing 12 (ZNF400, FLJ14524), variant 5 ENST00000406904.2 zinc finger, DHHC domain containing 12 (ZNF400, FLJ14524), variant 4 ENST00000443631.1 putative novel transcript ENST00000291900.2 ZYG homolog, variant 1 ENST00000494461.1 novel transcript, variant 4 ENST00000414921.1 Alternatively spliced 5' UTR, shares CDS with bA545E17.4.1 (partial) ENST00000414921.1 ZYG homolog, variant 3 ENST00000414921.1 alternative 5' UTR ENST00000427848.1 Alternatively spliced 5' UTR, shares CDS with bA545E17.4.1 (partial) ENST00000427848.1 alternative 5' UTR ENST00000427848.1 ZYG homolog, variant 2 ENST00000372648.5 novel protein (FLJ10743), variant 2 ENST00000475097.1 novel transcript, variant 4 ENST00000466056.1 novel transcript, variant 3 ENST00000223865.8 novel protein (FLJ10743), variant 1 ENST00000372642.4 endonuclease G ENST00000361256.5 novel protein (HSPC109), variant 1 ENST00000467582.1 novel transcript, variant 3 ENST00000480366.1 novel transcript, variant 4 ENST00000466556.1 novel transcript, variant 1 ENST00000467396.1 novel transcript, variant 5 ENST00000466418.1 cysteine conjugate-beta lyase; cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase), variant 8 ENST00000372599.3 Variant 2; alternatively spliced in 5' UTR ENST00000426694.1 alternative 5' UTR ENST00000494608.1 novel transcript, variant 6 ENST00000415948.1 OV260 chr9.128.008.a-intron1 ENST00000434250.1 Possible CRAT antisense transcript ENST00000454968.1 novel transcript (FLJ35367, FLJ14115), variant 1 ENST00000454968.1 continues as bA492E3.1.1 in Em:AL391056 ENST00000454968.1 continued from bA65J3.4.1 in Em:AL353803 ENST00000444184.1 novel transcript (FLJ35367, FLJ14115), variant 2 ENST00000444184.1 continued from bA65J3.4.2 in Em:AL353803 ENST00000444184.1 continues as bA492E3.1.2 in Em:AL391056 ENST00000453213.1 putative novel transcript (FLJ35367, FLJ14115), variant 4 ENST00000412141.1 novel transcript (FLJ35367, FLJ14115), variant 5 ENST00000454635.1 novel transcript, variant 6 ENST00000443993.1 novel transcript (FLJ20378) ENST00000372486.1 alternatively spliced 5' UTR, share CDS with bA483H20.1.1 ENST00000372486.1 continues as bA483H20.1.2 in Em:AL590369 ENST00000372486.1 alternative 5' UTR ENST00000372486.1 continued from bA492E3.3.2 in Em:AL391056 ENST00000372486.1 AD-003 protein (AD-003), variant 2 ENST00000372483.4 AD-003 protein (AD-003), variant 1 ENST00000481189.1 novel transcript, variant 7 ENST00000459968.1 novel transcript, variant 5 ENST00000482347.1 novel transcript, variant 3 ENST00000372481.3 AD-003 protein (AD-003), variant 6 ENST00000372480.1 AD-003 protein (AD-003), variant 4 ENST00000486391.1 novel transcript, variant 8 ENST00000372478.4 novel protein (FLJ35803) ENST00000372478.4 continues as bA492E3.4 in Em:AL391056 ENST00000372478.4 continued from bA483H20.2 in Em:AL590369 ENST00000277459.4 ankyrin repeat and SOCS box-containing 6 (FLJ20548), variant 2 ENST00000277458.4 ankyrin repeat and SOCS box-containing 6 (FLJ20548), variant 1 ENST00000455074.1 putative novel transcript ENST00000425374.1 ubiquitin activating enzyme 2 pseudogene ENST00000259339.2 torsin family 1, member B (torsin B) (DQ1) ENST00000486372.1 this variant and variant fragment .1.4 could be part of one single variant ENST00000486372.1 torsin family 1, member B (torsin B) (DQ1) ENST00000427860.1 torsin family 1, member B (torsin B) (DQ1) ENST00000488169.1 torsin family 1, member B (torsin B) (DQ1) ENST00000488169.1 this variant and variant fragment .1.2 could be part of one single variant ENST00000351698.4 dystonia 1, torsion (autosomal dominant; torsin A) (DQ2, TOR1A) ENST00000474192.1 dystonia 1, torsion (autosomal dominant; torsin A) (DQ2, TOR1A) ENST00000474192.1 this variant and variant fragment .2.2 could be part of one single variant ENST00000473604.1 dystonia 1, torsion (autosomal dominant; torsin A) (DQ2, TOR1A) ENST00000473084.1 dystonia 1, torsion (autosomal dominant; torsin A) (DQ2, TOR1A) ENST00000473084.1 this variant and variant fragment .2.4 could be part of one single variant ENST00000372447.3 hepatocellular carcinoma-associated antigen 59 (LOC51759) (HSPC220) ENST00000461349.1 novel transcript ENST00000461762.1 novel transcript ENST00000480023.1 this variant and variant fragment .3.4 could be part of one single variant ENST00000480023.1 novel transcript ENST00000461539.1 novel transcript ENST00000492991.1 novel transcript ENST00000495934.1 this variant and variant fragment .3.2 could be part of one single variant ENST00000495934.1 novel transcript ENST00000491053.1 ubiquitin specific protease 20 (VDU2, KIAA1003) ENST00000491053.1 this variant and one or more of variant fragments .4.6 and .4.7 could be part of one single variant ENST00000372429.3 ubiquitin specific protease 20 (VDU2, KIAA1003) ENST00000315480.4 alternatively spliced 3' UTR, share CDS with bA409K20.4.1 ENST00000315480.4 ubiquitin specific protease 20 (VDU2, KIAA1003) ENST00000315480.4 alternative 3' UTR ENST00000494971.1 ubiquitin specific protease 20 (VDU2, KIAA1003) ENST00000358355.1 ubiquitin specific protease 20 (VDU2, KIAA1003) ENST00000358355.1 alternatively spliced 5' UTR, shares CDS with bA409K20.4.1 ENST00000358355.1 alternative 5' UTR ENST00000474895.1 ubiquitin specific protease 20 (VDU2, KIAA1003) ENST00000474895.1 this variant and one or more of variant fragments .4.4 and .4.7 could be part of one single variant ENST00000491731.1 ubiquitin specific protease 20 (VDU2, KIAA1003) ENST00000496927.1 9ubiquitin specific protease 20 (VDU2, KIAA1003) ENST00000472108.1 ubiquitin specific protease 20 (VDU2, KIAA1003) ENST00000472108.1 this variant and one or more of variant fragments .4.4 and .4.6 could be part of one single variant ENST00000417984.1 60S ribosomal protein L34 (RPL34) pseudogene ENST00000372416.1 formin binding protein 1 (FBP17, KIAA0554) ENST00000479142.1 formin binding protein 1 (FBP17, KIAA0554) ENST00000449089.1 formin binding protein 1 (FBP17, KIAA0554) ENST00000355681.2 formin binding protein 1 (FBP17, KIAA0554) ENST00000478129.1 formin binding protein 1 (FBP17, KIAA0554) ENST00000462766.1 formin binding protein 1 (FBP17, KIAA0554) ENST00000482107.1 formin binding protein 1 (FBP17, KIAA0554) ENST00000491905.1 formin binding protein 1 (FBP17, KIAA0554) ENST00000447586.1 putative novel transcript ENST00000414926.1 putative novel transcript ENST00000372406.1 G protein-coupled receptor 107 (LUSTR1, FLJ20998, FLJ22591, KIAA1624, MGC15440, RP11-88G17) ENST00000475101.1 G protein-coupled receptor 107 (LUSTR1, FLJ20998, FLJ22591, KIAA1624, MGC15440, RP11-88G17) ENST00000347136.6 G protein-coupled receptor 107 (LUSTR1, FLJ20998, FLJ22591, KIAA1624, MGC15440, RP11-88G17) ENST00000493417.1 G protein-coupled receptor 107 (LUSTR1, FLJ20998, FLJ22591, KIAA1624, MGC15440, RP11-88G17) ENST00000462907.1 G protein-coupled receptor 107 (LUSTR1, FLJ20998, FLJ22591, KIAA1624, MGC15440, RP11-88G17) ENST00000483935.1 G protein-coupled receptor 107 (LUSTR1, FLJ20998, FLJ22591, KIAA1624, MGC15440, RP11-88G17) ENST00000415344.1 putative novel transcript ENST00000372398.3 frequenin homolog (Drosophila) (FLUP, NCS1, NCS-1, DKFZp761L1223) (neuronal calcium sensor 1) ENST00000493042.1 frequenin homolog (Drosophila) (FLUP, NCS1, NCS-1, DKFZp761L1223) (neuronal calcium sensor 1) ENST00000415566.1 Gene fragments RP11-88G17.4-001, RP11-618A20.3-001, RP11-618A20.4-001 and RP11-618A20.1-003 are part of the same gene; the exact exon structure linking the fragments is yet to be determined ENST00000420499.1 Gene fragments RP11-88G17.4-001, RP11-618A20.3-001, RP11-618A20.4-001 and RP11-618A20.1-003 are part of the same gene; the exact exon structure linking the fragments is yet to be determined ENST00000462148.1 Gene fragments RP11-88G17.4-001, RP11-618A20.3-001, RP11-618A20.4-001 and RP11-618A20.1-003 are part of the same gene; the exact exon structure linking the fragments is yet to be determined ENST00000487727.1 novel transcript (DKFZp434P0216) ENST00000487727.1 indel causes a frameshift in exon 9 ENST00000480829.1 novel transcript (DKFZp434P0216) ENST00000428715.1 Gene fragments RP11-88G17.4-001, RP11-618A20.3-001,RP11-618A20.4-001 and RP11-618A20.1-003 are part of the same gene; the exact exon structure linking the fragments is yet to be determined ENST00000352480.5 argininosuccinate synthetase (ASS1,CTLN1) ENST00000372394.1 argininosuccinate synthetase (ASS1,CTLN1) ENST00000372394.1 alternatively spliced 5' UTR, shares CDS with bA618A20.2.1 ENST00000372394.1 alternative 5' UTR ENST00000372393.2 argininosuccinate synthetase (ASS1,CTLN1) ENST00000372393.2 alternatively spliced 5' UTR, shares CDS with bA618A20.2.1 ENST00000372393.2 alternative 5' UTR ENST00000422569.1 this variant and one or more of variant fragments .2.6 and .2.7 could be part of one single variant ENST00000422569.1 argininosuccinate synthetase (ASS1,CTLN1) ENST00000443588.1 argininosuccinate synthetase (ASS1,CTLN1) ENST00000467695.1 argininosuccinate synthetase (ASS1,CTLN1) ENST00000493984.1 argininosuccinate synthetase (ASS1,CTLN1) ENST00000492400.1 argininosuccinate synthetase (ASS1,CTLN1) ENST00000492400.1 this variant and variant fragment .2.4 could be part of one single variant ENST00000470849.1 argininosuccinate synthetase (ASS1,CTLN1) ENST00000470849.1 this variant and variant fragment .2.4 could be part of one single variant ENST00000372386.5 argininosuccinate synthetase (ASS1,CTLN1) ENST00000467100.1 far upstream element (FUSE) binding protein 3 (FBP3) ENST00000319725.9 far upstream element (FUSE) binding protein 3 (FBP3) ENST00000372376.1 non-canonical splicing between exons 9 and 10 ENST00000372376.1 far upstream element (FUSE) binding protein 3 (FBP3) ENST00000465949.1 far upstream element (FUSE) binding protein 3 (FBP3) ENST00000487406.1 far upstream element (FUSE) binding protein 3 (FBP3) ENST00000472006.1 far upstream element (FUSE) binding protein 3 (FBP3) ENST00000492199.1 far upstream element (FUSE) binding protein 3 (FBP3) ENST00000423330.1 RPL19 (ribosomal protein L19) pseudogene ENST00000253008.2 PR domain containing 12 (PR-domain containing 12) ENST00000372358.5 homolog of yeast RRP4 (ribosomal RNA processing 4), 3'-5' exoribonuclease (RRP4) ENST00000491115.1 homolog of yeast RRP4 (ribosomal RNA processing 4), 3'-5' exoribonuclease (RRP4) ENST00000430138.2 homolog of yeast RRP4 (ribosomal RNA processing 4), 3'-5' exoribonuclease (RRP4) (FLJ33193) ENST00000372352.3 homolog of yeast RRP4 (ribosomal RNA processing 4), 3'-5' exoribonuclease (RRP4) ENST00000490641.1 homolog of yeast RRP4 (ribosomal RNA processing 4), 3'-5' exoribonuclease (RRP4) ENST00000372351.3 homolog of yeast RRP4 (ribosomal RNA processing 4), 3'-5' exoribonuclease (RRP4) ENST00000372350.2 homolog of yeast RRP4 (ribosomal RNA processing 4), 3'-5' exoribonuclease (RRP4) ENST00000495699.1 homolog of yeast RRP4 (ribosomal RNA processing 4), 3'-5' exoribonuclease (RRP4) ENST00000463488.1 homolog of yeast RRP4 (ribosomal RNA processing 4), 3'-5' exoribonuclease (RRP4) ENST00000467138.1 homolog of yeast RRP4 (ribosomal RNA processing 4), 3'-5' exoribonuclease (RRP4) (FLJ35408) ENST00000372348.2 v-abl Abelson murine leukemia viral oncogene homolog 1 (ABL, JTK7) ENST00000393293.3 v-abl Abelson murine leukemia viral oncogene homolog 1 (ABL, JTK7) ENST00000393293.3 exon ends with non-canonical splicing ENST00000318560.5 v-abl Abelson murine leukemia viral oncogene homolog 1 (ABL, JTK7) ENST00000417156.1 ribosomal protein L37 (RPL37) pseudogene ENST00000372338.4 novel protein similar to fibrinogen proteins ENST00000372337.1 novel protein similar to fibrinogen proteins ENST00000444139.1 novel protein (FLJ14810) similar to fibrinogen proteins ENST00000451466.1 alternatively spliced in 5' UTR, shares partial CDS with bA83J21.2.1 ENST00000451466.1 alternative 5' UTR ENST00000451466.1 novel protein similar to fibrinogen proteins ENST00000463475.1 novel transcript ENST00000486250.1 novel transcript ENST00000421067.1 putative novel transcript ENST00000361069.4 laminin, gamma 3 ENST00000355048.2 non-canonical splicing between exons 17 and 18 ENST00000355048.2 laminin, gamma 3 ENST00000480883.1 laminin, gamma 3 ENST00000355452.5 laminin, gamma 3 ENST00000355452.5 laminin, gamma 3 (DKFZp434E202) ENST00000462567.1 laminin, gamma 3 ENST00000372314.3 FLJ25060 ENST00000247291.3 FLJ12783, DKFZp761J191, DKFZp761N011 ENST00000372302.1 FLJ34593 ENST00000359428.5 nucleoporin 214kDa ENST00000530843.1 NMD candidate ENST00000489260.1 nucleoporin 214kDa ENST00000470765.1 nucleoporin 214kDa ENST00000483497.2 nucleoporin 214kDa ENST00000498010.1 nucleoporin 214kDa ENST00000476004.1 nucleoporin 214kDa ENST00000528406.1 alternative 3' UTR ENST00000496921.2 nucleoporin 214kDa (FLJ36454) ENST00000415391.1 novel transcript ENST00000417798.1 novel transcript ENST00000446606.1 ribosomal protein L13a (RPL13A) pseudogene ENST00000247295.4 novel transcript (FLJ00024) ENST00000372269.3 novel protein ENST00000372271.3 novel protein (FLJ38104) ENST00000464831.1 novel protein ENST00000372264.3 novel protein (MGC12921) (FLJ14662) ENST00000372261.1 novel protein ENST00000405995.1 novel protein (contains KIAA0515) ENST00000489593.1 novel transcript ENST00000422467.1 this variant fragment and either of variant fragments .1.2, .1.4 or .1.5 could be part of one single variant ENST00000422467.1 novel protein ENST00000456307.1 novel protein ENST00000456307.1 this variant fragment and either of variant fragments .1.3, .1.4 or .1.5 could be part of one single variant ENST00000451855.1 this variant fragment and either of variant fragments .1.2, .1.3 or .1.5 could be part of one single variant ENST00000451855.1 novel protein ENST00000320547.7 novel protein (contains FLJ22022) ENST00000320547.7 this variant fragment and either of variant fragments .1.2, .1.3 or .1.4 could be part of one single variant ENST00000465931.1 novel transcript (FLJ31354) ENST00000428514.1 RNA, U62 small nucleolar ENST00000426867.1 novel transcript identical to RNA, U62 small nucleolar (RNU62) ENST00000341012.7 protein-O-mannosyltransferase 1 (RT) (FLJ90407) ENST00000441334.1 protein-O-mannosyltransferase 1 (RT) ENST00000372228.3 protein-O-mannosyltransferase 1 (RT) ENST00000402686.3 protein-O-mannosyltransferase 1 (RT) (FLJ90393) ENST00000418774.1 alternatively spliced in 5' UTR, shares partial CDS with bA334J6.2.1 ENST00000418774.1 protein-O-mannosyltransferase 1 (RT) ENST00000418774.1 alternative 5' UTR ENST00000415075.1 protein-O-mannosyltransferase 1 (RT) ENST00000448212.1 protein-O-mannosyltransferase 1 (RT) ENST00000483472.1 protein-O-mannosyltransferase 1 (RT) ENST00000430619.1 protein-O-mannosyltransferase 1 (RT) ENST00000462375.1 protein-O-mannosyltransferase 1 (RT) ENST00000485278.1 protein-O-mannosyltransferase 1 (RT) (FLJ37239) ENST00000372220.4 protein-O-mannosyltransferase 1 (RT) ENST00000467848.1 protein-O-mannosyltransferase 1 (RT) ENST00000494883.1 protein-O-mannosyltransferase 1 (RT) ENST00000415423.1 putative novel transcript ENST00000372215.4 uridine-cytidine kinase 1 (UCK1) (FLJ12255) ENST00000372208.3 uridine-cytidine kinase 1 (UCK1) ENST00000491309.1 uridine-cytidine kinase 1 (UCK1) (FLJ25119) ENST00000372211.3 uridine-cytidine kinase 1 (UCK1) ENST00000372210.3 uridine-cytidine kinase 1 (UCK1) ENST00000484876.1 novel transcript ENST00000494584.1 novel transcript ENST00000459858.1 novel transcript ENST00000482398.1 novel transcript ENST00000266110.6 guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene) (C3G) ENST00000372195.1 guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene) (C3G) ENST00000429421.1 guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene) (C3G) ENST00000414781.1 guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene) (C3G) ENST00000419442.1 guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene) (C3G) ENST00000481260.1 guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene) (C3G) ENST00000438647.1 guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene) (C3G) ENST00000427994.1 guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene) (C3G) ENST00000411521.1 eukaryotic translation initiation factor 4A isoform 1 (EIF4A1) pseudogene ENST00000444708.1 putative novel transcript ENST00000357028.2 Sp1 transcriptional activation cofactor subunit 8 34kDa ENST00000357028.2 continues from bA32B11.1.2 in Em:AL513102; continues as bA326N3.1.2 in Em:AL603649 ENST00000357028.2 Sp1 transcriptional activation cofactor subunit 8 34 kDa ENST00000357028.2 continues from bB195B13.1.2 in Em:AL713892; continues as bA323H21.4.2 in Em:AL160271 ENST00000357028.2 cofactor required for Sp1 transcriptional activation subunit 8 34kDa ENST00000474263.1 Sp1 transcriptional activation cofactor subunit 8 34 kDa ENST00000444872.1 putative novel transcript ENST00000393229.3 netrin G2 protein ENST00000393229.3 continues from bA5N16.1.1 in Em:AL353631 ENST00000467453.1 novel transcript ENST00000393228.3 netrin G2 protein ENST00000490694.1 novel transcript ENST00000483055.1 novel transcript ENST00000436441.1 KIAA0625 protein (contains FLJ10594) ENST00000477049.1 KIAA0625 protein (contans FLJ10594) ENST00000464133.1 novel transcript ENST00000474172.1 novel transcript ENST00000461970.1 novel transcript ENST00000448486.1 putative novel transcript ENST00000263610.2 BarH-like 1 (Drosophila) protein ENST00000372159.3 DEAD/H box polypeptide 31 ENST00000372155.1 DEAD/H box polypeptide 31 ENST00000310532.2 DEAD/H box polypeptide 31 ENST00000480876.1 DEAD/H box polypeptide 31 ENST00000482620.1 DEAD/H box polypeptide 31 ENST00000372146.4 general transcription factor IIIC, polypeptide 4 ENST00000483873.1 general transcription factor IIIC, polypeptide 4 ENST00000298545.3 novel protein (FLJ32704) ENST00000477396.1 novel transcript ENST00000476719.1 novel transcript ENST00000467161.1 novel transcript ENST00000482422.1 novel transcript ENST00000451318.1 putative novel transcript ENST00000372136.3 chromosome 9 open reading frame 9 protein ENST00000356311.5 chromosome 9 open reading frame 9 protein ENST00000350499.6 chromosome 9 open reading frame 9 protein ENST00000403810.1 NP_001008567.1 ENST00000461879.1 tuberous sclerosis 1 ENST00000475903.1 tuberous sclerosis 1 ENST00000490179.1 tuberous sclerosis 1 ENST00000339463.3 alternative 5' UTR ENST00000372097.5 general transcription factor IIIC, polypeptide 5, 63kDa ENST00000440319.1 general transcription factor IIIC, polypeptide 5, 63kDa ENST00000372108.5 general transcription factor IIIC, polypeptide 5, 63kDa ENST00000342018.7 general transcription factor IIIC, polypeptide 5, 63kDa ENST00000439697.1 general transcription factor IIIC, polypeptide 5, 63kDa ENST00000485692.1 general transcription factor IIIC, polypeptide 5, 63kDa ENST00000460815.1 general transcription factor IIIC, polypeptide 5, 63kDa ENST00000434175.1 general transcription factor IIIC, polypeptide 5, 63kDa ENST00000461871.1 general transcription factor IIIC, polypeptide 5, 63kDa ENST00000435745.1 general transcription factor IIIC, polypeptide 5, 63kDa ENST00000489842.1 general transcription factor IIIC, polypeptide 5, 63kDa ENST00000372080.4 carboxyl ester lipase (bile salt-stimulated lipase) ENST00000423824.1 putative novel transcript ENST00000482648.1 ral guanine nucleotide dissociation stimulator ENST00000469972.1 ral guanine nucleotide dissociation stimulator ENST00000493438.1 ral guanine nucleotide dissociation stimulator ENST00000372050.3 ral guanine nucleotide dissociation stimulator ENST00000372047.3 ral guanine nucleotide dissociation stimulator ENST00000393160.3 ral guanine nucleotide dissociation stimulator ENST00000498797.1 ral guanine nucleotide dissociation stimulator ENST00000495621.1 ral guanine nucleotide dissociation stimulator ENST00000477660.1 ral guanine nucleotide dissociation stimulator ENST00000424572.1 ral guanine nucleotide dissociation stimulator ENST00000471109.1 ral guanine nucleotide dissociation stimulator ENST00000493067.1 ral guanine nucleotide dissociation stimulator ENST00000460587.1 ral guanine nucleotide dissociation stimulator ENST00000447308.1 putative novel transcript ENST00000372043.3 Forssman glycolipid synthetase (FS) ENST00000470431.1 Forssman glycolipid synthetase (FS) ENST00000472281.1 Forssman glycolipid synthetase (FS) ENST00000372040.3 Forssman glycolipid synthetase (FS) ENST00000372038.3 Forssman glycolipid synthetase (FS) ENST00000372036.3 Forssman glycolipid synthetase (FS) ENST00000487864.1 Forssman glycolipid synthetase (FS) ENST00000372034.3 odorant-binding protein 2B (OBP2B) ENST00000473737.1 odorant-binding protein 2B (OBP2B) ENST00000461961.1 odorant-binding protein 2B (OBP2B) ENST00000453660.1 ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase), ABO-*O02 allele ENST00000453660.1 The ABO gene in this indvividual produces a truncated protein without functional glycosyltransferase activity indicative of blood group O ENST00000453660.1 ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase), ABO-*O01 allele ENST00000372022.4 surfeit 6 ENST00000468290.1 surfeit 6 ENST00000486395.1 alternative 3' UTR ENST00000343730.5 surfeit 5, isoform b ENST00000476080.1 alternative 5' UTR ENST00000471524.1 surfeit 5 ENST00000446777.1 alternative 5' UTR ENST00000494177.1 alternative 5' UTR ENST00000457204.2 alternative 5' UTR ENST00000323345.6 ribosomal protein L7a ENST00000496554.1 ribosomal protein L7a ENST00000463740.1 ribosomal protein L7a ENST00000426651.1 ribosomal protein L7a ENST00000468019.1 ribosomal protein L7a ENST00000485706.1 this variant and variant 9 could be part of the same variant ENST00000485706.1 ribosomal protein L7a ENST00000315731.4 ribosomal protein L7a ENST00000489392.1 ribosomal protein L7a ENST00000492798.1 ribosomal protein L7a ENST00000492798.1 this variant and variant 7 could be part of the same variant ENST00000371974.3 surfeit 1 ENST00000495952.1 surfeit 1 ENST00000437995.1 surfeit 1 ENST00000463965.1 surfeit 1 ENST00000371964.4 surfeit 2 ENST00000495524.1 surfeit 2 ENST00000486887.1 surfeit 2 ENST00000371989.3 surfeit 4 ENST00000485435.1 surfeit 4 ENST00000465565.1 surfeit 4 ENST00000467910.1 surfeit 4 ENST00000371991.3 surfeit 4 ENST00000371982.3 surfeit 4 ENST00000371957.3 novel protein (MGC43306) ENST00000468046.1 putative novel transcript ENST00000475232.1 novel transcript ENST00000462310.1 putative novel transcript ENST00000477284.1 putative novel transcript ENST00000453165.1 Xenopus prevents mitotic catastrophe 2 homolog ENST00000371942.3 Xenopus prevents mitotic catastrophe 2 homolog ENST00000454825.1 Xenopus prevents mitotic catastrophe 2 homolog ENST00000494045.1 Xenopus prevents mitotic catastrophe 2 homolog ENST00000478037.1 Xenopus prevents mitotic catastrophe 2 homolog ENST00000445916.1 Xenopus prevents mitotic catastrophe 2 homolog ENST00000291722.7 chromosome 9 open reading frame 7 ENST00000474734.1 chromosome 9 open reading frame 7 ENST00000316948.4 chromosome 9 open reading frame 7 ENST00000489519.1 chromosome 9 open reading frame 7 ENST00000444798.1 chromosome 9 open reading frame 7 ENST00000420546.1 novel transcript ENST00000371897.4 solute carrier family 2 (facilitated glucose transporter), member 6 ENST00000485978.1 solute carrier family 2 (facilitated glucose transporter), member 6 ENST00000371899.4 solute carrier family 2 (facilitated glucose transporter), member 6 ENST00000414172.1 solute carrier family 2 (facilitated glucose transporter), member 6 ENST00000425189.1 novel transcript ENST00000371872.4 sarcosine dehydrogenase (SAR, SDH, SARD, DMGDHL1) ENST00000371868.1 sarcosine dehydrogenase (SAR, SDH, SARD, DMGDHL1) ENST00000469828.1 sarcosine dehydrogenase (SAR, SDH, SARD, DMGDHL1) ENST00000427237.1 sarcosine dehydrogenase (SAR, SDH, SARD, DMGDHL1) ENST00000371867.1 sarcosine dehydrogenase (SAR, SDH, SARD, DMGDHL1) ENST00000371850.3 vav 2 oncogene ENST00000371851.1 vav 2 oncogene ENST00000406606.3 vav 2 oncogene ENST00000486113.1 vav 2 oncogene ENST00000472905.1 vav 2 oncogene ENST00000430633.1 novel transcript (FLJ35348) ENST00000432807.1 novel transcript ENST00000371842.2 alternative 5' UTR ENST00000433041.1 alternative 5' UTR ENST00000412181.1 novel transcript (FLJ32958) ENST00000417135.1 novel transcript ENST00000481739.1 retinoid X receptor alpha ENST00000356384.4 retinoid X receptor alpha ENST00000444936.1 putative novel transcript ENST00000435284.1 putative novel transcript ENST00000446184.1 putative novel transcript ENST00000454160.1 putative novel transcript ENST00000371817.3 NP_000084 ENST00000371813.3 novel protein ENST00000412680.1 pseudogene similar to part of a ficolin family protein ENST00000371806.3 ficolin (collagen/fibrinogen domain containing) 1 ENST00000417054.1 novel transcript ENST00000277415.11 NP_006325.1 ENST00000252854.4 NP_055094 ENST00000539877.1 not organism-supported ENST00000545657.1 not organism-supported ENST00000452377.1 Putative novel transcript ENST00000420883.1 Putative novel transcript ENST00000450850.1 putative novel transcript ENST00000449637.1 suppressor of cytokine signaling 5 (SOCS5) pseudogene ENST00000412464.1 putative novel transcript ENST00000455039.1 putative novel transcript ENST00000356818.2 novel protein (KIAA0649) ENST00000401470.2 variant 2; alternatively spliced in 5' UTR ENST00000401470.2 novel protein ENST00000429260.2 NP_001041730.1 ENST00000371789.3 alternative 5' UTR ENST00000371785.1 mitochondrial ribosomal protein S2 ENST00000488610.1 mitochondrial ribosomal protein S2 ENST00000485333.1 mitochondrial ribosomal protein S2 ENST00000462948.1 mitochondrial ribosomal protein S2 ENST00000453385.1 mitochondrial ribosomal protein S2 ENST00000472946.1 mitochondrial ribosomal protein S2 ENST00000415062.1 novel transcript ENST00000263598.2 lipocalin 1 ENST00000371781.3 variant 2; alternatively spliced in 3' UTR ENST00000371781.3 lipocalin 1 ENST00000539850.1 alternative 3' UTR ENST00000371768.3 progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein) ENST00000479141.1 progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein) ENST00000371766.1 variant 2; alternatively spliced in 3' UTR ENST00000371766.1 progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein) ENST00000277508.5 variant 3; alternatively spliced in 3' UTR ENST00000277508.5 progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein) ENST00000433563.1 progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein) ENST00000418284.1 variant 5; alternatively spliced in 3' UTR ENST00000418284.1 progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein) ENST00000454923.1 variant 8; alternatively spliced in 3' UTR ENST00000454923.1 progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein) ENST00000457014.1 progestagen-associated endometrial protein (placental protein 14, pregnancy-associated endometrial alpha-2-globulin, alpha uterine protein) ENST00000457014.1 variant 6; alternatively spliced in 3' UTR ENST00000447907.1 novel transcript ENST00000445997.1 novel transcript ENST00000447497.1 novel protein ENST00000434190.1 progestagen-associated endometrial protein pseudogene (PAEP) ENST00000371763.1 NP_892019.2 ENST00000430290.2 not organism-supported ENST00000487664.1 potassium channel, subfamily T, member 1 ENST00000389532.4 novel protein (contains DKFZp434G2311) ENST00000483991.1 novel transcript ENST00000493088.1 novel protein ENST00000492174.1 novel transcript ENST00000468150.1 novel transcript ENST00000460094.1 novel transcript ENST00000423793.1 novel transcript ENST00000371756.3 putative glialblastoma cell differentiation-related (GDBR1) ENST00000489050.1 this variant and either of variant fragments .3.3 and .3.5 could be part of one single variant ENST00000489050.1 novel transcript ENST00000465873.1 this variant and variant fragment .3.6 could be part of one single variant ENST00000465873.1 novel transcript ENST00000471163.1 this variant and variant fragment .3.6 could be part of one single variant ENST00000471163.1 novel transcript ENST00000478485.1 novel transcript ENST00000486258.1 novel transcript ENST00000371753.1 novel protein (MGC23427) ENST00000467669.1 putative novel transcript ENST00000358701.5 DKFZp762A2013 ENST00000455222.1 novel protein ENST00000354753.2 activator of G-protein signalling 3 (AGS3) (DKFZp727I051) ENST00000392944.1 activator of G-protein signalling 3 (AGS3) ENST00000291775.3 alternatively spliced in 5' UTR, shares CDS with bB270L15.1.2 ENST00000291775.3 alternative 5' UTR ENST00000460290.1 caspase recruitment domain family, member 9 ENST00000371734.3 caspase recruitment domain family, member 9 ENST00000371732.5 caspase recruitment domain family, member 9 ENST00000298532.2 small nuclear RNA activating complex, polypeptide 4, 190kDa (SNAP190, PTalpha) ENST00000298537.7 Start agrees with that found in mouse, which has an upstream stop codon (not present in human) ENST00000371720.1 inositol polyphosphate-5-phosphatase 72kDa ENST00000371717.3 inositol polyphosphate-5-phosphatase 72kDa ENST00000462616.1 inositol polyphosphate-5-phosphatase 72kDa ENST00000444897.1 inositol polyphosphate-5-phosphatase 72kDa ENST00000467838.1 novel transcript ENST00000277537.6 novel protein (KIAA0310) ENST00000453963.1 novel protein (KIAA0310) ENST00000371706.3 novel protein (KIAA0310) ENST00000313084.5 novel protein (KIAA0310) ENST00000433860.1 novel protein (KIAA0310) ENST00000472305.1 novel transcript ENST00000277541.6 Notch homolog 1, translocation-associated (Drosophila) (hN1, TAN1) ENST00000494783.1 Notch homolog 1, translocation-associated (Drosophila) (hn1, TAN1) ENST00000491649.1 Notch homolog 1, translocation-associated (Drosophila) (hn1, TAN1) ENST00000439501.1 novel transcript ENST00000429224.1 novel transcript ENST00000450304.1 novel transcript ENST00000411904.1 novel transcript ENST00000371699.1 NEU1 protein (ZNEU1) ENST00000406555.3 NEU1 protein (ZNEU1) ENST00000406555.3 alternatively spliced 5' UTR, shares CDS with bA251M2.2.1 ENST00000406555.3 alternative 5' UTR ENST00000492862.1 novel transcript ENST00000490469.1 novel transcript ENST00000492002.1 novel transcript ENST00000371698.3 NEU1 protein (ZNEU1) ENST00000371698.3 alternatively spliced 5' UTR, shares CDS with bA251M2.2.1 ENST00000371698.3 alternative 5' UTR ENST00000472752.1 novel transcript ENST00000470861.1 ) ENST00000371692.4 novel protein similar to mouse pancreatitis-induced protein 49 (PIP49) ENST00000371691.1 novel protein similar to mouse pancreatitis-induced protein 49 (PIP49) ENST00000371691.1 novel protein similar to mouse pancreatitis-induced protein 49 (PIP49) ENST00000414282.1 novel transcript (FLJ30346) ENST00000416970.1 novel transcript (FLJ30346) ENST00000436596.1 novel transcript ENST00000447221.1 novel transcript (FLJ30346) ENST00000435202.1 novel transcript (LOC158062) ENST00000476567.1 novel transcript ENST00000341206.3 NMD exception ENST00000341040.7 novel transcript (LOC158062) ENST00000341040.7 this variant and variant fragment .3.4 could be part of one single variant ENST00000497771.1 NP_001001712.2 ENST00000480597.1 novel transcript ENST00000479767.1 novel transcript ENST00000482893.1 novel transcript, variant 3 (FLJ33328) ENST00000371688.3 novel protein similar to mouse lipocalin 8 (EP17, Lcn5) ENST00000495223.1 novel transcript ENST00000482511.1 novel transcript ENST00000442568.1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G isoform 1 (ATP6V1G1) pseudogene ENST00000290079.8 NP_116317.1 ENST00000484858.1 this variant and one or more of variant fragments .7.1, .7.2 and .7.3 could be part of one single variant ENST00000484858.1 novel transcript ENST00000484471.1 novel protein ENST00000311502.7 novel protein, variant 1 (FLJ10101) ENST00000357466.2 novel protein ENST00000464941.1 novel protein, variant 2 (FLJ37063) ENST00000436380.1 novel protein, variant 3 (FLJ13045) ENST00000425121.1 novel protein ENST00000466096.1 novel transcript ENST00000461992.1 novel protein ENST00000435930.1 novel protein, variant 5 (FLJ40767) ENST00000414656.1 novel transcript (FLJ30985) ENST00000445357.1 nucleolin (NCL) pseudogene ENST00000371661.1 phosphohistidine phosphatase (PHP14) ENST00000492540.1 novel transcript ENST00000247665.10 phosphohistidine phosphatase (PHP14) ENST00000462205.1 novel transcript ENST00000497413.1 novel transcript ENST00000463215.1 novel transcript ENST00000485732.1 novel transcript, variant 1 (DKFZp43I1716) ENST00000481327.1 novel transcript ENST00000479475.1 novel protein, variant 3 (DKFZp434M1411) ENST00000371649.1 endothelial differentiation-related factor 1 (MBF1, EDF-1) ENST00000224073.1 endothelial differentiation-related factor 1 (MBF1, EDF-1) ENST00000371648.4 endothelial differentiation-related factor 1 (MBF1, EDF-1) ENST00000419057.1 TNF receptor-associated factor 2 (TRAP, TRAP3) ENST00000419057.1 alternatively spliced 5' UTR, shares CDS with bA216L13.13.1 ENST00000419057.1 alternative 5' UTR ENST00000429509.1 TNF receptor-associated factor 2 (TRAP, TRAP3) ENST00000429509.1 alternatively spliced 5' UTR, shares CDS with bA216L13.13.1 ENST00000429509.1 alternative 5' UTR ENST00000247668.2 TNF receptor-associated factor 2 (TRAP, TRAP3) ENST00000371645.5 TNF receptor-associated factor 2 (TRAP, TRAP3) ENST00000414589.1 TNF receptor-associated factor 2 (TRAP, TRAP3) ENST00000414589.1 alternatively spliced 5' UTR, shares CDS with bA216L13.13.1 ENST00000414589.1 alternative 5' UTR ENST00000474950.1 this variant and variant fragment .1.9 could be part of one single variant ENST00000474950.1 TNF receptor-associated factor 2 (TRAP, TRAP3) ENST00000482854.1 this variant and variant fragment .1.9 could be part of one single variant ENST00000482854.1 TNF receptor-associated factor 2 (TRAP, TRAP3) ENST00000469701.1 this variant and variant fragment .1.9 could be part of one single variant ENST00000469701.1 TNF receptor-associated factor 2 (TRAP, TRAP3) ENST00000466107.1 TNF receptor-associated factor 2 (TRAP, TRAP3, MGC:45012) ENST00000466107.1 this variant and one or more of variant fragments .1.6, .1.7 and .1.8 could be part of one single variant ENST00000395082.2 ribosomal protein L30 (RPL30) pseudogene ENST00000325285.3 novel protein (likely ortholog of mouse f-box and WD-40 domain protein 5 (FBXW5)) ENST00000433269.1 novel protein (likely ortholog of mouse f-box and WD-40 domain protein 5 (FBXW5)) ENST00000480818.1 novel transcript ENST00000491246.1 novel transcript ENST00000428398.1 novel protein (likely ortholog of mouse f-box and WD-40 domain protein 5 (FBXW5)) ENST00000443788.1 novel protein (likely ortholog of mouse f-box and WD-40 domain protein 5 (FBXW5)) ENST00000371634.2 complement component 8, gamma polypeptide ENST00000224181.3 complement component 8, gamma polypeptide ENST00000484376.1 complement component 8, gamma polypeptide ENST00000465773.1 complement component 8, gamma polypeptide ENST00000484304.1 novel transcript ENST00000492820.1 novel transcript ENST00000463714.1 novel transcript ENST00000495410.1 novel transcript ENST00000491603.1 novel transcript ENST00000471615.1 novel protein ENST00000371632.3 novel protein ENST00000494713.1 novel transcript ENST00000476751.1 novel protein ENST00000466277.1 novel transcript ENST00000480204.1 novel protein ENST00000371629.1 novel protein ENST00000413913.1 novel transcript ENST00000457950.1 prostaglandin D2 synthase 21kDa (brain) ENST00000371625.3 prostaglandin D2 synthase 21kDa (brain) ENST00000371623.3 prostaglandin D2 synthase 21kDa (brain) ENST00000471521.1 prostaglandin D2 synthase 21kDa (brain) ENST00000446677.1 prostaglandin D2 synthase 21kDa (brain) ENST00000460340.1 prostaglandin D2 synthase 21kDa (brain) ENST00000492068.1 prostaglandin D2 synthase 21kDa (brain) ENST00000462514.1 prostaglandin D2 synthase 21kDa (brain) ENST00000444903.1 prostaglandin D2 synthase 21kDa (brain) ENST00000467871.1 prostaglandin D2 synthase 21kDa (brain) ENST00000371620.3 novel protein ENST00000468484.1 novel transcript ENST00000481187.1 novel transcript ENST00000483807.1 novel protein ENST00000488678.1 novel transcript ENST00000493968.1 novel transcript ENST00000467845.1 novel transcript ENST00000492564.1 novel transcript ENST00000498095.1 novel transcript ENST00000463765.1 novel transcript ENST00000480181.1 chloride intracellular channel 3 ENST00000494426.1 chloride intracellular channel 3 ENST00000473911.1 chloride intracellular channel 3 ENST00000456673.1 chloride intracellular channel 3 ENST00000341511.6 ATP-binding cassette, sub-family A (ABC1), member 2 ENST00000479446.1 ATP-binding cassette, sub-family A (ABC1), member 2 ENST00000459850.1 ATP-binding cassette, sub-family A (ABC1), member 2 ENST00000448336.1 ATP-binding cassette, sub-family A (ABC1), member 2 ENST00000464157.1 ATP-binding cassette, sub-family A (ABC1), member 2 ENST00000463603.1 ATP-binding cassette, sub-family A (ABC1), member 2 ENST00000437791.2 ATP-binding cassette, sub-family A (ABC1), member 2 ENST00000488535.1 ATP-binding cassette, sub-family A (ABC1), member 2 ENST00000466707.1 ATP-binding cassette, sub-family A (ABC1), member 2 ENST00000492260.1 ATP-binding cassette, sub-family A (ABC1), member 2 ENST00000467624.1 ATP-binding cassette, sub-family A (ABC1), member 2 ENST00000464876.1 ATP-binding cassette, sub-family A (ABC1), member 2 ENST00000398207.4 ATP-binding cassette, sub-family A (ABC1), member 2 ENST00000425423.1 ATP-binding cassette, sub-family A (ABC1), member 2 ENST00000314412.6 fucosyltransferase 7 (alpha (1,3) fucosyltransferase) ENST00000457302.1 putativel novel transcript ENST00000434532.1 putativel novel transcript ENST00000371600.3 neural proliferation, differentiation and control, 1 ENST00000371601.4 neural proliferation, differentiation and control, 1 ENST00000496498.1 neural proliferation, differentiation and control, 1 ENST00000472668.1 neural proliferation, differentiation and control, 1 ENST00000488145.1 neural proliferation, differentiation and control, 1 ENST00000485589.1 neural proliferation, differentiation and control, 1 ENST00000355097.2 ectonucleoside triphosphate diphosphohydrolase 2 ENST00000460614.1 ectonucleoside triphosphate diphosphohydrolase 2 ENST00000312665.5 ectonucleoside triphosphate diphosphohydrolase 2 ENST00000469106.1 ectonucleoside triphosphate diphosphohydrolase 2 ENST00000439076.1 novel transcript ENST00000435463.1 putative novel transcript ENST00000456356.1 putative novel transcript ENST00000476184.1 novel protein (LOC91373) ENST00000371579.2 dipeptidylpeptidase 7 (QPP, DPP2, DPEP2, DPPII) ENST00000470766.1 dipeptidylpeptidase 7 (QPP, DPP2, DPEP2, DPPII) ENST00000473532.1 dipeptidylpeptidase 7 (QPP, DPP2, DPEP2, DPPII) ENST00000463619.1 dipeptidylpeptidase 7 (QPP, DPP2, DPEP2, DPPII) ENST00000463619.1 this variant and variant fragment .2.9 could be part of a single variant ENST00000483783.1 this variant and one or more of variant fragments .2.6, .2.8 and .2.9 could be part of a single variant ENST00000483783.1 dipeptidylpeptidase 7 (QPP, DPP2, DPEP2, DPPII) ENST00000488415.1 dipeptidylpeptidase 7 (QPP, DPP2, DPEP2, DPPII) ENST00000472306.1 dipeptidylpeptidase 7 (QPP, DPP2, DPEP2, DPPII) ENST00000485456.1 dipeptidylpeptidase 7 (QPP, DPP2, DPEP2, DPPII) ENST00000460830.1 dipeptidylpeptidase 7 (QPP, DPP2, DPEP2, DPPII) ENST00000482088.1 dipeptidylpeptidase 7 (QPP, DPP2, DPEP2, DPPII) ENST00000482088.1 this variant and variant fragment .2.5 could be part of a single variant ENST00000478597.1 dipeptidylpeptidase 7 (QPP, DPP2, DPEP2, DPPII) ENST00000478597.1 this variant and variant fragment .2.5 could be part of a single variant ENST00000497375.1 dipeptidylpeptidase 7 (QPP, DPP2, DPEP2, DPPII) ENST00000491807.1 this variant and one or more of variant fragments .2.4 and .2.4 could be part of a single variant ENST00000491807.1 dipeptidylpeptidase 7 (QPP, DPP2, DPEP2, DPPII) ENST00000473703.1 dipeptidylpeptidase 7 (QPP, DPP2, DPEP2, DPPII) ENST00000471122.1 Translation in Tr:Q59GW0 looks unconvincing ENST00000371550.4 Based on rat cDNA ENST00000371546.4 Based on rat cDNA ENST00000371555.4 Based on rat cDNA ENST00000371553.3 Based on rat cDNA ENST00000371559.4 Based on rat cDNA ENST00000485413.1 This variant and variant fragment .3.9 could be part of a single variant ENST00000462584.1 this variant and variant fragment .3.2 could be part of a single variant ENST00000462584.1 glutamate receptor, ionotropic, N-methyl D-aspartate 1 (NR1, NMDA1, NMDAR1) ENST00000371542.3 novel protein ENST00000430332.1 novel transcript ENST00000427366.1 novel transcript ENST00000413619.1 novel transcript ENST00000487917.1 this variant and one of variant fragments .5.6 or .5.7 could be part of a single variant ENST00000487917.1 novel transcript ENST00000459740.1 novel transcript ENST00000323927.2 anaphase-promoting complex subunit 2 (ANAPC2) (APC2, KIAA1406) ENST00000493730.1 this variant and one of variant fragments .5.6 or .5.7 could be part of a single variant ENST00000493730.1 novel transcript ENST00000483432.1 novel transcript ENST00000485970.1 this variant and one of variant fragments .5.6 or .5.7 could be part of a single variant ENST00000485970.1 novel transcript ENST00000471131.1 this variant and one or more of variant fragments .5.2, .5.4 and .5.5 could be part of a single variant ENST00000495611.1 this variant and one or more of variant fragments .5.2, .5.4 and .5.5 could be part of a single variant ENST00000495611.1 novel transcript ENST00000322310.5 Sjogren's syndrome nuclear autoantigen 1 ENST00000459860.1 Sjogren's syndrome nuclear autoantigen 1 ENST00000463511.1 Sjogren's syndrome nuclear autoantigen 1 ENST00000464553.1 Sjogren's syndrome nuclear autoantigen 1 ENST00000339554.3 nasal embryonic luteinizing hormone-releasing hormone factor (DKFZP586J1624) ENST00000371482.1 nasal embryonic luteinizing hormone-releasing hormone factor (DKFZP586J1624) ENST00000371472.1 nasal embryonic luteinizing hormone-releasing hormone factor (DKFZP586J1624) ENST00000484316.1 novel transcript ENST00000482448.1 novel transcript ENST00000371468.1 nasal embryonic luteinizing hormone-releasing hormone factor (DKFZP586J1624) ENST00000371457.1 novel protein (FLJ31318) ENST00000492278.1 novel transcript ENST00000469998.1 novel transcript ENST00000434090.1 novel protein (FLJ31318) ENST00000487228.1 novel transcript ENST00000491019.1 novel protein (FLJ31318) ENST00000371443.5 mitochondrial ribosomal protein L41 (RPML27, MRP-L270) ENST00000479650.1 novel transcript ENST00000467243.1 extra base in genomic sequence at 119345bp changes the frame of the translation so cannot get the translation found in sequence EM:BC040173.1. ENST00000467243.1 novel transcript ENST00000277540.2 novel protein (LOC9271) ENST00000497237.1 novel transcript ENST00000475100.1 novel transcript ENST00000472113.1 novel transcript ENST00000485189.1 novel transcript ENST00000467768.1 novel transcript ENST00000477690.1 novel transcript ENST00000470855.1 novel transcript ENST00000481839.1 novel transcript ENST00000476303.1 novel transcript ENST00000460572.1 novel transcript ENST00000491359.1 novel transcript ENST00000298585.2 melanin-concentrating hormone receptor 1 interacting zinc-finger protein (ZMYND17) (MIZIP) ENST00000471957.1 novel transcript ENST00000371421.4 novel protein (MGC40555) ENST00000483563.1 novel transcript ENST00000431925.2 novel protein (MGC40555) ENST00000461627.1 novel protein (MGC40555) ENST00000419386.1 novel protein (MGC40555) ENST00000466367.1 novel transcript ENST00000495220.1 novel transcript ENST00000471125.1 novel transcript ENST00000491911.1 novel transcript ENST00000497877.1 novel transcript ENST00000468983.1 novel transcript ENST00000475658.1 novel transcript ENST00000371417.3 novel protein ENST00000371417.3 The translation differs from that in EM:AF267857.1 due to an extra c at position 170479 in the genomic sequence which changes the frame. ENST00000496793.1 novel transcript ENST00000460843.1 NP_079033.4 ENST00000462942.1 euchromatic histone methyltransferase 1 (FLJ12879, KIAA1876) (Eu-HMTase1) ENST00000437270.1 pseudogene similar to part of SET translocation (myeloid leukemia-associated) (SET) ENST00000421194.1 forkhead box H1 (FAST1, FAST-1) (FOXH1) pseudogene ENST00000371372.1 calcium channel, voltage-dependent, L type, alpha 1B subunit (CACNN, CACNL1A5) ENST00000277551.2 calcium channel, voltage-dependent, L type, alpha 1B subunit (CACNN, CACNL1A5) ENST00000371363.1 calcium channel, voltage-dependent, L type, alpha 1B subunit (CACNN, CACNL1A5) ENST00000371357.1 calcium channel, voltage-dependent, L type, alpha 1B subunit (CACNN, CACNL1A5) ENST00000413253.1 calcium channel, voltage-dependent, L type, alpha 1B subunit (CACNN, CACNL1A5) ENST00000442569.1 pseudogene similar to part of interleukin 9 receptor (ILR9) ENST00000508529.1 tubulin, beta polypeptide 4, member Q (TUBB4Q) pseudogene ENST00000428088.1 putative novel transcript ENST00000446912.1 novel transcript ENST00000441300.1 novel pseudogene ENST00000449585.1 putative novel transcript ENST00000416477.1 novel pseudogene (FLJ40100) ENST00000423948.1 interleukin 9 receptor (IL9R) pseudogene ENST00000439456.1 alternative 5' UTR ENST00000509513.2 NP_997644.2 ENST00000381591.1 NP_006615.2 ENST00000280886.6 novel protein (KIAA0934) ENST00000421992.1 novel protein ENST00000423550.1 novel protein ENST00000425723.2 putative novel transcript ENST00000451601.1 putative novel transcript ENST00000441152.2 novel protein (FLJ38681) ENST00000381489.4 novel protein (FLJ38694) ENST00000443662.1 putative novel transcript ENST00000412695.1 putative novel transcript ENST00000316157.3 novel protein (KIAA0217) ENST00000448368.1 novel protein ENST00000440895.1 novel protein ENST00000469487.1 putative novel transcript ENST00000476529.1 novel transcript ENST00000406525.2 novel protein ENST00000481118.1 novel transcript ENST00000412411.1 novel protein ENST00000435531.1 novel transcript ENST00000360803.4 G protein-binding protein CRFG (NGB, FLJ10686, FLJ10690) ENST00000491635.1 G protein-binding protein CRFG (FLJ39774) ENST00000360059.5 G protein-binding protein CRFG ENST00000491261.1 G protein-binding protein CRFG ENST00000483839.1 G protein-binding protein CRFG (NGB, FLJ10686, FLJ10690) ENST00000277517.1 diphosphate dimethylallyl diphosphate isomerase 2 (IDI2) ENST00000437374.1 novel transcript (HT009) ENST00000420381.1 novel transcript ENST00000428780.2 novel transcript ENST00000434470.1 novel transcript ENST00000381344.3 isopentenyl-diphosphate delta isomerase ENST00000491735.1 isopentenyl-diphosphate delta isomerase ENST00000427898.1 isopentenyl-diphosphate delta isomerase ENST00000429642.1 isopentenyl-diphosphate delta isomerase ENST00000482091.1 isopentenyl-diphosphate delta isomerase ENST00000358220.1 novel protein (KIAA0982) ENST00000381329.1 novel protein (BC018044) ENST00000381329.1 There is a SNP C-> T located at position 24113 within the genomic clone RP11-529L18 which causes a premature stop and protein of 249 aa instead of size 264 aa ENST00000263150.4 novel protein ENST00000436154.1 novel protein ENST00000482165.1 novel transcript ENST00000381312.1 double-stranded RNA specific adenosine deaminase (ADAR3) ENST00000381310.3 double-stranded RNA specific adenosine deaminase (ADAR3)(FLJ30545) ENST00000474762.1 novel transcript ENST00000490172.1 novel transcript (FLJ25034) ENST00000381305.1 double-stranded RNA specific adenosine deaminase (ADAR3) ENST00000477140.1 putative novel transcript ENST00000469464.1 novel transcript (FLJ36975) ENST00000432987.1 putative novel transcript ENST00000421697.2 putative novel transcript ENST00000381301.3 novel protein ENST00000413603.1 novel transcript (FLJ40155) ENST00000438372.1 novel transcript ENST00000454424.1 putative novel transcript ENST00000435539.1 putative novel transcript ENST00000450757.1 novel transcript ENST00000421077.1 putative novel transcript (FLJ31539) ENST00000418524.1 novel transcript ENST00000436003.1 putative novel transcript ENST00000418295.1 novel transcript ENST00000414107.1 putative novel transcript ENST00000441907.1 putative novel transcript ENST00000439973.1 putative novel transcript ENST00000431209.1 putative novel transcript ENST00000438753.1 putative novel transcript ENST00000437289.1 putative novel transcript ENST00000419388.1 novel pseudogene ENST00000446337.1 putative novel transcript ENST00000439575.1 novel transcript ENST00000381125.4 phosphofructokinase, platelet ENST00000495715.1 phosphofructokinase, platelet ENST00000381075.2 phosphofructokinase, platelet ENST00000421751.1 phosphofructokinase, platelet ENST00000407806.2 phosphofructokinase, platelet ENST00000415005.1 phosphofructokinase, platelet ENST00000468050.1 phosphofructokinase, platelet ENST00000460445.1 phosphofructokinase, platelet ENST00000413079.1 phosphofructokinase, platelet ENST00000381072.1 phosphofructokinase, platelet ENST00000433193.1 phosphofructokinase, platelet ENST00000480928.1 pitrilysin metalloproteinase 1 (MP1, hMP1, KIAA1104) ENST00000490510.1 pitrilysin metalloproteinase 1 (MP1, hMP1, KIAA1104) ENST00000464395.1 pitrilysin metalloproteinase 1 (MP1, hMP1, KIAA1104) ENST00000224949.3 pitrilysin metalloproteinase 1 (MP1, hMP1, KIAA1104) ENST00000380994.1 pitrilysin metalloproteinase 1 (MP1, hMP1, KIAA1104) ENST00000455371.1 pitrilysin metalloproteinase 1 (MP1, hMP1, KIAA1104) ENST00000451454.1 pitrilysin metalloproteinase 1 (MP1, hMP1, KIAA1104) ENST00000424714.1 pitrilysin metalloproteinase 1 (MP1, hMP1, KIAA1104) ENST00000430362.1 pitrilysin metalloproteinase 1 (MP1, hMP1, KIAA1104) ENST00000488065.1 pitrilysin metalloproteinase 1 (MP1, hMP1, KIAA1104) ENST00000441377.1 novel transcript ENST00000452662.1 novel transcript ENST00000430356.1 novel transcript (FLJ40226) ENST00000421821.1 putative novel transcript ENST00000445932.1 novel transcript ENST00000417149.1 novel transcript ENST00000436340.1 putative novel transcript ENST00000413993.1 novel transcript ENST00000426811.1 putative novel transcript ENST00000413757.1 putative novel transcript ENST00000421629.1 novel transcript ENST00000415358.1 putative novel transcript ENST00000461124.1 core promoter element binding protein (GBF, ZF9, Zf9, BCD1, CPBP, KLF6) ENST00000497571.1 core promoter element binding protein (GBF, ZF9, Zf9, BCD1, CPBP, KLF6) ENST00000173785.4 core promoter element binding protein (GBF, ZF9, Zf9, BCD1, CPBP, KLF6) ENST00000492125.1 core promoter element binding protein (GBF, ZF9, Zf9, BCD1, CPBP, KLF6) ENST00000469435.1 core promoter element binding protein (GBF, ZF9, Zf9, BCD1, CPBP, KLF6) ENST00000380946.3 core promoter element binding protein (GBF, ZF9, Zf9, BCD1, CPBP, KLF6) ENST00000413339.1 putative novel transcript ENST00000450152.1 putative novel transcript ENST00000432452.1 putative novel transcript ENST00000455525.1 putative novel transcript ENST00000455199.1 novel transcript (FLJ31241) ENST00000454470.1 putative novel transcript ENST00000418372.1 putative novel transcript ENST00000454152.1 putative novel transcript (FLJ38380) ENST00000434902.1 putative novel transcript ENST00000420082.1 novel transcript ENST00000430998.1 novel transcript ENST00000443994.1 novel transcript ENST00000449712.1 novel transcript ENST00000417883.2 novel transcript ENST00000462718.2 aldo-keto reductase loopADR (MGC10612) ENST00000432950.1 aldo-keto reductase pseudogene ENST00000477661.1 aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase) ENST00000380872.3 aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase) ENST00000442997.1 aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase) ENST00000380859.1 aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase) ENST00000476100.1 aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase) ENST00000435726.1 putative novel transcript ENST00000380753.4 aldo-keto reductase family 1, member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein 3-alpha hydroxysteroid dehydrogenase, type III) ENST00000460124.1 aldo-keto reductase family 1, member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein 3-alpha hydroxysteroid dehydrogenase, type III) ENST00000443701.1 putative novel transcript ENST00000451575.1 putative novel transcript ENST00000440414.1 novel transcript ENST00000470862.1 aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) ENST00000480822.1 aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) ENST00000380554.3 aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) ENST00000480697.1 aldo-keto reductase family 1, member C3 (3-alpha hydroxysteroid dehydrogenase, type II) ENST00000451627.1 aldo-keto reductase pseudogene ENST00000427165.1 aldo-keto reductase pseudogene ENST00000469875.1 aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol ENST00000380448.1 aldo-keto reductase family 1, member C4 (chlordecone reductase; 3-alpha hydroxysteroid dehydrogenase, type I; dihydrodiol ENST00000441452.1 ADP-ribosylation factor-like 4 (ARL4) pseudogene ENST00000428920.1 putative novel transcript ENST00000449457.1 putative novel transcript ENST00000305623.8 aldo-keto reductase pseudogene ENST00000451325.1 ribosomal protein L26 (RPL26) pseudogene ENST00000380433.3 stresscopin (SPC) (SCP, UCN3, UCNIII) ENST00000486354.1 neuroepithelial cell transforming gene 1 ENST00000449083.1 neuroepithelial cell transforming gene 1 ENST00000465087.1 neuroepithelial cell transforming gene 1 ENST00000484741.1 neuroepithelial cell transforming gene 1 ENST00000478294.1 putative novel transcript ENST00000425246.1 novel transcript ENST00000427341.1 novel transcript ENST00000441526.1 ribosomal protein L23a (RPL23A) pseudogene ENST00000493897.1 ankyrin repeat and SOCS box-containing 13 ENST00000459912.1 ankyrin repeat and SOCS box-containing 13 ENST00000479033.1 ankyrin repeat and SOCS box-containing 13 ENST00000485783.1 ankyrin repeat and SOCS box-containing 13 ENST00000482921.1 ankyrin repeat and SOCS box-containing 13 ENST00000480839.1 this variant and variant 2 could be part of the same variant ENST00000480839.1 novel transcript ENST00000477043.1 novel transcript ENST00000473789.1 novel transcript ENST00000496681.1 alternative 5' UTR ENST00000482419.1 putative novel transcript ENST00000463468.1 novel transcript ENST00000487196.1 putative novel transcript ENST00000411512.1 putative novel transcript ENST00000380191.4 GDP dissociation inhibitor 2 ENST00000479928.1 GDP dissociation inhibitor 2 ENST00000447751.1 GDP dissociation inhibitor 2 ENST00000380181.3 GDP dissociation inhibitor 2 ENST00000456041.1 GDP dissociation inhibitor 2 ENST00000418688.1 GDP dissociation inhibitor 2 ENST00000380127.1 GDP dissociation inhibitor 2 ENST00000380094.4 alternative 3' UTR ENST00000191063.8 NP_001009943 ENST00000492368.1 novel transcript ENST00000362091.4 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000470089.1 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000462507.1 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000379999.5 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000469009.1 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000494526.1 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000379994.1 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000460453.1 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000485558.1 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000489042.1 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000475867.1 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000461504.1 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000485290.1 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000496013.1 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000479433.1 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000470353.1 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000481029.1 likely ortholog of mouse f-box only protein 18 (FBXO18)(FBH1,FLJ14590) ENST00000397264.3 putative novel transcript ENST00000448685.1 putative novel transcript ENST00000454321.1 putative novel transcript ENST00000532039.1 not organism-supported ENST00000440436.1 novel transcript ENST00000397237.2 ribosomal protein L32 (RPL32) pseudogene ENST00000379888.4 splicing factor (45kD) (SPF45)(MGC14439) ENST00000437845.1 splicing factor (45kD) (SPF45)(MGC14439) ENST00000432931.1 splicing factor (45kD) (SPF45)(MGC14439) ENST00000418631.1 splicing factor (45kD) (SPF45)(MGC14439) ENST00000467214.1 splicing factor (45kD) (SPF45)(MGC14439) ENST00000447032.1 splicing factor (45kD) (SPF45)(MGC14439) ENST00000481147.1 splicing factor (45kD) (SPF45)(MGC14439) ENST00000476706.1 splicing factor (45kD) (SPF45)(MGC14439) ENST00000465906.1 splicing factor (45kD) (SPF45)(MGC14439) ENST00000467080.1 splicing factor (45kD) (SPF45)(MGC14439) ENST00000496762.1 splicing factor (45kD) (SPF45)(MGC14439) ENST00000446200.1 putative novel transcript ENST00000435526.1 putative novel transcript ENST00000360521.2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 (PFKFB3)(IPFK2) ENST00000438246.1 putative novel transcript ENST00000427630.1 putative novel transcript ENST00000440192.1 syndecan binding protein (syntenin) (SDCBP) pseudogene ENST00000263125.5 protein kinase C, theta (PRKCQ) ENST00000397178.2 protein kinase C, theta (PRKCQ) ENST00000455810.1 novel transcript ENST00000414894.1 putative novel transcript ENST00000449648.1 putative novel transcript ENST00000445427.1 novel transcript ENST00000448835.1 novel transcript ENST00000417112.1 putative novel transcript ENST00000436383.1 novel transcript ENST00000457632.1 putative novel transcript ENST00000420049.1 putative novel transcript ENST00000361972.4 novel protein (KIAA1617) ENST00000379713.3 novel protein (KIAA1617) ENST00000379711.1 novel protein (KIAA1617) ENST00000421389.1 cytochrome c oxidase subunit VIc (COX6) pseudogene ENST00000420395.1 novel transcript ENST00000414631.1 putative novel transcript ENST00000256861.6 novel protein (MGC10848) ENST00000298441.6 NP_116206.3 ENST00000461751.1 novel protein (MGC10848) ENST00000379587.3 non_organism_suported ENST00000414392.1 putative novel transcript ENST00000498098.1 K ENST00000379562.3 KIN, antigenic determinant of recA protein homolog (mouse) (KIN)(BTCD,KIN17) ENST00000463666.1 KIN, antigenic determinant of recA protein homolog (mouse) (KIN)(BTCD,KIN17) ENST00000471320.1 KIN, antigenic determinant of recA protein homolog (mouse) (KIN)(BTCD,KIN17) ENST00000460089.1 KIN, antigenic determinant of recA protein homolog (mouse) (KIN)(BTCD,KIN17) ENST00000356708.7 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 ENST00000493053.1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 ENST00000462760.1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 ENST00000460362.1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 ENST00000460362.1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 (ATP5C1)(ATP5C,ATP5CL1) ENST00000335698.4 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 ENST00000465936.1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 ENST00000460820.1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 ENST00000472202.1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 ENST00000473809.1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 ENST00000480528.1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1 ENST00000344293.5 TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa (TAF3)(TAF140,TAFII140) ENST00000440219.1 mitochondrial ribosomal protein L13 (MRPL13) pseudogene ENST00000418270.1 putative novel transcript ENST00000458727.1 putative novel transcript ENST00000417359.1 putative novel transcript ENST00000481743.1 GATA binding protein 3 (GATA3)(HDR,MGC5445) ENST00000379328.3 GATA binding protein 3 (GATA3)(HDR,MGC5445) ENST00000346208.3 GATA binding protein 3 (GATA3)(HDR,MGC5445) ENST00000461472.1 GATA binding protein 3 (GATA3)(HDR,MGC5445) ENST00000451976.1 novel pseudogene (FLJ34719, FLJ14936) ENST00000428165.1 novel transcript ENST00000454056.1 novel transcript ENST00000413941.1 putative novel transcript ENST00000413286.1 novel transcript ENST00000451609.1 keratin pseudogene ENST00000425516.1 novel pseudogene (FLJ20420) ENST00000447297.1 novel transcript ENST00000456526.1 putative novel transcript ENST00000458168.1 putative novel transcript ENST00000450068.1 heat shock protein pseudogene ENST00000419836.1 putative novel transcript ENST00000429539.1 novel transcript ENST00000455871.1 putative novel transcript ENST00000435106.1 putative novel transcript ENST00000448495.1 ORM1-like (S. cerevisiae) pseudogene ENST00000415590.1 novel transcript ENST00000434919.1 putative novel transcript ENST00000446372.1 novel transcript ENST00000428520.1 novel transcript ENST00000450174.1 novel transcript ENST00000441855.1 putative novel transcript ENST00000420825.1 novel transcript ENST00000315874.3 CUG triplet repeat RNA binding protein 2 ENST00000354440.2 CUG triplet repeat RNA binding protein 2 variant 2; alternatively spliced in 3' UTR ENST00000354440.2 CUG triplet repeat RNA binding protein variant 2; alternatively spliced in 3' UTR ENST00000354440.2 CUG triplet repeat ribosomal binding protein 2 variant 2; alternatively spliced in 3' UTR ENST00000354897.2 CUG triplet repeat ribosomal binding protein 2 ENST00000354897.2 CUG triplet repeat RNA binding protein 2 ENST00000354897.2 CUG triplet repeat RNA binding protein ENST00000437825.1 putative novel transcript ENST00000428853.1 putative novel transcript ENST00000432370.1 novel transcript ENST00000420634.1 novel transcript ENST00000417273.1 putative novel transcript ENST00000379256.3 novel protein (FLJ40494) ENST00000429092.1 putative novel transcript ENST00000379237.1 protein related to the N terminus of tre (RNTRE) (KIAA0019) ENST00000443016.1 novel transcript (FLJ34168) ENST00000379215.4 novel protein (FLJ20909) ENST00000496136.1 novel transcript ENST00000420401.1 novel protein ENST00000422887.1 novel protein ENST00000495787.1 novel transcript ENST00000474155.1 novel transcript ENST00000379208.1 novel protein ENST00000444604.1 novel protein ENST00000379200.1 novel protein (MGC35403) ENST00000445498.1 novel transcript (LOC219731) ENST00000453242.1 novel transcript ENST00000356352.2 UPF2 regulator of nonsense transcripts homolog (yeast) ENST00000356352.2 alternatively spliced 5' UTR, shares CDS with bA401F24.4.2 ENST00000356352.2 alternatively spliced 5' UTR, shares CDS with bA796C22.1.2 ENST00000356352.2 alternatively spliced 5' UTR, shares CDS with Em:AC073160.1.2 ENST00000356352.2 alternative 5' UTR ENST00000357604.5 UPF2 regulator of nonsense transcripts homolog (yeast) ENST00000357604.5 alternatively spliced 5' UTR, shares CDS with Em:AC073160.1.1 ENST00000357604.5 alternatively spliced 5' UTR, shares CDS with bA796C22.1.1 ENST00000357604.5 alternatively spliced 5' UTR, shares CDS with bA401F24.4.1 ENST00000357604.5 alternative 5' UTR ENST00000379172.1 UPF2 regulator of nonsense transcripts homolog (yeast) (FLJ38872) ENST00000460569.1 UPF2 regulator of nonsense transcripts homolog (yeast) ENST00000263035.4 novel protein (KIAA1630) ENST00000437298.1 this variant and variants 3, 4 and 5 could be part of the same variant ENST00000437298.1 novel transcript ENST00000465617.1 novel transcript ENST00000415935.1 this variant and variants 5 and 6 could be part of the same variant ENST00000415935.1 novel protein ENST00000448829.1 this variant and variants 5 and 6 could be part of the same variant ENST00000448829.1 novel protein ENST00000479283.1 this variant and variants 3, 4 and 6 could be part of the same variant ENST00000479283.1 putative novel transcript ENST00000457248.1 putative novel transcript ENST00000379051.1 likely ortholog of mouse SEC61, alpha subunit 2 (S. cerevisiae) (SEC61A2) ENST00000441368.1 likely ortholog of mouse SEC61, alpha subunit 2 (S. cerevisiae) (SEC61A2) ENST00000475268.1 likely ortholog of mouse SEC61, alpha subunit 2 (S. cerevisiae) (SEC61A2) ENST00000298428.9 likely ortholog of mouse SEC61, alpha subunit 2 (S. cerevisiae) (SEC61A2) ENST00000495368.1 likely ortholog of mouse SEC61, alpha subunit 2 (S. cerevisiae) (SEC61A2) ENST00000304267.8 likely ortholog of mouse SEC61, alpha subunit 2 (S. cerevisiae) (SEC61A2) ENST00000472221.1 likely ortholog of mouse SEC61, alpha subunit 2 (S. cerevisiae) (SEC61A2) ENST00000379020.3 likely ortholog of mouse SEC61, alpha subunit 2 (S. cerevisiae) (SEC61A2) ENST00000379017.3 likely ortholog of mouse SEC61, alpha subunit 2 (S. cerevisiae) (SEC61A2) ENST00000457034.1 likely ortholog of mouse SEC61, alpha subunit 2 (S. cerevisiae) (SEC61A2) ENST00000418772.1 likely ortholog of mouse SEC61, alpha subunit 2 (S. cerevisiae) (SEC61A2) ENST00000419021.1 likely ortholog of mouse SEC61, alpha subunit 2 (S. cerevisiae) (SEC61A2) ENST00000466451.1 likely ortholog of mouse SEC61, alpha subunit 2 (S. cerevisiae) (SEC61A2) ENST00000426560.1 likely ortholog of mouse SEC61, alpha subunit 2 (S. cerevisiae) (SEC61A2) ENST00000491614.1 nudix (nucleoside diphosphate linked moiety X)-type motif 5 ENST00000378929.3 nudix (nucleoside diphosphate linked moiety X)-type motif 5 ENST00000378937.3 nudix (nucleoside diphosphate linked moiety X)-type motif 5 ENST00000378952.3 nudix (nucleoside diphosphate linked moiety X)-type motif 5 ENST00000476462.1 nudix (nucleoside diphosphate linked moiety X)-type motif 5 ENST00000378940.3 nudix (nucleoside diphosphate linked moiety X)-type motif 5 ENST00000378927.3 nudix (nucleoside diphosphate linked moiety X)-type motif 5 ENST00000498825.1 nudix (nucleoside diphosphate linked moiety X)-type motif 5 ENST00000444732.1 nudix (nucleoside diphosphate linked moiety X)-type motif 5 ENST00000421657.1 putative novel transcript ENST00000378847.3 CamKI-like protein kinase (CKLiK) (LOC221042, LOC283070) ENST00000487696.1 CamKI-like protein kinase (CKLiK) ENST00000378845.1 CamKI-like protein kinase (CKLiK) ENST00000378839.1 novel protein (FLJ38473) ENST00000378825.3 novel protein (DKFZP761F241) (FLJ20925) ENST00000441148.1 ribosomal protein L5 (RPL5) pseudogene ENST00000263036.3 optineurin ENST00000378764.1 optineurin ENST00000487935.1 optineurin ENST00000482140.1 optineurin ENST00000378757.2 optineurin ENST00000430081.1 optineurin ENST00000378752.3 optineurin ENST00000378748.3 optineurin ENST00000378747.3 optineurin ENST00000486862.1 optineurin ENST00000424614.1 optineurin ENST00000469025.1 optineurin ENST00000456003.1 small nuclear ribonucleoprotein polypeptide G (SNRPG) pseudogene ENST00000442321.1 pseudogene similar to part of chromodomain protein, Y chromosome, 1 (CDY1) ENST00000442900.1 pseudogene similar to part of COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast) (COX10) ENST00000447253.1 novel pseudogene (FLJ10648, KIAA1525) ENST00000418616.1 ribosomal protein L36A (RPL36A) pseudogene ENST00000378681.3 novel protein (LOC221044) ENST00000463405.1 novel transcript (LOC221044) ENST00000396913.2 NP_001032626.1 ENST00000453759.2 alternative 5' UTR ENST00000479604.1 Donor site of 5th exon is 6 bases longer than object 001 ENST00000327347.5 selenophosphate synthetase (SPS) ENST00000319684.4 selenophosphate synthetase (SPS) ENST00000413411.1 selenophosphate synthetase (SPS) ENST00000425947.1 selenophosphate synthetase (SPS) ENST00000494329.1 selenophosphate synthetase (SPS) ENST00000448272.1 putative novel transcript ENST00000378605.3 novel protein (FLJ40283) ENST00000465276.1 novel protein (FLJ40283) ENST00000480703.1 novel protein (FLJ40283) ENST00000463303.1 novel protein (FLJ40283) ENST00000469555.1 novel protein (FLJ40283) ENST00000492675.1 novel protein (FLJ40283) ENST00000466271.1 novel protein (FLJ40283) ENST00000486542.1 novel protein (FLJ40283) ENST00000341083.3 novel protein (FLJ40283) ENST00000440282.1 novel protein (FLJ40283) ENST00000438431.1 putative novel transcript ENST00000378572.3 PRP18 pre-mRNA processing factor 18 homolog (yeast)(PRPF18)(PRP18, hPrp18) ENST00000417658.1 PRP18 pre-mRNA processing factor 18 homolog (yeast)(PRPF18)(PRP18, hPrp18) ENST00000320054.4 PRP18 pre-mRNA processing factor 18 homolog (yeast)(PRPF18)(PRP18, hPrp18) ENST00000430832.1 novel transcript ENST00000440878.1 novel transcript ENST00000419851.1 novel transcript ENST00000437446.1 putative novel transcript ENST00000430721.1 novel transcript ENST00000445338.1 ribosomal protein L6 (RPL6) pseudogene ENST00000357447.2 novel protein (FLJ10210) ENST00000460348.1 novel protein (FLJ10210) ENST00000475325.1 novel protein (FLJ10210) ENST00000495956.1 novel protein (FLJ10210) ENST00000264546.6 novel protein (FLJ10210) ENST00000492155.1 novel protein (FLJ10210) ENST00000342409.2 novel protein (FLJ10210) ENST00000477221.1 novel protein (FLJ10210) ENST00000491869.1 novel protein (FLJ10210) ENST00000493380.1 novel protein (FLJ10210) ENST00000475141.1 novel protein (FLJ10210) ENST00000412388.1 putative novel transcript ENST00000449462.1 novel transcript ENST00000475013.1 nuclear transport factor 2 (NUTF2)(NTF2,PP15) pseudogene ENST00000446193.1 novel transcript ENST00000451617.1 novel transcript ENST00000181796.2 NP_113641.2 ENST00000468747.1 alternative 5' UTR ENST00000378467.4 alternative 5' UTR ENST00000378465.3 alternative 5' UTR ENST00000378458.2 alternative 5' UTR ENST00000478076.1 alternative 5' UTR ENST00000378462.1 alternative 5' UTR ENST00000378461.1 alternative 5' UTR ENST00000496330.1 alternative 5' UTR ENST00000479731.1 alternative 5' UTR ENST00000468492.1 alternative 5' UTR ENST00000452706.2 alternative 5' UTR ENST00000489100.1 alternative 5' UTR ENST00000494865.1 alternative 5' UTR ENST00000475786.1 alternative 5' UTR ENST00000488576.1 alternative 5' UTR ENST00000442012.1 alternative 5' UTR ENST00000482277.1 alternative 5' UTR ENST00000472095.1 alternative 5' UTR ENST00000491458.1 novel protein (MGC11034) ENST00000443282.1 novel transcript ENST00000456871.1 laminin receptor 1 (ribosomal protein SA, 67kDa) (LAMR1) pseudogene ENST00000378442.1 novel protein similar to ARMET protein precursor (Arginine-rich protein)(LOC283071). variant 1 ENST00000378441.2 novel protein similar to ARMET protein precursor (Arginine-rich protein)(LOC283071). variant 3 ENST00000467405.1 novel protein similar to ARMET protein precursor (Arginine-rich protein)(LOC283071). variant 5 ENST00000466269.1 novel protein similar to ARMET protein precursor (Arginine-rich protein)(LOC283071). variant 4 ENST00000465530.1 novel protein similar to ARMET protein precursor (Arginine-rich protein)(LOC283071). variant 2 ENST00000378372.3 likely ortholog of mouse heat shock protein, 70 kDa 4 (HSP70-4) ENST00000493863.1 likely ortholog of mouse heat shock protein, 70 kDa 4 (HSP70-4) ENST00000437161.2 likely ortholog of mouse heat shock protein, 70 kDa 4 (HSP70-4) ENST00000494337.1 likely ortholog of mouse heat shock protein, 70 kDa 4 (HSP70-4) ENST00000493178.1 likely ortholog of mouse heat shock protein, 70 kDa 4 (HSP70-4) ENST00000481379.1 likely ortholog of mouse heat shock protein, 70 kDa 4 (HSP70-4) ENST00000441647.1 likely ortholog of mouse heat shock protein, 70 kDa 4 (HSP70-4) ENST00000493614.1 likely ortholog of mouse heat shock protein, 70 kDa 4 (HSP70-4) ENST00000470430.1 likely ortholog of mouse heat shock protein, 70 kDa 4 (HSP70-4) ENST00000439979.1 putative novel transcript ENST00000378331.5 suppressor of variegation 3-9 (Drosophila) homolog 2; hypothetical protein FLJ23414 (SUV39H2)(FLJ23414) ENST00000433779.1 suppressor of variegation 3-9 (Drosophila) homolog 2; hypothetical protein FLJ23414 (SUV39H2)(FLJ23414) ENST00000378325.3 suppressor of variegation 3-9 (Drosophila) homolog 2; hypothetical protein FLJ23414 (SUV39H2)(FLJ23414) ENST00000354919.6 suppressor of variegation 3-9 (Drosophila) homolog 2; hypothetical protein FLJ23414 (SUV39H2)(FLJ23414) ENST00000313519.5 suppressor of variegation 3-9 (Drosophila) homolog 2; hypothetical protein FLJ23414 (SUV39H2)(FLJ23414) ENST00000420416.1 suppressor of variegation 3-9 (Drosophila) homolog 2; hypothetical protein FLJ23414 (SUV39H2)(FLJ23414) ENST00000412254.1 suppressor of variegation 3-9 (Drosophila) homolog 2; hypothetical protein FLJ23414 (SUV39H2)(FLJ23414) ENST00000358298.6 suppressor of variegation 3-9 (Drosophila) homolog 2; hypothetical protein FLJ23414 (SUV39H2)(FLJ23414) ENST00000378289.4 DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) (DCLRE1C) ENST00000378246.2 DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) (DCLRE1C) ENST00000378246.2 alternative 5' UTR; shares CDS with bA2K17.2.2, bA2K17.2.3, bA2K17.2.12 ENST00000378246.2 alternative 5' UTR ENST00000357717.2 DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) (DCLRE1C) ENST00000357717.2 alternative 5' UTR ENST00000357717.2 alternative 5' UTR; shares CDS with bA2K17.2.1, bA2K17.2.3, bA2K17.2.12 ENST00000378249.1 alternative 5' UTR; shares CDS with bA2K17.2.1, bA2K17.2.2, bA2K17.2.12 ENST00000378249.1 DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) (DCLRE1C) ENST00000378249.1 alternative 5' UTR ENST00000396817.2 DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) (DCLRE1C) ENST00000396817.2 alternative 5' UTR ENST00000396817.2 alternative 5' UTR; shares CDS with bA2K17.2.5, bA2K17.2.6, bA2K17.2.7, bA2K17.2.13 ENST00000378255.1 alternative 5' UTR; shares CDS with bA2K17.2.4, bA2K17.2.6, bA2K17.2.7, bA2K17.2.13 ENST00000378255.1 DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) (DCLRE1C) ENST00000378255.1 alternative 5' UTR ENST00000378254.1 alternative 5' UTR; shares CDS with bA2K17.2.4, bA2K17.2.5, bA2K17.2.7, bA2K17.2.13 ENST00000378254.1 DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) (DCLRE1C) ENST00000378254.1 alternative 5' UTR ENST00000378278.2 DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) (DCLRE1C) ENST00000378258.1 alternative 5' UTR; shares CDS with bA2K17.2.4, bA2K17.2.5, bA2K17.2.6, bA2K17.2.13 ENST00000378258.1 DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) (DCLRE1C) ENST00000378258.1 alternative 5' UTR ENST00000378242.1 DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) (DCLRE1C) ENST00000492201.1 DNA cross-link repair 1C (PSO2 homolog, S.cerevisiae) (DCLRE1C) ENST00000489845.1 DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) (DCLRE1C) ENST00000489161.1 DNA cross-link repair 1C (PSO2 homolog, S.cerevisiae) (DCLRE1C) ENST00000418843.1 DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) (DCLRE1C) ENST00000378241.1 DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) (DCLRE1C) ENST00000378241.1 alternative 5' UTR; shares CDS with bA2K17.2.4, bA2K17.2.5, bA2K17.2.6, bA2K17.2.7 ENST00000378241.1 alternative 5' UTR ENST00000456122.1 alternative 5' UTR; shares CDS with bA2K17.2.1, bA2K17.2.2, bA2K17.2.3 ENST00000456122.1 DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae) (DCLRE1C) ENST00000456122.1 alternative 5' UTR ENST00000477770.1 novel protein similar to mouse Meig1 (Meg1)(meiosis expressed gene 1) ENST00000496225.1 novel protein similar to mouse Meig1 (Meg1)(meiosis expressed gene 1) ENST00000378240.1 novel protein similar to mouse Meig1 (Meg1)(meiosis expressed gene 1) ENST00000467536.1 novel transcript ENST00000431186.1 seven transmembrane receptor (rhodopsin family) pseudogene ENST00000502808.1 olfactory receptor pseudogene ENST00000382617.3 seven transmembrane receptor (rhodopsin family) pseudogene ENST00000454630.1 pseudogene simlar to part of DNA cross-link repair 1C (PSO2 homolog, S.cerevisiae) (DCLRE1C)(SCIDA, SNM1C, ARTEMIS, RS-SCID,DCLREC1C, FLJ11360) ENST00000428897.1 novel thioesterase domain containing protein (FLJ11106) ENST00000413672.1 novel thioesterase domain containing protein (FLJ11106) ENST00000429028.1 novel thioesterase domain containing protein (FLJ11106) ENST00000378228.3 novel thioesterase domain containing protein (FLJ11106) ENST00000378225.1 novel thioesterase domain containing protein (FLJ11106) ENST00000378217.3 novel thioesterase domain containing protein (FLJ11106) ENST00000493912.1 novel thioesterase domain containing protein (FLJ11106) ENST00000485251.1 novel thioesterase domain containing protein (FLJ11106) ENST00000356189.5 FLJ38219 ENST00000452090.1 pseudogene similar to part of glyceraldehyde-3-phosphate dehydrogenase (GAPD)(G3PD,GAPDH) ENST00000378207.3 novel protein ENST00000378203.1 ribonuclease P (38kD) (RPP38) ENST00000378203.1 alternative 5' UTR; shares CDS with bA455B2.5.1, bA455B2.5.2, bA455B2.5.5 ENST00000378203.1 alternative 5' UTR ENST00000378201.1 ribonuclease P (38kD) (RPP38) ENST00000378202.5 alternative 5' UTR; shares CDS with bA455B2.5.1, bA455B2.5.3, bA455B2.5.5 ENST00000378202.5 ribonuclease P (38kD) (RPP38) ENST00000378202.5 alternative 5' UTR ENST00000378197.4 ribonuclease P (38kD) (RPP38) ENST00000378197.4 alternative 5' UTR; shares CDS with bA455B2.5.2, bA455B2.5.3, bA455B2.5.5 ENST00000378197.4 alternative 5' UTR ENST00000441850.1 ribonuclease P (38kD) (RPP38) ENST00000441850.1 alternative 5' UTR; shares CDS with bA455B2.5.1, bA455B2.5.2, bA455B2.5.3 ENST00000441850.1 alternative 5' UTR ENST00000451677.1 putative novel transcript ENST00000466201.1 N-myristoyltransferase 2 (NMT2) ENST00000486786.1 N-myristoyltransferase 2 (NMT2) ENST00000378165.3 N-myristoyltransferase 2 (NMT2) ENST00000378150.1 N-myristoyltransferase 2 (NMT2) ENST00000378143.1 N-myristoyltransferase 2 (NMT2) ENST00000478580.1 N-myristoyltransferase 2 (NMT2) ENST00000415473.1 peptidylprolyl isomerase A (cyclophilin A) (PPIA) pseudogene ENST00000450788.1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa (NDUFA4)(MLRQ) pseudogene ENST00000378116.4 novel protein (LOC221061) ENST00000477161.1 novel protein (LOC221061) ENST00000455654.1 novel protein (LOC221061) ENST00000433455.1 putative novel transcript ENST00000378076.3 integrin, alpha 8 ENST00000477064.1 integrin, alpha 8 ENST00000477064.1 this variant and variant .3 could be part of the same variant ENST00000468882.1 integrin, alpha 8 ENST00000468882.1 this variant and variant .2 could be part of the same variant ENST00000277632.3 novel protein (FLJ13397) (CARP) ENST00000477891.1 novel transcript ENST00000378036.1 novel protein ENST00000378036.1 alternative 5' UTR ENST00000378036.1 alternatively spliced 5' UTR, shares CDS with bA394I23.1.4 ENST00000378033.1 novel protein ENST00000378033.1 alternatively spliced 5' UTR, shares CDS with bA394I23.1.3 ENST00000378033.1 alternative 5' UTR ENST00000476912.1 putative novel transcript ENST00000418767.1 novel protein ENST00000436829.1 novel protein ENST00000433300.1 ferritin, light polypeptide (FTL) pseudogene ENST00000417542.1 novel transcript ENST00000434386.1 novel transcript ENST00000378000.1 alternative 5' UTR ENST00000485788.1 phosphotriesterase related ENST00000345264.5 Ras suppressor protein 1 ENST00000345264.5 alternatively spliced 5' UTR, shares CDS with bA416D8.2.2 ENST00000345264.5 alternatively spliced 5' UTR, shares CDS with Em:AC073367.1.2 ENST00000345264.5 alternative 5' UTR ENST00000377921.3 alternatively spliced 5' UTR, shares CDS with bA416D8.2.1 ENST00000377921.3 Ras suppressor protein 1 ENST00000377921.3 alternatively spliced 5' UTR, shares CDS with Em:AC073367.1.1 ENST00000377921.3 alternative 5' UTR ENST00000464074.1 Ras suppressor protein 1 ENST00000377911.1 Ras suppressor protein 1 ENST00000421480.1 putative novel transcript ENST00000377833.4 cubilin (intrinsic factor-cobalamin receptor) ENST00000438254.1 cubilin (intrinsic factor-cobalamin receptor) ENST00000433666.1 cubilin (intrinsic factor-cobalamin receptor) ENST00000377823.1 cubilin (intrinsic factor-cobalamin receptor) ENST00000437232.1 novel transcript ENST00000478317.1 vimentin ENST00000478317.1 this variant and variant 8 could be part of the same variant ENST00000478746.1 vimentin ENST00000478746.1 this variant and variant 8 could be part of the same variant ENST00000497849.1 vimentin ENST00000497849.1 this variant and variant 8 could be part of the same variant ENST00000224237.5 vimentin ENST00000487938.1 vimentin ENST00000485947.1 vimentin ENST00000469543.1 vimentin ENST00000421459.2 vimentin ENST00000421459.2 this variant and variants 4, 5 and 6 could be part of the same variant ENST00000495528.1 vimentin ENST00000456355.1 putative novel transcript ENST00000440449.1 likely ortholog of mouse sialyltransferase 8-VI (alpha-2, 8-sialytransferase) (ST8SIA-VI) ENST00000377602.4 likely ortholog of mouse sialyltransferase 8-VI (alpha-2, 8-sialytransferase) (ST8SIA-VI) ENST00000479513.1 likely ortholog of mouse sialyltransferase 8-VI (alpha-2, 8-sialytransferase) (ST8SIA-VI) ENST00000438179.1 novel pseudogene (FLJ34719, FLJ14936) ENST00000361271.3 novel protein similar to protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a (PTPLA) ENST00000498812.1 novel transcript ENST00000471481.1 novel transcript ENST00000466335.1 novel transcript ENST00000326961.5 novel protein similar to protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a (PTPLA) ENST00000377524.3 signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 ENST00000460949.1 signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 ENST00000445846.1 signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 ENST00000377500.1 signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 ENST00000475749.1 signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 ENST00000486183.1 signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 ENST00000494250.1 signal transducing adaptor molecule (SH3 domain and ITAM motif) 1 ENST00000445235.1 novel transcript ENST00000377495.1 novel protein ENST00000331429.2 novel protein similar to mannose receptor, C type 1 (MRC1) ENST00000480516.1 novel protein ENST00000239761.3 mannose receptor, C type 1 ENST00000442231.1 putative novel transcript ENST00000377374.4 novel protein (FLJ30499) ENST00000377371.3 novel protein ENST00000439319.1 novel transcript (FLJ30450) ENST00000445287.1 novel transcript ENST00000324631.7 calcium channel, voltage-dependent, beta 2 subunit ENST00000282343.8 calcium channel, voltage-dependent, beta 2 subunit ENST00000396576.2 calcium channel, voltage-dependent, beta 2 subunit ENST00000377319.3 calcium channel, voltage-dependent, beta 2 subunit ENST00000498816.1 calcium channel, voltage-dependent, beta 2 subunit ENST00000377315.4 calcium channel, voltage-dependent, beta 2 subunit ENST00000457058.1 novel transcript ENST00000425669.1 novel transcript ENST00000436485.1 putative novel transcript ENST00000433526.1 putative novel transcript ENST00000377304.4 novel protein (LOC221078) (FLJ23743) ENST00000493816.1 novel transcript ENST00000456217.1 novel transcript ENST00000449529.1 putative novel transcript ENST00000444660.1 putative novel transcript ENST00000414939.1 novel transcript ENST00000377275.3 ADP-ribosylation-like factor 8 (ARL8) ENST00000413342.1 programmed cell death 8 (apoptosis-inducing factor) (PDCD8) pseudogene ENST00000427232.1 putative novel transcript ENST00000441557.1 pseudogene similar to part of glycogen synthase kinase 3 ENST00000434717.1 ubiquitin-conjugating enzyme pseudogene ENST00000480707.1 novel transcript ENST00000426818.1 putative novel transcript ENST00000411849.1 high-mobility group nucleosome binding domain 1 (HMGN1) pseudogene ENST00000427935.1 pseudogene similar to part of ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 (ATP2A2) ENST00000451713.1 novel transcript ENST00000431157.1 novel transcript ENST00000423551.1 putative novel transcript ENST00000419987.1 NADH dehydrogenase 2 (MTND2) pseudogene ENST00000377252.3 tumor endothelial marker 7-related precursor (TEM7R) (FLJ14623) ENST00000377252.3 tumor endothelial marker 7-related protein (TEM7R) (FLJ14623) ENST00000377242.3 tumour endothelial marker 7-related precursor (TEM7R) (FLJ14623) ENST00000377242.3 tumor endothelial marker 7-related precursor (TEM7R) (FLJ4623) ENST00000377242.3 tumor endothelial marker 7-related precurosr (TEM7R) (FLJ14623) ENST00000377238.1 tumor endothelial marker 7-related precursor (TEM7R) (FLJ14623) ENST00000377238.1 novel transcript ENST00000451584.1 putative novel transcript ENST00000457220.1 S-adenosylmethionine decarboxylase proenzyme 2 (AdoMetDC) (SamDC) pseudogene ENST00000377122.4 nebulette (actin-binding Z-disk protein)(NEBL) ENST00000417816.2 nebulette (actin-binding Z-disk protein)(NEBL) ENST00000493005.1 nebulette (actin-binding Z-disk protein)(NEBL) ENST00000492325.1 nebulette (actin-binding Z-disk protein)(NEBL) ENST00000473616.1 nebulette (actin-binding Z-disk protein)(NEBL) ENST00000481592.1 nebulette (actin-binding Z-disk protein)(NEBL) ENST00000460652.1 nebulette (actin-binding Z-disk protein)(NEBL) ENST00000498424.1 nebulette (actin-binding Z-disk protein)(NEBL) ENST00000482754.1 nebulette (actin-binding Z-disk protein)(NEBL) ENST00000377119.1 nebulette (actin-binding Z-disk protein)(NEBL) ENST00000434381.1 nebulette (actin-binding Z-disk protein)(NEBL) ENST00000485750.1 nebulette (actin-binding Z-disk protein)(NEBL) ENST00000464278.1 nebulette (actin-binding Z-disk protein)(NEBL) ENST00000412991.1 pseudogene similar to part of MTND1 (NADH dehydrogenase 1) ENST00000452981.1 pseudogene similar to part of MTCO3 (COIII)(cytochrome c oxidase III) ENST00000416702.1 eukaryotic translation initiation factor 4B (EIF4B)(EIF-4B) pseudogene ENST00000425092.1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1)(B23,NPM,NUMATRIN) pseudogene ENST00000534331.1 NP_001010896.2 ENST00000529198.1 NP_001170954.1 ENST00000439097.1 putative novel transcript ENST00000417845.1 putative novel transcript ENST00000457930.1 ribosomal protein L15 (RPL15) pseudogene ENST00000415420.1 pseudogene similar to part of HOM-TES-85 (tumour antigen HOM-TES-85) ENST00000433460.1 putative novel transcript ENST00000454103.1 pseudogene similar to part of FLJ10581 ENST00000377100.3 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10)(AF10) ENST00000377072.3 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10)(AF10) ENST00000307729.7 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10)(AF10) ENST00000377091.2 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10)(AF10) ENST00000471315.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10)(AF10) ENST00000495130.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10)(AF10) ENST00000476557.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10)(AF10) ENST00000430455.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10)(AF10) ENST00000462999.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10)(AF10) ENST00000480415.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10)(AF10) ENST00000479634.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10)(AF10) ENST00000438473.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10)(AF10) ENST00000468309.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10)(AF10) ENST00000420525.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10)(AF10) ENST00000453465.1 heterogeneous nuclear ribonucleoprotein R (HNRPR)(HNRNPR, hnRNP-R) pseudogene ENST00000376980.3 DnaJ (Hsp40) homolog, subfamily C, member 1 (DNAJC1)(DNAJL1) ENST00000483085.1 DnaJ (Hsp40) homolog, subfamily C, member 1 (DNAJC1)(DNAJL1) ENST00000476103.1 DnaJ (Hsp40) homolog, subfamily C, member 1 (DNAJC1)(DNAJL1) ENST00000447548.1 DnaJ (Hsp40) homolog, subfamily C, member 1 (DNAJC1)(DNAJL1) ENST00000376946.1 DnaJ (Hsp40) homolog, subfamily C, member 1 (DNAJC1)(DNAJL1) ENST00000435632.1 CGI-45 protein (CGI-45) pseudogene ENST00000426134.1 ribosomal protein L29 (RPL29) pseudogene ENST00000422359.1 novel pseudogene ENST00000426373.1 pseudogene similar to part of PSME2 (PA28B,REGbeta,PA28beta) (proteasome (prosome, macropain) activator subunit 2 (PA28 beta)) ENST00000419532.1 ribosomal protein L31 (RPL31) pseudogene ENST00000376836.3 BUP protein (BUP) ENST00000475460.1 BUP protein (BUP) ENST00000463409.1 BUP protein (BUP) ENST00000468179.1 BUP protein (BUP) ENST00000489125.1 BUP protein (BUP) ENST00000470045.1 BUP protein (BUP) ENST00000456711.1 BUP protein (BUP) ENST00000444869.1 BUP protein (BUP) ENST00000472610.1 BUP protein (BUP) ENST00000496071.1 BUP protein (BUP) ENST00000448361.1 BUP protein (BUP) ENST00000479958.1 BUP protein (BUP) ENST00000468469.1 BUP protein (BUP) ENST00000472673.1 BUP protein (BUP) ENST00000483684.1 BUP protein (BUP) ENST00000471350.1 BUP protein (BUP) ENST00000463688.1 BUP protein (BUP) ENST00000417470.1 B lymphoma Mo-MLV insertion region (mouse) (BMI1)(MGC12685) ENST00000417470.1 alternative 5' UTR; shares CDS with bA573G6.3.1, bA573G6.3.2, bA573G6.3.8 ENST00000417470.1 alternative 5' UTR ENST00000376663.3 B lymphoma Mo-MLV insertion region (mouse) (BMI1)(MGC12685) ENST00000376663.3 alternative 5' UTR; shares CDS with bA573G6.3.2, bA573G6.3.4, bA573G6.3.8 ENST00000376663.3 alternative 5' UTR ENST00000442508.1 B lymphoma Mo-MLV insertion region (mouse) (BMI1)(MGC12685) ENST00000442508.1 alternative 5' UTR; shares CDS with bA573G6.3.1, bA573G6.3.4, bA573G6.3.8 ENST00000442508.1 alternative 5' UTR ENST00000456675.1 B lymphoma Mo-MLV insertion region (mouse) (BMI1)(MGC12685) ENST00000416820.1 B lymphoma Mo-MLV insertion region (mouse) (BMI1)(MGC12685) ENST00000416820.1 alternative 5' UTR ENST00000416820.1 alternative 5' UTR; shares CDS with bA573G6.3.1, bA573G6.3.2, bA573G6.3.4 ENST00000443519.1 B lymphoma Mo-MLV insertion region (mouse) (BMI1)(MGC12685) ENST00000496174.1 B lymphoma Mo-MLV insertion region (mouse) (BMI1)(MGC12685) ENST00000490311.1 B lymphoma Mo-MLV insertion region (mouse) (BMI1)(MGC12685) ENST00000376624.3 sperm associated antigen 6 (SPAG6)(pf16, MGC26276, Repro-SA-1,DKFZp434I153) ENST00000488555.1 sperm associated antigen 6 (SPAG6)(pf16, MGC26276, Repro-SA-1,DKFZp434I153) ENST00000456231.1 sperm associated antigen 6 (SPAG6)(pf16, MGC26276, Repro-SA-1,DKFZp434I153) ENST00000313311.6 sperm associated antigen 6 (SPAG6)(pf16, MGC26276, Repro-SA-1,DKFZp434I153) ENST00000435326.1 sperm associated antigen 6 (SPAG6)(pf16, MGC26276, Repro-SA-1,DKFZp434I153) ENST00000494631.1 sperm associated antigen 6 (SPAG6)(pf16, MGC26276, Repro-SA-1,DKFZp434I153) ENST00000490361.1 sperm associated antigen 6 (SPAG6)(pf16, MGC26276, Repro-SA-1,DKFZp434I153) ENST00000487973.1 sperm associated antigen 6 (SPAG6)(pf16, MGC26276, Repro-SA-1,DKFZp434I153) ENST00000422675.1 putative novel transcript ENST00000376573.4 phosphatidylinositol-4-phosphate 5-kinase, type II, alpha ENST00000474335.1 phosphatidylinositol-4-phosphate 5-kinase, type II, alpha ENST00000422321.1 phosphatidylinositol-4-phosphate 5-kinase, type II, alpha ENST00000432610.1 phosphatidylinositol-4-phosphate 5-kinase, type II, alpha ENST00000298032.5 novel protein (FLJ32827) (FLJ25845) ENST00000376523.1 novel protein ENST00000484642.1 novel transcript ENST00000465729.1 puative novel transcript ENST00000464017.1 novel transcript (FLJ33642) ENST00000473919.1 variant 3, 4 and 5 could be part of the same variant ENST00000473919.1 putative novel transcript ENST00000376510.3 pilin-like transcription factor (PILB) (CGI-131) ENST00000472663.1 pilin-like transcription factor (PILB) (CGI-131) ENST00000468633.1 pilin-like transcription factor (PILB) (CGI-131) ENST00000415292.1 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (YWHAZ) pseudogene ENST00000376504.3 novel protein similar to bHLH protein Ptf1-p48 (PTF1A) (possible ortholog of rodent pancreas specific transcription factor, 1a (Ptf1a)) ENST00000422120.1 novel pseudogene ENST00000376500.1 novel protein ENST00000323327.4 novel protein (MGC46732) ENST00000443224.1 putative novel transcript ENST00000376462.1 DKFZp761L0424, KIAA1217 ENST00000376456.4 FLJ33823 ENST00000376454.3 DKFZp451I248 ENST00000438429.1 FLJ39127 ENST00000422734.1 mitotic phosphoprotein 44 (LOC129401) pseudogene ENST00000413666.1 putative novel transcript (FLJ14139) ENST00000445438.1 putative novel transcript ENST00000396432.2 NP_065875.3 ENST00000477137.1 non-organism_supported ENST00000418325.1 Rho-GTPase activating protein 10 (ARHGAP10) ENST00000446003.1 alternative 5' UTR ENST00000320152.5 HHGP protein (HHGP) (FLJ11888) ENST00000376378.1 HHGP protein (HHGP) ENST00000376376.3 HHGP protein (HHGP) ENST00000446973.1 pseudogene similar to part of NADH dehydrogenase 6 (MTND6) ENST00000496261.1 novel protein similar to secreted frizzled-related protein 4 (FLJ37702) ENST00000331161.4 novel protein similar to secreted frizzled-related protein 4 (FLJ37702) variant 2; alternatively spliced in 3' UTR ENST00000483339.1 novel protein similar to secreted frizzled-related protein 4 (FLJ37702) ENST00000376363.1 novel protein similar to secreted frizzled-related protein 4 (FLJ37702) ENST00000524413.1 alternative 5' UTR ENST00000436140.1 novel transcript ENST00000449643.1 novel transcript (FLJ37439) ENST00000376351.3 novel protein (contains KIAA1136 and FLJ37801) ENST00000482641.1 novel transcript ENST00000490549.1 novel transcript ENST00000423883.1 protein x 0004 (MGC14560) pseudogene ENST00000450270.1 novel transcript ENST00000452911.1 novel transcript ENST00000265944.5 myosin IIIA ENST00000376302.1 myosin IIIA ENST00000376301.1 myosin IIIA ENST00000477691.1 myosin IIIA ENST00000478093.1 myosin IIIA ENST00000376261.3 glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) ENST00000376261.3 alternative 3' UTR ENST00000376261.3 alternatively spliced 3' UTR; shares CDS with bA420F12.1.2 ENST00000259271.3 glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) ENST00000259271.3 alternatively spliced 3' UTR; shares CDS with bA420F12.1.1 ENST00000259271.3 alternative 3' UTR ENST00000428517.2 glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) ENST00000376248.1 glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa) ENST00000376236.4 amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein ENST00000490118.1 amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein (FLJ208095) ENST00000490118.1 amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein ENST00000356785.4 amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein ENST00000493857.1 amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein ENST00000449071.1 novel transcript ENST00000455612.1 putative novel transcript ENST00000412114.1 novel transcript (LOC143107) ENST00000423917.1 novel transcript ENST00000434458.1 novel transcript ENST00000413288.1 novel transcript ENST00000454991.1 putative novel transcript ENST00000446557.1 novel transcript ENST00000376215.5 trans-prenyltransferase (TPT) ENST00000376215.5 this CDS differs from the published sequence. ENST00000473224.1 trans-prenyltransferase (TPT) ENST00000491711.1 trans-prenyltransferase (TPT) ENST00000470978.1 trans-prenyltransferase (TPT) ENST00000449300.1 heat shock protein pseudogene ENST00000458171.1 putative novel transcript ENST00000376138.3 spectrin SH3 domain binding protein 1 ENST00000376170.4 spectrin SH3 domain binding protein 1 ENST00000376166.1 spectrin SH3 domain binding protein 1 ENST00000376160.1 spectrin SH3 domain binding protein 1 ENST00000376142.2 spectrin SH3 domain binding protein 1 ENST00000359188.4 spectrin SH3 domain binding protein 1 ENST00000376139.2 spectrin SH3 domain binding protein 1 ENST00000376140.3 spectrin SH3 domain binding protein 1 ENST00000473481.1 spectrin SH3 domain binding protein 1 ENST00000458084.1 novel transcript (LOC119151) (FLJ40086) ENST00000431296.1 novel transcript ENST00000458682.1 putative novel transcript ENST00000433966.1 novel transcript (LOC338616) ENST00000445828.1 novel protein ENST00000376087.4 novel protein (KIAA1074) ENST00000490015.1 novel transcript ENST00000473304.1 novel transcript ENST00000466890.1 novel transcript ENST00000376016.3 YME1-like 1 (S. cerevisiae) ENST00000326799.3 YME1-like 1 (S. cerevisiae) ENST00000463270.1 YME1-like 1 (S. cerevisiae) ENST00000491542.1 YME1-like 1 (S. cerevisiae) ENST00000493741.1 YME1-like 1 (S. cerevisiae) ENST00000427324.1 YME1-like 1 (S. cerevisiae) ENST00000396296.3 YME1-like 1 (S. cerevisiae) ENST00000477432.1 YME1-like 1 (S. cerevisiae) ENST00000375946.4 novel protein (FLJ14813) ENST00000342386.5 novel protein (FLJ90323) ENST00000375940.4 novel protein ENST00000477034.1 novel transcript ENST00000396271.3 endozepine-related protein precursor (DKFZp434A2417) ENST00000375905.4 endozepine-related protein precursor (DKFZp434A2417) (FLJ32907) ENST00000375901.1 endozepine-related protein precursor (DKFZp434A2417) (KIAA1996) ENST00000375888.1 endozepine-related protein precursor (DKFZp434A2417) ENST00000476758.1 endozepine-related protein precursor (DKFZp434A2417) ENST00000426079.1 endozepine-related protein precursor (DKFZp434A2417) ENST00000412279.1 endozepine-related protein precursor (DKFZp434A2417) ENST00000448648.1 novel pseudogene (KIAA0563, FLJ34306) ENST00000438905.1 novel pseudogene (FLJ10376) ENST00000422707.1 pseudogene similar to part of breast cancer antigen NY-BR-1 (NY-BR-1) ENST00000445714.1 novel pseudogene ENST00000438700.3 NP_001030014.2 ENST00000356940.5 RAB18, member RAS oncogene family (RAB18) ENST00000490236.1 RAB18, member RAS oncogene family (RAB18) ENST00000375802.3 RAB18, member RAS oncogene family (RAB18) ENST00000465772.1 RAB18, member RAS oncogene family (RAB18) ENST00000484281.1 RAB18, member RAS oncogene family (RAB18) ENST00000423465.1 RAB18, member RAS oncogene family (RAB18) ENST00000460919.2 novel protein (MGC39616) ENST00000561227.1 alternative 5' UTR ENST00000481659.1 putative novel transcript ENST00000305242.5 novel protein (FLJ10817)(DKFZP434P1735) ENST00000467083.1 putative novel transcript ENST00000480504.1 novel transcript ENST00000434029.1 novel protein (FLJ10376) ENST00000486279.1 putative novel transcript ENST00000454114.1 ribosomal protein L36a-like (RPL36AL) pseudogene ENST00000425137.1 novel transcript ENST00000417885.1 mitochondrial ribosomal protein S21 (MRPS21)(MDS016, RPMS21, MRP-S21) pseudogene ENST00000375732.1 novel protein (FLJ32798) ENST00000496637.1 novel transcript ENST00000375719.3 novel protein ENST00000441595.1 novel protein ENST00000481244.1 novel transcript ENST00000474731.1 novel transcript ENST00000474682.1 putative novel transcript ENST00000435701.1 zinc finger protein pseudogene ENST00000421132.1 putative novel transcript ENST00000426103.1 laminin receptor 1 (ribosomal protein SA, 67kDa)(LAMR1) pseudogene ENST00000526722.1 alternative 5' UTR ENST00000347934.4 NP_567823.1 ENST00000420266.1 alternative 5' UTR ENST00000424454.1 alternative 5' UTR ENST00000442148.1 alternative 5' UTR ENST00000448193.1 alternative 5' UTR ENST00000414108.1 alternative 5' UTR ENST00000439676.1 WW domain-containing adapter with a coiled-coil region (WAC)(PRO1741, FLJ31290, KIAA1844, MGC10753) ENST00000456243.1 CGI-121 protein (CGI-121) pseudogene ENST00000456082.1 putative novel transcript ENST00000443246.1 putative novel transcript ENST00000446012.1 putative novel transcript ENST00000426922.1 putative novel transcript ENST00000375520.1 novel protein ENST00000480465.1 ribosomal protein L21 (RPL21) pseudogene ENST00000375500.3 similar to Lysozyme C-1 (1,4-beta-N-acylmuramidase C, EC 3.2.1.17)(MGC33408) ENST00000494304.1 similar to Lysozyme C-1 (1,4-beta-N-acylmuramidase C, EC 3.2.1.17)(MGC33408) ENST00000430295.1 novel transcript ENST00000438399.1 novel transcript ENST00000427063.2 novel transcript ENST00000455774.1 novel transcript ENST00000414457.1 novel transcript ENST00000413405.1 novel transcript ENST00000446807.1 novel transcript ENST00000438202.1 novel transcript ENST00000423223.1 novel transcript ENST00000445521.1 novel transcript ENST00000375400.3 supervillin (archvillin) (SVIL) ENST00000497265.1 supervillin (archvillin) (SVIL) ENST00000355867.4 supervillin (archvillin) (SVIL) ENST00000484139.1 supervillin (archvillin) (SVIL) ENST00000460007.1 supervillin (archvillin) (SVIL) ENST00000482607.1 supervillin (archvillin) (SVIL) ENST00000474106.1 supervillin (archvillin) (SVIL) ENST00000491872.1 supervillin (archvillin) (SVIL) ENST00000464984.1 supervillin (archvillin) (SVIL) ENST00000483758.1 supervillin (archvillin) (SVIL) ENST00000464726.1 supervillin (archvillin) (SVIL) ENST00000490031.1 supervillin (archvillin) (SVIL) ENST00000465422.1 supervillin (archvillin) (SVIL) ENST00000441292.1 single-stranded DNA binding protein (SSBP1)(SSBP) pseudogene ENST00000375377.1 novel protein (KIAA1462) ENST00000464386.1 putative novel transcript ENST00000470641.1 putative novel transcript ENST00000465712.1 novel transcript ENST00000411802.1 putative novel transcript ENST00000440791.1 eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) pseudogene ENST00000263063.3 novel protein (FLJ10486) ENST00000488290.1 novel transcript (DKFZp434I138) ENST00000417581.1 novel protein ENST00000421701.1 novel protein ENST00000471055.1 novel transcript (FLJ40533) ENST00000512082.1 pseudogene similar to part of dynamin 1 (DNM1) ENST00000340929.4 golgin pseudogene ENST00000398317.2 MKI67 (FHA domain) interacting nucleolar phosphoprotein (MKI67IP) pseudogene ENST00000440882.1 pseudogene similar to part of SIN3 homolog A, transcriptional regulator (yeast) (SIN3A) ENST00000438347.1 cyclin D3 (CCND3) pseudogene ENST00000375328.1 mitogen-activated protein kinase kinase kinase 8 ENST00000375328.1 alternatively spliced 5' UTR; shares CDS with bA449I17.6.2 ENST00000375328.1 alternative 5' UTR ENST00000415139.1 mitogen-activated protein kinase kinase kinase 8 ENST00000415139.1 this variant and variant 6 could be part of the same variant ENST00000375322.1 mitogen-activated protein kinase kinase kinase 8 ENST00000413724.1 mitogen-activated protein kinase kinase kinase 8 ENST00000413724.1 this variant and variant 6 could be part of the same variant ENST00000375321.1 mitogen-activated protein kinase kinase kinase 8 ENST00000375321.1 alternatively spliced 5' UTR; shares CDS with bA449I17.6.1 ENST00000375321.1 alternative 5' UTR ENST00000430603.1 mitogen-activated protein kinase kinase kinase 8 ENST00000430603.1 this variant and variants 3 and 4 could be part of the same variant. ENST00000396326.2 heterogeneous nuclear ribonucleoprotein A1 (HRPA1) pseudogene ENST00000440932.1 putative novel transcript ENST00000426067.1 putative novel transcript ENST00000467037.1 novel transcript ENST00000375318.2 novel protein similar to lysozyme C-1 (14-beta-N-acylmuramidase C EC 3.2.1.17) (MGC33408) ENST00000423173.1 putative novel transcript ENST00000450581.1 putative novel transcript ENST00000422642.1 supervillin (SVIL) pseudogene ENST00000416310.1 putative novel transcript ENST00000375311.1 FLJ32761 ENST00000448545.1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 10 (RNA helicase) (DDH10) pseudogene ENST00000447199.1 pseudogene similar to part of serine palmitoyltransferase, long chain base subunit 1 (SPTLC1) (HSAN, HSN1, LBC1, LCB1, SPT1, SPTI) ENST00000420945.1 putative novel transcript ENST00000414627.1 This small 19 aa match is referenced from Locuslink ENST00000433770.1 putative novel transcript ENST00000311380.4 Rho GTPase activating protein 12 (ARHGAP12)(FLJ10971, FLJ20737, FLJ21785) ENST00000375250.5 Rho GTPase activating protein 12 (ARHGAP12)(FLJ10971, FLJ20737, FLJ21785) ENST00000492028.1 Rho GTPase activating protein 12 (ARHGAP12)(FLJ10971, FLJ20737, FLJ21785) ENST00000497085.1 Rho GTPase activating protein 12 (ARHGAP12)(FLJ10971, FLJ20737, FLJ21785) ENST00000493008.1 Rho GTPase activating protein 12 (ARHGAP12)(FLJ10971, FLJ20737, FLJ21785) ENST00000344936.2 Rho GTPase activating protein 12 (ARHGAP12)(FLJ10971, FLJ20737, FLJ21785) ENST00000477117.1 Rho GTPase activating protein 12 (ARHGAP12)(FLJ10971, FLJ20737, FLJ21785) ENST00000497103.1 Rho GTPase activating protein 12 (ARHGAP12)(FLJ10971, FLJ20737, FLJ21785) ENST00000454919.1 Rho GTPase activating protein 12 (ARHGAP12)(FLJ10971, FLJ20737, FLJ21785) ENST00000450921.1 high-mobility group box 1 (HMGB1)(HMG1, HMG3, SBP-1) pseudogene ENST00000415903.1 ribosomal protein L34 (RPL34) pseudogene ENST00000302418.4 kinesin family member 5B (kinesin 1 (110-120kD))(KIF5B)(KNS, KINH, KNS1, UKHC, U-KHC) ENST00000493889.1 kinesin family member 5B (kinesin 1 (110-120kD))(KIF5B)(KNS, KINH, KNS1, UKHC, U-KHC) ENST00000446897.1 ribosomal protein S4 pseudogene ENST00000435436.1 part of a novel pseudogene ENST00000437408.1 pseudogene similar to part of RAB18 (RAB18, member RAS oncogene family) ENST00000405422.2 peptidylprolyl isomerase A (cyclophilin A) (PPIA) pseudogene ENST00000442520.1 ribosomal protein S24 (RPS24) pseudogene ENST00000415731.1 putative novel transcript ENST00000419441.1 putative novel transcript ENST00000412085.1 putative novel transcript ENST00000417447.1 putative novel transcript ENST00000362006.5 alternative 5' UTR ENST00000493685.1 variants 2 3 and 4 could be part of the same variant ENST00000493685.1 novel transcript ENST00000302316.6 FLJ13031 ENST00000422668.1 FLJ40349 ENST00000302278.3 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) ENST00000488427.1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) ENST00000480226.1 alternative 5' UTR ENST00000534049.1 alternative 5' UTR ENST00000437302.1 alternative 5' UTR ENST00000475184.1 alternative 5' UTR ENST00000528877.1 alternative 5' UTR ENST00000417122.2 alternative 5' UTR ENST00000464001.1 integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12) ENST00000493758.1 alternative 5' UTR ENST00000472147.1 alternative 5' UTR ENST00000414670.1 alternative 5' UTR ENST00000432033.1 adenylate kinase 3 like 1 (AK3L1) pseudogene ENST00000439974.2 putative novel transcript ENST00000450890.1 novel transcript ENST00000414157.1 novel transcript ENST00000422184.1 NADH dehydrogenase subunit 4L (ND4L) pseudogene ENST00000423444.1 pseudogene similar to part of integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit) (ITGB2) ENST00000468834.1 ribosomal protein L7a (RPL7A) pseudogene ENST00000414308.1 putative novel transcript ENST00000265371.3 neuropilin 1 ENST00000374875.1 neuropilin 1 ENST00000413802.1 neuropilin 1 ENST00000418675.1 neuropilin 1 ENST00000466932.1 neuropilin 1 ENST00000431894.1 neuropilin 1 ENST00000374822.4 neuropilin 1 ENST00000374821.5 neuropilin 1 ENST00000374823.5 neuropilin 1 ENST00000432372.1 neuropilin 1 ENST00000455749.1 neuropilin 1 ENST00000451530.1 putative novel transcript ENST00000443179.1 putative novel transcript ENST00000457848.1 novel transcript ENST00000366376.2 putative novel transcript ENST00000418077.1 60S ribosomal protein L23 (RPL23) pseudogene ENST00000434552.1 novel transcript ENST00000374789.3 par-3 partitioning defective 3 homolog (C.elegans) ENST00000374788.3 par-3 partitioning defective 3 homolog (C.elegans) ENST00000346874.4 par-3 partitioning defective 3 homolog (C.elegans) ENST00000374794.3 par-3 partitioning defective 3 homolog (C.elegans) ENST00000350537.4 par-3 partitioning defective 3 homolog (C.elegans) ENST00000374790.3 par-3 partitioning defective 3 homolog (C.elegans) ENST00000466092.1 par-3 partitioning defective 3 homolog (C.elegans) ENST00000374776.1 par-3 partitioning defective 3 homolog (C.elegans), variant 1 continued from bA51B10.1.1 in Em:AL450337 continued as bA198D23.1.1 in Em:AL360233 ENST00000374776.1 par-3 partitioning defective 3 homolog (C.elegans) ENST00000374773.1 par-3 partitioning defective 3 homolog (C.elegans) ENST00000374768.1 par-3 partitioning defective 3 homolog (C.elegans) ENST00000423418.1 transcription elongation factor B(SIII) (TCEB2) pseudogene ENST00000411602.1 60S ribosomal protein L37 (RPL37) pseudogene ENST00000399739.2 40S ribosomal protein S12 (RPS12) pseudogene ENST00000446211.1 putative novel transcript ENST00000445923.1 pseudogene similar to part of synovial sarcoma translocation, chromosome 18 protein (SS18) ENST00000451920.1 peroxiredoxin 2 (PRDX2) pseudogene ENST00000374751.3 cullin 2 ENST00000374748.1 cullin 2, variant 2; alternatively spliced in 5' UTR ENST00000374746.1 cullin 2 ENST00000374749.3 cullin 2 ENST00000374754.3 cullin 2 ENST00000421317.1 cullin 2 ENST00000468804.1 cullin 2 ENST00000478044.1 cullin 2 ENST00000450742.1 continues from bA134A8.3.1 in Em:AL157783 ENST00000450742.1 novel transcript ENST00000423819.1 novel transcript ENST00000457255.1 continues from bA134A8.3.2 in Em:AL157783 ENST00000457255.1 novel transcript ENST00000450106.1 novel transcript ENST00000474362.1 NP_878270.1 ENST00000482646.1 cAMP responsive element modulator ENST00000374726.3 NP_001872.3 ENST00000374726.3 cAMP responsive element modulator ENST00000460270.1 NP_878273.1 ENST00000354759.3 NP_898831.1 ENST00000489321.1 alternative 5' UTR ENST00000427847.2 alternative 5' UTR ENST00000345491.3 NP_853549.1 ENST00000374734.3 non-submitted evidence ENST00000374734.3 NP_898830.1 ENST00000337656.4 non-submitted evidence ENST00000337656.4 NP_898829.1 ENST00000348787.2 NP_898883.1 ENST00000361599.4 NP_877572.1 ENST00000342105.3 NP_877570.1 ENST00000495301.1 alternative 5' UTR ENST00000472813.1 cAMP responsive element modulator ENST00000473940.1 NP_874386.1 ENST00000488328.1 NP_874387.1 ENST00000356917.5 NP_874389.1 ENST00000488741.1 NP_874392.1 ENST00000474931.1 NP_874390.1 ENST00000344351.5 NP_874391.1 ENST00000490511.1 NP_874393.1 ENST00000438388.1 vacuolar ATPase subunit (ATP6V1G2) pseudogene ENST00000439198.1 putative novel transcript ENST00000490012.1 novel transcript ENST00000493157.1 novel transcript ENST00000374704.4 novel transcript ENST00000492478.1 novel transcript ENST00000470025.1 novel transcript ENST00000465416.1 novel transcript ENST00000497692.1 novel transcript ENST00000321660.1 connexin40.1 ENST00000374694.1 frizzled homolog 8 (Drosophila) ENST00000425095.1 ribosomal protein L7 (RPL7) pseudogene ENST00000442783.1 putative novel transcript ENST00000412439.1 putative novel transcript ENST00000418405.1 NADH dehydrogenase 5 (MTND5) pseudogene ENST00000447010.1 pseudogene similar to part of NADH dehydrogenase 4 (MTND4) ENST00000418875.1 novel transcript ENST00000426283.1 putative novel transcript ENST00000440465.1 probable pseudogene ENST00000440465.1 novel protein similar to Pre-B cell enhancing factor (PBEF) (LOC283016) ENST00000457804.1 putative novel transcript ENST00000437526.1 pseudogene similar to MAP kinase-interacting serine/threonine kinase 1 (MKNK1) ENST00000431356.1 ADP-ribosylation factor-like 6 interacting protein (ARL6IP) pseudogene ENST00000361713.1 NMD exception ENST00000374660.1 breast cancer antigen NY-BR-1 (NY-BR-1) ENST00000374660.1 PMID: 11280766. Jager et. al ENST00000374660.1 NMD exception ENST00000475522.1 novel transcript ENST00000436077.1 novel transcript ENST00000420453.1 pseudogene similar to part of ATP8A2 (ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2) ENST00000426471.1 novel transcript ENST00000435629.1 novel transcript ENST00000442439.1 novel transcript ENST00000457388.1 novel pseudogene ENST00000429536.1 vomeronasal receptor pseudogene ENST00000425494.1 transforming, acidic coiled-coil containing protein 1 (TACC1)(Ga55, KIAA1103) pseudogene ENST00000448191.1 mitochondrial NADH dehydrogenase 1 (MTND1) pseudogene ENST00000432530.1 putative novel transcript ENST00000452497.1 zinc finger protein pseudogene ENST00000485560.1 novel transcript ENST00000395867.3 novel Kruppel-type zinc finger protein (LOC57209) ENST00000494133.1 novel transcript ENST00000374648.3 novel Kruppel-type zinc finger protein (LOC57209) ENST00000395873.3 novel Kruppel-type zinc finger protein (LOC57209) ENST00000395874.2 novel Kruppel-type zinc finger protein (LOC57209) ENST00000414066.1 tousled-like kinase 1 (TLK1)(KIAA0137, PKU-BETA) pseudogene ENST00000429214.1 putative novel transcript ENST00000406795.2 pseudogene similar to part of a zinc finger protein ENST00000432492.1 zinc finger protein pseudogene ENST00000302609.7 zinc finger protein 25 (KOX 19) ENST00000374633.1 zinc finger protein 25 (KOX 19) ENST00000467975.1 zinc finger protein 25 (KOX 19) ENST00000458705.2 zinc finger protein 33a (KOX 31) ENST00000469037.1 zinc finger protein 33a (KOX 31) ENST00000476504.1 zinc finger protein 33a (KOX 31) ENST00000478556.1 zinc finger protein 33a (KOX 31) ENST00000495197.1 eukaryotic translation initiation factor 3 subunit 6 interacting protein (EIF3S6IP) pseudogene ENST00000444174.1 FXYD domain containing ion transport regulator 6 (FXYD6) pseudogene ENST00000498773.1 zinc finger protein 37a (KOX21) ENST00000361085.4 zinc finger protein 37a (KOX21) ENST00000479469.1 zinc finger protein 37a (KOX 21) ENST00000463776.1 zinc finger protein 37a (KOX21) ENST00000477790.1 zinc finger protein 37a (KOX21) ENST00000430475.1 par-3 partitioning defective 3 homolog (C.elegans) (PARD3) pseudogene ENST00000419779.1 novel transcript ENST00000423162.1 novel transcript ENST00000453482.1 pseudogene similar to part of ARF GTPase-activating protein (MRIP2) ENST00000450980.1 novel transcript ENST00000418733.1 pseudogene similar to part of excision repair cross-complementing rodent repair deficiency, complementation group 3 (xeroderma pigmentosum group B complementing) (ERCC3) ENST00000239730.4 novel protein similar to CDC10 cell division cycle 10 homolog (S.cerevisiae) (CDC10) ENST00000475691.1 novel transcript ENST00000489046.1 novel protein similar to CDC10 cell division cycle 10 homolog (S.cerevisiae) (CDC10) ENST00000489259.1 novel transcript ENST00000496964.1 novel transcript ENST00000476473.1 novel transcript ENST00000468615.1 novel transcript ENST00000474003.1 novel transcript ENST00000497392.1 novel transcript ENST00000447412.2 not best-in-genome evidence ENST00000447412.2 novel transcript ENST00000444451.1 capicua homolog (Drosophila) (CIC) pseudogene ENST00000428915.1 not best-in-genome evidence ENST00000429313.1 novel protein similar to ATP-binding cassette sub-family D (ALD) member 1 (ABCD1) ENST00000428454.1 poly(A) binding protein cytoplasmic 3 (PABPC3) pseudogene ENST00000452667.1 novel transcript ENST00000431389.1 novel transcript ENST00000416231.1 novel transcript ENST00000448440.1 actin-related protein 3 homolog (yeast) (ACTR3) pseudogene ENST00000423877.1 novel transcript ENST00000456744.1 novel transcript ENST00000423458.1 RING finger protein 18 (RNF18) pseudogene ENST00000427864.1 N-acetylated alpha-linked acidic dipeptidase 2 (NAALAD2) pseudogene ENST00000446298.1 pseudogene similar to part of kinase suppressor of ras (KSR) ENST00000442306.1 Ig kappa chain precursor V region pseudogene ENST00000452851.1 poly(A) binding protein, cytoplasmic 1 (PABPC1) pseudogene ENST00000423987.1 zinc finger protein pseudogene ENST00000483242.1 novel transcript ENST00000472090.1 novel transcript ENST00000431603.1 novel protein ENST00000332123.5 novel transcript (FLJ34785) ENST00000424751.1 novel transcript (FLJ33470) ENST00000452075.2 novel transcript (FLJ23327) ENST00000462075.1 zinc finger protein 11b (KOX 2) ENST00000486187.1 zinc finger protein 11b (KOX 2) ENST00000465206.1 zinc finger protein 11b (KOX 2) ENST00000359467.2 zinc finger protein 11b (KOX 2) ENST00000476796.1 zinc finger protein 11b (KOX 2) ENST00000493285.1 zinc finger protein 11b (KOX 2) ENST00000486614.1 zinc finger protein 11b (KOX 2) ENST00000435210.1 vomeronasal receptor (V1R) pseudogene ENST00000411439.1 novel transcript ENST00000412710.1 cubilin (intrinsic factor-cobalamin receptor) (CUBN) pseudogene ENST00000439913.1 novel transcript ENST00000374518.4 KIAA0187 ENST00000421320.1 putative novel transcript (FLJ36774) ENST00000431395.1 novel transcript ENST00000340058.4 NP_065681.1 ENST00000374459.1 CG4853 gene product (LOC221002) ENST00000395810.1 CG4853 gene product (LOC221002) ENST00000451438.1 novel transcript ENST00000476166.1 novel transcript ENST00000480834.1 novel transcript ENST00000479189.1 novel transcript ENST00000357065.4 heterogeneous nuclear ribonucleoprotein F ENST00000356053.3 heterogeneous nuclear ribonucleoprotein F ENST00000337970.3 heterogeneous nuclear ribonucleoprotein F ENST00000477108.1 novel transcript ENST00000498176.1 novel transcript ENST00000442526.1 novel transcript ENST00000455398.1 alternative 5' UTR ENST00000490208.1 putative novel transcript ENST00000451167.1 alternative 5' UTR ENST00000434057.1 zinc finger pseudogene ENST00000421913.1 zinc finger protein pseudogene ENST00000306006.6 zinc finger protein 239 (MOK2, HOK-2) ENST00000374446.1 zinc finger protein 239 (MOK2, HOK-2) ENST00000491188.1 novel transcript ENST00000417455.1 Adenylyl cyclase-associated protein 1 (CAP 1) pseudogene ENST00000430885.1 alternative 5' UTR ENST00000374435.3 alternative 5' UTR ENST00000458063.1 novel transcript ENST00000431956.1 putative novel transcript ENST00000436649.1 ribosomal protein L21 (RPL21) pseudogene ENST00000374433.2 zinc finger protein 32 (KOX 30) ENST00000475186.1 novel transcript ENST00000485351.1 putative novel transcript ENST00000453284.1 putative novel transcript ENST00000418966.1 novel transcript ENST00000418426.1 putative novel transcript ENST00000451503.1 ubiquinol-cytochrome C reductase pseudogene ENST00000447108.1 transcription elongation factor B (SIII) pseudogene ENST00000423349.1 putative novel transcript ENST00000419406.1 putative novel transcript ENST00000431737.1 novel transcript ENST00000438454.1 putative novel transcript ENST00000446107.1 putative novel transcript ENST00000431987.1 putative novel transcipt ENST00000451929.1 novel transcript (LOC283033) ENST00000437014.1 putative novel transcript ENST00000452578.1 putative novel transcript ENST00000374429.2 NP_000600.1 ENST00000395793.3 Novel transcript ENST00000374426.2 NP_001029058.1 ENST00000343575.6 chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) ENST00000392269.2 60S ribosomal protein L9 (RPL9) pseudogene ENST00000456722.1 putative novel transcript ENST00000424793.1 eukaryotic translational initiation factor 2A pseudogene ENST00000450287.1 novel transcript ENST00000436877.1 novel transcript ENST00000389583.4 novel protein ENST00000425541.1 putative novel transcript ENST00000340258.4 AD037 protein (AD037) ENST00000427758.1 AD037 protein (AD037) ENST00000483709.1 AD037 protein (AD037) ENST00000462822.1 AD037 protein (AD037) ENST00000428466.1 AD037 protein (AD037) ENST00000465735.1 AD037 protein (AD037) ENST00000471941.1 AD037 protein (AD037) ENST00000471808.1 AD037 protein (AD037) ENST00000484477.1 AD037 protein (AD037) ENST00000493490.1 AD037 protein (AD037) ENST00000496638.1 putative novel transcript ENST00000298295.3 decidual protein induced by progesterone (DEPP) ENST00000448778.1 decidual protein induced by progesterone (DEPP ENST00000448778.1 alternative 5' UTR ENST00000298298.1 novel protein (FLJ30567) ENST00000298299.3 zinc finger protein 22 (KOX 15) ENST00000456938.1 novel transcript ENST00000455142.1 novel pseudogene similar to part of KIAA1052 ENST00000455650.1 ribosomal protein S19 pseudogene ENST00000450224.1 novel transcript ENST00000423875.1 novel transcript ENST00000448600.1 novel transcript ENST00000437884.1 Ras suppressor protein 1 pseudogene ENST00000457461.1 pseudogene similar to part of cubilin (intrinsic factor-cobalamin receptor)(CUBN) ENST00000427229.1 novel transcript ENST00000433115.1 novel pseudogene ENST00000444850.1 breast cancer antigen NY-BR-1 pseudogene ENST00000422807.1 putative novel transcript ENST00000443534.1 pseudogene similar to part of cubilin (intrinsic factor-cobalamin receptor)(CUBN) ENST00000436165.1 seven transmembrane helix receptor (FLJ31393) pseudogene ENST00000436165.1 unitary_pseudogene ENST00000553795.1 NP_001004297.2 ENST00000374401.2 alternative 5' UTR ENST00000374391.2 arachidonate 5-lipoxygenase ENST00000483623.1 arachidonate 5-lipoxygenase ENST00000475300.1 arachidonate 5-lipoxygenase ENST00000493336.1 arachidonate 5-lipoxygenase ENST00000481117.1 arachidonate 5-lipoxygenase ENST00000498461.1 arachidonate 5-lipoxygenase ENST00000435635.1 novel transcript ENST00000451376.1 putative novel transcript ENST00000344646.5 novel protein (LOC93550) ENST00000374371.1 novel protein (LOC93550) ENST00000374370.1 novel protein ENST00000484333.1 novel protein ENST00000465407.1 novel protein ENST00000495747.1 novel transcript ENST00000497028.1 novel transcript ENST00000335258.7 novel protein ENST00000454844.1 ARF GTPase-activating protein (MRIP2) pseudogene ENST00000426241.1 novel pseudogene (KIAA0592) ENST00000424552.1 novel pseudogene ENST00000374362.2 novel protein (KIAA0592) ENST00000374362.2 continued as bA534N5.1.1 in Em:AL731535 ENST00000420848.1 novel protein (KIAA0592) ENST00000420848.1 continued as bA534N5.1.2 in Em:AL731535 ENST00000485850.1 novel transcript ENST00000374359.1 novel protein ENST00000471102.1 novel transcript ENST00000411791.2 putative novel transcript ENST00000430779.2 novel transcript ENST00000492347.1 novel transcript ENST00000495243.1 novel transcript ENST00000490752.1 novel transcript ENST00000440803.1 novel transcript ENST00000417555.1 pseudogene similar to part of poly (ADP-ribose) glycohydrolase (PARG) ENST00000374340.3 non-organism_supported ENST00000395727.2 NP_001035851.1 ENST00000505814.1 alternative 5' UTR ENST00000509599.1 alternative 5' UTR ENST00000417004.1 alternative 5' UTR ENST00000506881.1 alternative 5' UTR ENST00000417888.1 novel protein similar to ARF GTPase-activating protein (MRIP2) (fragment) ENST00000435321.1 pseudogene similar to part of glutamate dehydrogenase 1 (GLUD1) ENST00000399571.2 dual specificity phosphatase 8 (DUSP8) pseudogene ENST00000443343.1 pseudogene similar to part of cathepsin L (CTSL) ENST00000453853.1 novel transcript ENST00000497389.1 novel transcript ENST00000301038.3 novel protein similar to FLJ12916 ENST00000470958.1 novel transcript ENST00000475914.1 novel transcript ENST00000448647.1 Ras homolog enriched in brain 2 (RHEB2) pseudogene ENST00000424615.1 putative novel transcript ENST00000437899.1 novel transcript ENST00000374328.3 alternative 5' UTR ENST00000374317.1 novel protein (LOC142964) ENST00000395716.1 Pancreatic polypeptide receptor 1 ENST00000422732.1 novel transcript ENST00000421426.1 heterogeneous nuclear ribonucleoprotein A1 (HNRPA1) pseudogene ENST00000481177.1 A variant has not been annotated corresponding to EST Em:BI062059.1 as this EST appears to be transcribed from a locus on bA145E20, as such an object has been annotated at the bA145E20 locus and not here on bA144G6 ENST00000481177.1 novel transcript ENST00000452267.1 novel protein ENST00000434533.1 putative novel transcript ENST00000399538.2 dual specificity phosphatase 8 (DUSP8) pseudogene ENST00000423775.1 pseudogene similar to part of cathepsin L (CTSL) ENST00000456034.1 novel transcript ENST00000439776.1 novel transcript ENST00000323387.5 novel pseudogene (FLJ12916) (MGC5560) ENST00000450289.1 Ras homolog enriched in brain (RHEB) pseudogene ENST00000453605.1 putative novel transcript ENST00000418196.1 putative novel transcript ENST00000399501.2 S-adenosylhomocysteine hydrolase (AHCY) pseudogene ENST00000454837.1 novel transcript ENST00000424375.1 novel transcript similar to LOC195977 (FLJ32754) ENST00000441923.1 this variant and variants 3 and 4 could be part of the same variant ENST00000441923.1 novel transcript ENST00000447511.1 this variant and variant 2 could be part of the same variant ENST00000447511.1 novel transcript ENST00000434908.1 this variant and variant 2 could be part of the same variant ENST00000434908.1 novel transcript ENST00000280961.5 ARF GTPase-activating protein (MRIP2) pseudogene ENST00000399377.3 novel pseudogene ENST00000445847.1 novel transcript ENST00000340243.6 novel protein similar to annexin A8 (ANXA8) ENST00000374277.5 novel protein similar to annexin A8 (ANXA8) ENST00000490584.1 novel transcript ENST00000430074.1 novel protein ENST00000379351.3 solute carrier family 9 member 3 (SLC9A3) pseudogene ENST00000420079.1 novel protein similar to N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2 (ASAH2) ENST00000457349.1 novel pseudogene ENST00000428057.1 cathepsin pseudogene ENST00000399452.2 dual specificity phosphatase 8 (DUSP8) pseudogene ENST00000456732.2 KIAA0187 pseudogene ENST00000432490.1 novel protein similar to ARF GTPase-activating protein (MRIP2) ENST00000457620.1 novel protein ENST00000466209.1 novel transcript ENST00000357718.4 annexin A8 ENST00000344416.5 annexin A8 ENST00000454672.1 novel transcript ENST00000433077.1 alternative 3' UTR ENST00000442001.1 alternative 3' UTR ENST00000436850.1 alternative 3' UTR ENST00000412534.1 alternative 3' UTR ENST00000444585.1 alternative 3' UTR ENST00000425196.1 alternative 3' UTR ENST00000431774.1 putative novel transcript ENST00000224600.4 retinol binding protein 3, interstitial ENST00000249598.1 growth differentiation factor 2 ENST00000374247.1 growth differentiation factor 10 ENST00000224605.2 growth differentiation factor 10 ENST00000374237.3 non-organism_supported ENST00000515532.1 alternative 5' UTR ENST00000509631.1 alternative 5' UTR ENST00000417914.1 alternative 5' UTR ENST00000510141.1 alternative 5' UTR ENST00000449800.1 novel transcript ENST00000436180.1 novel transcript ENST00000509944.1 novel protein similar to ARF GTPase-activating protein (MRIP2) ENST00000509393.1 KIAA0187 pseudogene ENST00000438010.1 novel transcript ENST00000451308.1 glutamate dehydrogenase pseudogene 2 ENST00000448376.1 dual specificity phosphatase 8 (DUSP8) pseudogene ENST00000430284.1 novel transcript ENST00000423864.1 novel transcript ENST00000419427.1 novel pseudogene ENST00000479781.1 novel transcript ENST00000342763.4 novel transcript ENST00000339771.4 ARF GTPase-activating protein (MRIP2) pseudogene ENST00000458344.1 KIAA0187 pseudogene ENST00000428535.1 novel protein tyrosine phosphatase (fragment) highly similar to DKFZP566K0524 ENST00000455582.1 novel protein tyrosine phosphatase (fragment) highly similar to DKFZP566K0524 ENST00000506185.1 novel protein tyrosine phosphatase (fragment) highly similar to DKFZP566K0524 ENST00000429307.1 putative novel transcript ENST00000505547.1 putative novel transcript ENST00000425165.1 ribosomal protein S6 (RPS6) pseudogene ENST00000432379.1 mitogen-activated protein kinase 8 ENST00000429041.1 mitogen-activated protein kinase 8 ENST00000374189.1 mitogen-activated protein kinase 8 (JNK1A2) ENST00000426557.1 mitogen-activated protein kinase 8 ENST00000476134.1 mitogen-activated protein kinase 8 ENST00000374182.3 mitogen-activated protein kinase 8 (JNK1) ENST00000374179.3 mitogen-activated protein kinase 8 (JNK1B1) ENST00000374176.4 mitogen-activated protein kinase 8 (JNK1B2) ENST00000374174.1 mitogen-activated protein kinase 8 ENST00000469879.1 mitogen-activated protein kinase 8 ENST00000471272.1 mitogen-activated protein kinase 8 ENST00000469110.1 mitogen-activated protein kinase 8 (DKFZp434B231) ENST00000482840.1 mitogen-activated protein kinase 8 ENST00000459755.1 mitogen-activated protein kinase 8 (FLJ36681) ENST00000374172.1 novel protein (LOC58504) (FLJ30475) ENST00000374170.1 non-organism_supported ENST00000489984.1 novel transcript ENST00000491108.1 novel transcript ENST00000464445.1 novel transcript ENST00000412463.1 cytochrome c oxidase subunit VIIb (COX7B) pseudogene ENST00000440750.1 putative novel transcript ENST00000312002.6 non-canonical splicing between exons 17 and 18 ENST00000374161.3 FLJ36288 ENST00000265453.7 KIAA1607, DKFZp667K0421, FLJ23863 ENST00000465910.1 FLJ00111 ENST00000434320.1 ribosomal protein L13a (RPL13A) pseudogene ENST00000414178.1 putative novel transcript ENST00000423256.1 putative novel transcript ENST00000430438.1 novel transcript ENST00000374160.3 novel Leucine Rich Repeat domain-containing protein (highly similar to Mus musculus 4930442L21Rik) ENST00000428825.1 putative novel transcript ENST00000422966.1 novel transcript ENST00000332853.3 novel protein ENST00000476018.1 novel transcript ENST00000298454.3 novel protein, variant 2 (FLJ31737) ENST00000442525.1 novel transcript, variant 1 (FLJ35736) ENST00000440054.1 novel transcript ENST00000443389.1 novel transcript ENST00000435809.1 novel transcript ENST00000311787.5 novel protein (LOC170370) ENST00000374156.4 novel protein ENST00000374153.1 novel protein ENST00000488276.1 novel transcript ENST00000474718.1 novel protein ENST00000453436.1 novel protein ENST00000374148.1 novel protein ENST00000470884.1 novel transcript ENST00000437677.1 putative novel transcript ENST00000442700.1 novel transcript ENST00000374144.3 DKFZp451F1910 ENST00000374139.1 novel protein similar to rodent paired-like homeodomain trancription factor Drg11 ENST00000423283.1 putative novel transcript ENST00000465653.1 excision repair cross-complementing rodent repair deficiency, complementation group 6 (CSB, CKN2, COFS, RAD26) ENST00000465653.1 this variant and one or more of variant fragments .3.3 through .3.5 could be part of one single variant ENST00000475116.1 excision repair cross-complementing rodent repair deficiency, complementation group 6 (CSB, CKN2, COFS, RAD26) ENST00000475116.1 this variant and one or more of variant fragments .3.2, .3.4 and .3.5 could be part of one single variant ENST00000479652.1 this variant and one or more of variant fragments .3.2, .3.3 and .3.5 could be part of one single variant ENST00000479652.1 excision repair cross-complementing rodent repair deficiency, complementation group 6 (CSB, CKN2, COFS, RAD26) ENST00000462247.1 alternative 5' UTR ENST00000339797.1 choline acetyltransferase ENST00000339797.1 alternative 5' UTR ENST00000460699.1 choline acetyltransferase ENST00000497767.1 choline acetyltransferase ENST00000481336.1 choline acetyltransferase ENST00000337653.2 choline acetyltransferase ENST00000466590.1 choline acetyltransferase ENST00000490270.1 choline acetyltransferase ENST00000374113.3 novel protein, variant 1 (FLJ34454) ENST00000374111.3 novel protein ENST00000374112.3 novel protein ENST00000374103.4 novel protein, variant 1 (FLJ10851) ENST00000490844.1 novel transcript, variant 2 (FLJ31255) ENST00000490844.1 this variant and one or more of variants .3.3 and .3.4 could be part of a single variant ENST00000496884.1 this variant and one or more of variants .3.2 and .3.3 could be part of a single variant ENST00000496884.1 novel transcript ENST00000471460.1 this variant and one or more of variants .3.2 and .3.4 could be part of a single variant ENST00000471460.1 novel transcript ENST00000420752.1 pseudogene similar to part of mitogen-activated protein kinase 6 (MAPK6) ENST00000432127.1 poly (ADP-ribose) glycohydrolase ENST00000402038.2 poly (ADP-ribose) glycohydrolase ENST00000492350.1 poly (ADP-ribose) glycohydrolase ENST00000492350.1 this variant and variant .1.4 could be part of a single variant ENST00000497481.1 poly (ADP-ribose) glycohydrolase ENST00000497481.1 this variant and variant .1.3 could be part of a single variant ENST00000413846.1 ribosomal protein L35a (RPL35A) pseudogene ENST00000426412.2 putative novel transcript ENST00000425119.2 novel protein similar to ARF GTPase-activating protein (MRIP2) ENST00000479304.1 novel transcript ENST00000470172.1 putative novel transcript ENST00000484805.1 novel transcript ENST00000482521.1 putative novel transcript ENST00000418400.1 novel transcript ENST00000415340.1 putative novel transcript ENST00000404618.2 poly (ADP-ribose) glycohydrolase (PARG) pseudogene ENST00000453154.1 ribosomal protein L35a (RPL35A) pseudogene ENST00000478381.1 novel transcript ENST00000462932.1 novel transcript ENST00000483296.1 novel transcript ENST00000374095.5 novel protein similar to ARF GTPase-activating protein (MRIP2) ENST00000439573.1 ribosomal protein L35a (RPL35A) pseudogene ENST00000449598.1 pseudogene similar to part of ral guanine nucleotide dissociation stimulator (RALGDS) ENST00000358559.2 microseminoprotein, beta-, variant 1 (a) ENST00000298239.6 microseminoprotein, beta-, variant 2 (b) ENST00000487536.1 microseminoprotein, beta- ENST00000478719.1 microseminoprotein, beta- ENST00000466268.1 microseminoprotein, beta- ENST00000474170.1 microseminoprotein, beta- ENST00000498586.1 nuclear receptor coactivator 4 ENST00000374087.4 nuclear receptor coactivator 4 ENST00000344348.6 nuclear receptor coactivator 4 ENST00000374082.1 nuclear receptor coactivator 4 ENST00000431200.1 nuclear receptor coactivator 4 ENST00000260867.4 translocase of inner mitochondrial membrane 23 ENST00000444743.1 translocase of inner mitochondrial membrane 23 ENST00000485812.1 translocase of inner mitochondrial membrane 23 ENST00000374065.3 translocase of inner mitochondrial membrane 23 ENST00000476778.1 translocase of inner mitochondrial membrane 23 ENST00000469116.1 translocase of inner mitochondrial membrane 23 ENST00000480051.1 translocase of inner mitochondrial membrane 23 ENST00000456092.1 poly (ADP-ribose) glycohydrolase (PARG) pseudogene ENST00000429323.1 ribosomal protein L35a (RPL35A) pseudogene ENST00000444438.1 novel transcript ENST00000429104.1 novel transcript ENST00000412531.2 novel protein similar to ARF GTPase-activating protein (MRIP2) ENST00000456967.1 novel transcript (LOC256277, FLJ31813) ENST00000457608.1 solute carrier family 9 member 3 (SLC9A3) pseudogene ENST00000417804.1 pseudogene similar to part of KIAA0592/FLJ10824 ENST00000434114.1 novel protein (FLJ10824) ENST00000492914.1 novel transcript ENST00000476514.1 novel transcript ENST00000454806.1 novel protein ENST00000426317.1 solute carrier family 9 (sodium/hydrogen exchanger), isoform 5 (SLC9A5) pseudogene ENST00000435916.1 dynein, cytoplasmic, intermediate polypeptide 2 (DNCI2) pseudogene ENST00000361781.2 MOB protein ENST00000492601.1 putative novel transcript ENST00000498514.1 novel transcript ENST00000437213.1 putative novel transcript ENST00000431906.1 putative novel transcript ENST00000443374.1 putative novel transcript (FLJ12320) ENST00000437111.1 novel pseudogene (FLJ10539) ENST00000449695.1 putative novel transcript ENST00000421591.1 novel pseudogene (KIAA1553) ENST00000442076.1 novel pseudogene ENST00000424971.1 novel pseudogene ENST00000455321.1 protein geranylgeranyltransferase type I, beta subunit (PGGT1B) pseudogene ENST00000374007.1 novel protein similar to N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2 (ASAH2) ENST00000374006.1 novel protein similar to N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2 (ASAH2) ENST00000483649.1 novel transcript ENST00000374001.1 apobec-1 complementation factor (ACF) (ASP) ENST00000373993.1 apobec-1 complementation factor (ACF) (ASP) ENST00000373997.3 apobec-1 complementation factor (ACF) (ASP) ENST00000373995.3 apobec-1 complementation factor (ACF) (ASP) ENST00000493415.1 apobec-1 complementation factor (ACF) (ASP) ENST00000473480.1 apobec-1 complementation factor (ACF) (ASP) ENST00000414883.1 apobec-1 complementation factor (ACF) (ASP) ENST00000438919.1 novel transcript ENST00000417131.1 novel pseudogene ENST00000373985.1 protein kinase, cGMP-dependent, type I ENST00000373980.4 protein kinase, cGMP-dependent, type I ENST00000373976.3 protein kinase, cGMP-dependent, type I ENST00000373975.1 protein kinase, cGMP-dependent, type I ENST00000343087.4 putative novel transcript ENST00000435271.1 novel transcript ENST00000419889.1 putative novel transcript ENST00000412878.1 Ras suppressor protein 1 (RSU1) pseudogene ENST00000452247.1 novel transcript ENST00000426785.1 novel transcript ENST00000420193.1 novel transcript ENST00000373970.3 dickkopf homolog 1 (Xenopus laevis) ENST00000467359.1 dickkopf homolog 1 (Xenopus laevis) ENST00000494277.1 dickkopf homolog 1 (Xenopus laevis) ENST00000476752.1 dickkopf homolog 1 (Xenopus laevis) ENST00000447680.1 ribosomal protein L31 (RPL31) pseudogene ENST00000456373.1 protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) (PRKRIR) pseudogene ENST00000422763.1 novel transcript ENST00000435813.1 novel transcript ENST00000443523.1 novel transcript ENST00000448017.1 novel transcript ENST00000373968.3 mannose-binding lectin (protein C) 2, soluble (opsonic defect) ENST00000493043.1 mannose-binding lectin (protein C) 2, soluble (opsonic defect) ENST00000444155.1 novel transcript ENST00000442866.1 small nuclear ribonucleoprotein polypeptide E (SNRPE) pseudogene ENST00000449272.1 putative novel transcript ENST00000373955.1 protocadherin 15 (USH1F) ENST00000450301.2 glyceraldehyde-3-phosphate dehydrogenase (GAPD) pseudogene ENST00000373944.3 ZW10 interactor ENST00000494312.1 ZW10 interactor ENST00000318387.2 ZW10 interactor ENST00000460654.1 ZW10 interactor ENST00000373940.1 ZW10 interactor ENST00000361148.6 ZW10 interactor ENST00000478181.1 ZW10 interactor ENST00000489649.1 ZW10 interactor ENST00000467523.1 ZW10 interactor ENST00000434711.1 pseudogene similar to part of tubulin, beta, 2 (TUBB2) ENST00000435086.1 novel pseudogene (KIAA0733) ENST00000418296.1 dual specificity phosphatase 18 (DUSP18) pseudogene ENST00000373935.3 inositol polyphosphate multikinase (IMPK) ENST00000312966.6 tumor protein, translationally-controlled 1 (TPT1) pseudogene ENST00000488388.1 uncharacterized hematopoietic stem/progenitor cells protein MDS029 ENST00000333926.5 uncharacterized hematopoietic stem/progenitor cells protein MDS029 ENST00000464703.1 uncharacterized hematopoietic stem/progenitor cells protein MDS029 ENST00000489785.1 uncharacterized hematopoietic stem/progenitor cells protein MDS029 ENST00000440189.1 putative novel transcript ENST00000373910.3 ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) ENST00000473824.1 ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast) ENST00000487519.1 transcription factor 6-like 1 (mitochondrial transcription factor 1-like) ENST00000373899.3 transcription factor 6-like 1 (mitochondrial transcription factor 1-like) ENST00000373895.3 transcription factor 6-like 1 (mitochondrial transcription factor 1-like) ENST00000395377.2 transcription factor 6-like 1 (mitochondrial transcription factor 1-like) ENST00000373886.3 bicaudal C homolog 1 (Drosophila) ENST00000263103.1 bicaudal C homolog 1 (Drosophila) ENST00000332869.5 novel pseudogene (FLJ37659) ENST00000432535.1 putative novel transcript ENST00000429404.1 TNF receptor-associated factor 6 (TRAF6) pseudogene ENST00000373878.3 novel protein (DKFZp761N042) ENST00000472199.1 putative novel transcript ENST00000373868.2 NP_937858.2 ENST00000442566.3 not organism-supported ENST00000277705.6 not organism-supported ENST00000468840.2 NP_001137245.1 ENST00000489341.1 family with sequence similarity 13, member C1 ENST00000512919.1 alternative 5' UTR ENST00000503444.1 alternative 5' UTR ENST00000433249.1 putative novel transcript ENST00000446432.1 mitochondrial ribosomal protein L50 (FLJ20493) (MRPL50) pseudogene ENST00000450677.1 novel transcript ENST00000395348.3 alternative 5' UTR ENST00000395347.1 alternative 5' UTR ENST00000430431.1 novel transcript ENST00000414264.1 novel transcript ENST00000263102.6 CCDS7257.1 ENST00000521074.1 alternative 5' UTR ENST00000444900.1 novel protein (LOC283025) ENST00000373820.1 ankyrin 3, node of Ranvier (ankyrin G) ENST00000502769.1 ankyrin 3, node of Ranvier (ankyrin G) ENST00000355288.2 NP_001140.2 ENST00000489505.2 ankyrin 3, node of Ranvier (ankyrin G) ENST00000480699.1 ankyrin 3, node of Ranvier (ankyrin G) ENST00000469721.2 ankyrin 3, node of Ranvier (ankyrin G) ENST00000459732.1 ankyrin 3, node of Ranvier (ankyrin G) ENST00000395302.3 ankyrin 3, node of Ranvier (ankyrin G) ENST00000395302.3 3 ENST00000465749.1 ankyrin 3, node of Ranvier (ankyrin G) ENST00000467420.2 ankyrin 3, node of Ranvier (ankyrin G) ENST00000373815.1 ankyrin 3, node of Ranvier (ankyrin G) ENST00000486349.1 ankyrin 3, node of Ranvier (ankyrin G) ENST00000460468.1 ankyrin 3, node of Ranvier (ankyrin G) ENST00000474360.1 ankyrin 3, node of Ranvier (ankyrin G) ENST00000414383.1 putative novel transcript ENST00000503220.1 probable pseudogene ENST00000503220.1 novel protein similar to ADP-ribosylation factor-like 4 (ARL4) ENST00000519078.1 alternative 5' UTR ENST00000395284.3 cell division cycle 2 protein ENST00000448257.2 alternative 5' UTR ENST00000373809.2 NP_203698.1 ENST00000357917.4 rho-related BTB domain containing 1 ENST00000337910.5 rho-related BTB domain containing 1 ENST00000496237.1 rho-related BTB domain containing 1 ENST00000461910.1 rho-related BTB domain containing 1 ENST00000490827.1 rho-related BTB domain containing 1 ENST00000483488.1 rho-related BTB domain containing 1 ENST00000441142.1 putative novel transcript ENST00000417931.1 putatiev novel transcript ENST00000277749.5 novel protein ENST00000389640.3 putative novel transcript ENST00000389639.3 novel protein ENST00000441001.1 novel transcript ENST00000279873.7 modulator recognition factor 2 (MRF2) ENST00000309334.5 modulator recognition factor 2 (MRF2) ENST00000315289.2 novel protein (FLJ39352) ENST00000395260.3 rhotekin 2 (RTKN2) ENST00000442753.1 putative novel transcript ENST00000395254.3 novel protein (KIAA0844) ENST00000421210.1 alternative 5' UTR ENST00000395251.1 NP_955524.2 ENST00000412255.1 pseudogene similar to part of aldehyde dehydrogenase 7 family, member A1 (ALDH7A1) ENST00000425290.1 novel transcript ENST00000242480.3 early growth response 2 (Krox-20 homolog, Drosophila) ENST00000493899.1 early growth response 2 (Krox-20 homolog, Drosophila) ENST00000433019.1 novel transcript ENST00000277746.6 nuclear receptor binding factor 2 ENST00000467356.1 thyroid hormone receptor interactor 8 ENST00000467356.1 this variant and one or more of variant fragments .1.4 through .1.6 could be part of a single variant ENST00000327520.7 thyroid hormone receptor interactor 8, variant 2 (FLJ21338) ENST00000497922.1 this variant and variant fragment .1.3 could be part of a single variant ENST00000497922.1 thyroid hormone receptor interactor 8 ENST00000490669.1 this variant and variant fragment .1.3 could be part of a single variant ENST00000490669.1 thyroid hormone receptor interactor 8 ENST00000483298.1 this variant and variant fragment .1.3 could be part of a single variant ENST00000483298.1 thyroid hormone receptor interactor 8 ENST00000489372.1 novel transcript ENST00000414123.1 CDA11 protein (CDA11) pseudogene ENST00000428581.1 putative novel transcript ENST00000417210.1 putative novel transcript ENST00000450055.1 px19-like protein (PX19) pseudogene ENST00000430304.1 pseudogene similar to part of heat shock 10kDa protein 1 (chaperonin 10) (HSPE1) ENST00000298249.3 novel protein (LOC221035) ENST00000448009.1 mitochondrial ribosomal protein L35 (MRPL35) pseudogene ENST00000444770.1 novel transcript ENST00000452821.1 ribosomal protein L7a (RPL7A) pseudogene ENST00000451946.1 putative novel transcript ENST00000412976.1 activator of S phase kinase (DBF4) (ASK) pseudogene ENST00000432217.1 ribosomal protein L17 (RPL17) pseudogene ENST00000404883.2 annexin A2 pseudogene 3 ENST00000425902.1 putative novel transcript ENST00000436904.1 pseudogene similar to part of myosin light chain 1 slow a (MLC1SA) ENST00000441175.1 pseudogene similar to part of itchy homolog E3 ubiquitin protein ligase (mouse) (ITCH) ENST00000428346.1 putative novel transcript ENST00000433152.1 putative novel transcript ENST00000433211.1 alpha-catenin-like protein (MGC26194) (VR22) ENST00000373735.1 alpha-catenin-like protein (MGC26194) (VR22) ENST00000494580.1 bA65E10.1.2 in Em:AL607023 ENST00000494580.1 novel transcript ENST00000472963.1 alpha-catenin-like protein (MGC26194) (VR22) ENST00000472963.1 non-canonical donor and acceptor splice sites between final two exons. ENST00000330298.5 alpha-catenin-like protein (MGC26194) (VR22) ENST00000361320.3 novel protein ENST00000373722.1 novel protein ENST00000485868.1 novel transcript ENST00000472278.1 novel transcript ENST00000422963.1 putative novel transcript ENST00000422016.1 ribosomal protein L7a (RPL7A) pseudogene ENST00000425765.1 aldo-keto reductase family 1, member B10 (aldose reductase) (AKR1B10) pseudogene ENST00000454107.1 ribosomal protein L21 (RPL21) pseudogene ENST00000225171.2 J domain containing protein 1 (JDP1) ENST00000483798.1 novel transcript ENST00000480963.1 novel transcript ENST00000339758.6 J domain containing protein 1 (JDP1) ENST00000480180.1 novel transcript ENST00000455312.1 novel pseudogene ENST00000482081.1 ribosomal protein L12 (RPL12) pseudogene ENST00000406900.1 alternative 5' UTR ENST00000480158.1 this variant and one or more of variant fragments .1.4 and .1.7 could be part of a single variant ENST00000480158.1 novel transcript ENST00000463478.1 this variant and one or more of variant fragments .1.3 and .1.4 could be part of a single variant ENST00000463478.1 novel transcript ENST00000492996.1 novel transcript, variant 6 (FLJ23155) ENST00000506515.1 alternative 5' UTR ENST00000515753.1 alternative 5' UTR ENST00000435889.1 ribosomal protein S3A (RPS3A) pseudogene ENST00000354393.2 sarcomeric protein myopalladin, 145 kDa (MYOP) ENST00000358913.5 ccontinued from Em:AC024258.2.1 in Em:AC024258; continues as Em:AC016395.1.1 in Em:AC016395 ENST00000358913.5 sarcomeric protein myopalladin, 145 kDa (MYOP) ENST00000373675.3 sarcomeric protein myopalladin, 145 kDa (MYOP), variant 3 (FLJ14437) ENST00000444086.1 novel transcript ENST00000429634.1 novel transcript ENST00000443208.1 pseudogene similar to part of the keratin family of proteins ENST00000336578.1 MAWD binding protein (MAWBP) ENST00000309049.4 MAWD binding protein (MAWBP), variant 1 (FLJ14767) ENST00000468798.1 novel transcript ENST00000473901.1 novel transcript ENST00000495025.1 novel transcript ENST00000277795.4 MAWD binding protein (MAWBP), variant 3 (FLJ35507) ENST00000478192.1 novel transcript ENST00000469172.1 heterogeneous nuclear ribonucleoprotein H3 (2H9), variant 2 (FLJ34092) ENST00000461310.1 this variant and variant .6.11 could be part of a single variant ENST00000461310.1 novel transcript ENST00000480987.1 novel transcript ENST00000486854.1 this variant and variant .6.11 could be part of a single variant ENST00000486854.1 novel transcript ENST00000467249.1 this variant and one or more of variants .6.6 and .6.11 could be part of a single variant ENST00000467249.1 novel transcript ENST00000354695.5 heterogeneous nuclear ribonucleoprotein H3 (2H9) ENST00000481819.1 heterogeneous nuclear ribonucleoprotein H3 (2H9), variant 4 (DKFZp586F0222) ENST00000491200.1 heterogeneous nuclear ribonucleoprotein H3 (2H9) ENST00000490442.1 heterogeneous nuclear ribonucleoprotein H3 (2H9) ENST00000478698.1 heterogeneous nuclear ribonucleoprotein H3 (2H9) ENST00000478698.1 this variant and variant .6.10 could be part of a single variant ENST00000466249.1 novel transcript ENST00000265865.3 FLJ36895 ENST00000342616.4 FLJ10063 ENST00000415623.1 ribosomal protein L26 (RPL26) pseudogene ENST00000439904.1 novel transcript ENST00000265870.2 solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 ENST00000493963.1 solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 ENST00000474927.1 this variant and variant fragment .1.4 could be part of a single variant ENST00000474927.1 solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 ENST00000491102.1 this variant and variant fragment .1.3 could be part of a single variant ENST00000491102.1 solute carrier family 25 (mitochondrial carrier; Graves disease autoantigen), member 16 ENST00000414397.1 ribosomal protein L26 (RPL26) pseudogene ENST00000422205.1 novel pseudogene ENST00000373644.4 leukemia-associated protein with a CXXC domain (LCX) ENST00000419176.1 ribosomal protein S3A (RPS3A) pseudogene ENST00000416028.1 putative novel transcript ENST00000536391.1 alternative 5' UTR ENST00000538031.1 alternative 5' UTR ENST00000543719.1 confirm experimentally ENST00000539539.1 alternative 5' UTR ENST00000540807.1 not organism-supported ENST00000543706.1 not organism-supported ENST00000399169.4 C10orf24 ENST00000298596.6 C10orf24 ENST00000399165.4 C10orf24 ENST00000399162.2 C10orf24 ENST00000373585.3 nucleolar protein GU2 (GU2)(GUB, MGC3199, RH-II/GuB) ENST00000483593.1 novel transcript ENST00000471475.1 novel transcript ENST00000494889.1 novel transcript ENST00000475535.1 novel transcript ENST00000466265.1 novel transcript ENST00000354185.4 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 21 ENST00000361983.4 novel protein (DKFZP586B0923)(KIAA1279) ENST00000481912.1 novel transcript ENST00000399158.2 endothelial-derived gene 1 (EG1)(EG-1, DKFZP434N185) pseudogene ENST00000411655.1 actin, beta (ACTB) pseudogene ENST00000462445.1 putative novel transcript ENST00000242465.3 proteoglycan 1, secretory granule (PPG, PRG, SERGLYCIN) ENST00000373382.1 vacuolar protein sorting 26 (yeast) (HB58, Hbeta58, FLJ12930) ENST00000477667.1 vacuolar protein sorting 26 (yeast) (HB58, Hbeta58, FLJ12930) ENST00000489656.1 vacuolar protein sorting 26 (yeast) (HB58, Hbeta58, FLJ12930) ENST00000497564.1 vacuolar protein sorting 26 (yeast) (HB58, Hbeta58, FLJ12930) ENST00000490696.1 vacuolar protein sorting 26 (yeast) (HB58, Hbeta58, FLJ12930) ENST00000467852.1 vacuolar protein sorting 26 (yeast) (HB58, Hbeta58, FLJ12930) ENST00000489794.1 vacuolar protein sorting 26 (yeast) (HB58, Hbeta58, FLJ12930) ENST00000497022.1 vacuolar protein sorting 26 (yeast) (HB58, Hbeta58, FLJ12930) ENST00000438591.1 ribosomal protein S12 (RPS12) pseudogene ENST00000359655.4 suppressor of var1, 3-like 1 (S. cerevisiae)(SUV3) ENST00000471069.1 suppressor of var1, 3-like 1 (S. cerevisiae)(SUV3) ENST00000483572.1 suppressor of var1, 3-like 1 (S. cerevisiae)(SUV3) ENST00000422378.1 suppressor of var1, 3-like 1 (S. cerevisiae)(SUV3) ENST00000478227.1 suppressor of var1, 3-like 1 (S. cerevisiae)(SUV3) ENST00000486661.1 suppressor of var1, 3-like 1 (S. cerevisiae)(SUV3) ENST00000497254.1 suppressor of var1, 3-like 1 (S. cerevisiae)(SUV3) ENST00000450995.1 novel transcript ENST00000354624.5 novel hexokinase domain containing protein (FLJ37767) ENST00000486754.1 novel transcript ENST00000488706.1 putative novel transcript ENST00000470920.1 putative novel transcript ENST00000413220.1 putative novel transcript ENST00000450646.1 hexokinase 1 (HKI, HXK1) ENST00000464803.1 hexokinase 1 (HKI, HXK1) ENST00000480047.1 hexokinase 1 (HKI, HXK1) ENST00000483077.1 hexokinase 1 (HKI, HXK1) ENST00000479594.1 hexokinase 1 (HKI, HXK1) ENST00000476368.1 hexokinase 1 (HKI, HXK1) ENST00000483054.1 hexokinase 1 (HKI, HXK1) ENST00000488644.1 hexokinase 1 (HKI, HXK1) ENST00000421088.1 hexokinase 1 (HKI, HXK1) ENST00000359426.6 hexokinase 1 (HKI, HXK1) ENST00000493591.1 hexokinase 1 (HKI, HXK1) ENST00000494253.1 hexokinase 1 (HKI, HXK1) ENST00000467704.1 hexokinase 1 (HKI, HXK1) ENST00000467710.1 hexokinase 1 (HKI, HXK1) ENST00000470050.1 hexokinase 1 (HKI, HXK1) ENST00000435088.1 ribosomal protein S15a (RPS15A) pseudogene ENST00000373307.1 tachykinin receptor 2 (SKR,NK2R,NKNAR,TAC2R), varinat 2 ENST00000373306.4 tachykinin receptor 2 (SKR,NK2R,NKNAR,TAC2R), varinat 1 ENST00000444398.1 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 (ATP5G) pseudogene ENST00000373290.2 transmembrane 4 superfamily member tetraspan NET-7 (NET-7) ENST00000430550.1 novel pseudogene ENST00000242462.4 neurogenin 3 (ngn3, Atoh5, Math4B) ENST00000428753.1 putative novel transcript ENST00000440153.1 ATP synthase 6 (MTATP6)(ATP6) pseudogene ENST00000425216.1 cytochrome c oxidase II (MTCO2)(COII) pseudogene ENST00000415223.1 cytochrome c oxidase I (MTCO1)(COI) pseudogene ENST00000418575.1 NADH dehydrogenase 2 (MTND2) pseudogene ENST00000430341.1 NADH dehydrogenase 1 (MTND1) pseudogene ENST00000491890.1 novel protein (LOC219738) ENST00000373279.4 novel protein (LOC219738) ENST00000421716.1 novel protein (LOC219738) ENST00000434931.1 novel transcript ENST00000416265.1 novel transcript ENST00000438138.1 ribosomal protein L5 (RPL5) pseudogene ENST00000398978.3 NP_005194 ENST00000456019.1 collagen, type XIII, alpha 1 ENST00000427247.1 putative novel transcript ENST00000373255.3 H2A histone family, member Y2 ENST00000455786.1 H2A histone family, member Y2 ENST00000479444.1 H2A histone family, member Y2 ENST00000373248.1 apoptosis-inducing factor (AIF)-homologous mitochondrion-associated inducer of death (AMID) ENST00000307864.1 apoptosis-inducing factor (AIF)-homologous mitochondrion-associated inducer of death (AMID) ENST00000482166.1 apoptosis-inducing factor (AIF)-homologous mitochondrion-associated inducer of death (AMID) ENST00000287078.6 novel protein (MGC34695) ENST00000335494.5 novel protein (MGC34695) ENST00000494143.1 novel transcript ENST00000479086.1 novel transcript ENST00000373241.4 SAR1a gene homolog 1 (S. cerevisiae) ENST00000373239.1 SAR1a gene homolog 1 (S. cerevisiae) ENST00000373239.1 alternatively spliced 5' UTR, shares CDS with bA367H5.4.1 ENST00000373239.1 alternative 5' UTR ENST00000373238.1 SAR1a gene homolog 1 (S. cerevisiae) ENST00000373238.1 alternatively spliced 5' UTR, shares CDS with bA367H5.4.1 ENST00000373238.1 alternative 5' UTR ENST00000373242.1 SAR1a gene homolog 1 (S. cerevisiae) ENST00000452767.1 SAR1a gene homolog 1 (S. cerevisiae) ENST00000373236.1 SAR1a gene homolog 1 (S. cerevisiae) ENST00000477464.1 SAR1a gene homolog 1 (S. cerevisiae) ENST00000428512.1 calbindin 2, 29kDa (calretinin) pseudogene ENST00000435591.1 ribosomal protein S25 (RPS25) pseudogene ENST00000373232.2 pyrophosphatase (inorganic) ENST00000373230.4 pyrophosphatase (inorganic) ENST00000460755.1 pyrophosphatase (inorganic) ENST00000495346.1 pyrophosphatase (inorganic) ENST00000434829.1 putative novel transcript ENST00000373224.1 novel protein (FLJ10751) ENST00000373224.1 alternative 5' UTR ENST00000355790.4 novel protein (FLJ10751) ENST00000358141.2 novel protein (FLJ10751) ENST00000446961.1 novel protein (FLJ10751) ENST00000430943.1 novel pseudogene ENST00000373218.4 eukaryotic translation initiation factor 4E binding protein 2 ENST00000287139.3 nodal homolog (mouse) ENST00000414871.1 nodal homolog (mouse) ENST00000373214.4 novel protein (KIAA1274) ENST00000426268.1 novel protein (KIAA1274) ENST00000427625.1 YY1 transcription factor pseudogene ENST00000432960.1 putative novel transcript ENST00000373209.1 perforin 1 (pore forming protein) ENST00000473106.1 perforin 1 (pore forming protein) ENST00000373208.1 a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14 ENST00000373207.1 a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14 ENST00000299290.1 novel protein (FLJ32820) ENST00000394982.2 novel protein (FLJ32820) ENST00000435209.1 ribosomal protein S26 (RPS26) pseudogene ENST00000486993.1 sphingosine-1-phosphate lyase 1 ENST00000373202.3 sphingosine-1-phosphate lyase 1 ENST00000299297.4 sphingosine-1-phosphate lyase 1 ENST00000409118.2 sphingosine-1-phosphate lyase 1 ENST00000454400.1 putative novel transcript ENST00000448452.1 putative novel transcript ENST00000493961.1 6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) ENST00000299299.3 6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) ENST00000493228.1 6-pyruvoyl-tetrahydropterin synthase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) ENST00000415746.1 putative novel transcript ENST00000335350.6 transmembrane receptor Unc5H2 (UNC5H2) ENST00000373192.4 transmembrane receptor Unc5H2 (UNC5H2) ENST00000447119.1 putative novel transcript ENST00000449737.1 putative novel transcript ENST00000373189.5 equilibrative nucleoside transporter 3 (ENT3) ENST00000479577.1 novel transcript ENST00000469204.1 equilibrative nucleoside transporter 3 (ENT3) ENST00000461841.2 cadherin related 23 ENST00000461841.2 continued from Em:AC012469.1.2 in Em:AC012469 ENST00000299366.6 cadherin related 23 ENST00000299366.6 contiunes as Em:AC012469.1.3 in Em:AC012469 ENST00000224721.5 cadherin related 23 ENST00000224721.5 contiunes as Em:AC012469.1.1 in Em:AC012469 ENST00000466757.2 cadherin related 23 ENST00000470494.1 cadherin related 23 ENST00000442677.1 cadherin related 23 ENST00000493280.1 cadherin related 23 ENST00000428918.1 novel transcript ENST00000398786.2 novel protein (FLJ00245) ENST00000394957.3 novel protein (FLJ00041 PP2135) ENST00000470317.1 novel transcript ENST00000481568.1 novel transcript ENST00000394936.3 prosaposin (variant Gaucher disease and variant metachromatic leukodystrophy) (GLBA, SAP1) ENST00000373120.1 non-canonical acceptor splice site at final exon ENST00000373120.1 prosaposin (variant Gaucher disease and variant metachromatic leukodystrophy) (GLBA, SAP1) ENST00000493143.1 surfactant, pulmonary-associated protein A1 (PSAP,PSPA,SP-A,SFTP1,SP-A1,COLEC4) ENST00000441348.1 putative novel transcript ENST00000373115.4 carbohydrate (chondroitin 6) sulfotransferase 3 ENST00000373109.1 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 (KIAA0275) ENST00000463279.1 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 ENST00000469121.1 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 ENST00000460053.1 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 ENST00000495888.1 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 ENST00000483699.1 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2 (KIAA0275) ENST00000342444.4 novel protein (FLJ36851) (CGI-18) ENST00000373101.2 non-canonical acceptor splice site between exons 1 and 2 ENST00000373101.2 alternative 5' UTR ENST00000317126.4 alternative 5' UTR ENST00000461369.2 novel transcript ENST00000527593.1 alternative 5' UTR ENST00000524829.1 alternative 5' UTR ENST00000526751.1 alternative 5' UTR ENST00000492502.2 novel transcript ENST00000533958.1 alternative 5' UTR ENST00000416278.1 ribosomal protein L15 (RPL15) pseudogene ENST00000478193.1 novel transcript ENST00000299381.3 novel protein ENST00000470481.1 novel transcript ENST00000468144.1 novel transcript ENST00000496924.1 novel transcript ENST00000307365.3 HIF-1 responsive protein (RTP801,REDD1,FLJ20500) ENST00000473155.1 novel transcript ENST00000471240.1 novel transcript ENST00000491934.1 putative novel transcript ENST00000444643.2 NP_060096.3 ENST00000361114.5 calcium binding atopy-related autoantigen 1 ENST00000476605.1 calcium binding atopy-related autoantigen 1 ENST00000489666.1 calcium binding atopy-related autoantigen 1 ENST00000431638.1 putative novel transcript ENST00000425543.1 cytochrome c oxidase subunit VIIc (COX7C) pseudogene ENST00000437647.1 HMG17 pseudogene ENST00000433335.1 novel pseudogene (FLJ12684) ENST00000373053.3 novel protein ENST00000357157.6 novel protein (LOC90550) ENST00000483185.1 putative novel transcript ENST00000443299.1 putative novel transcript ENST00000334011.5 oncoprotein induced transcript 3 (FLJ39116) ENST00000428039.1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1) pseudogene ENST00000373032.3 phospholipase A2, group XIII ENST00000396131.2 ribosomal protein L17 (RPL17) pseudogene ENST00000307116.2 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I ENST00000373008.1 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I ENST00000464310.1 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I ENST00000480231.1 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I ENST00000442202.1 novel pseudogene ENST00000431293.1 putative novel transcript ENST00000488223.1 nudix (nucleoside diphosphate linked moiety X)-type motif 13 ENST00000357321.4 nudix (nucleoside diphosphate linked moiety X)-type motif 13 ENST00000469925.1 nudix (nucleoside diphosphate linked moiety X)-type motif 13 ENST00000372997.3 nudix (nucleoside diphosphate linked moiety X)-type motif 13 ENST00000494307.1 putative novel transcript ENST00000372979.4 suppressor of S. cerevisiae gcr2 (HSGT1) ENST00000484976.1 suppressor of S. cerevisiae gcr2 (HSGT1) ENST00000453402.1 suppressor of S. cerevisiae gcr2 (HSGT1) ENST00000413026.1 suppressor of S. cerevisiae gcr2 (HSGT1) ENST00000242505.6 novel protein (KIAA0974) ENST00000372955.3 novel protein ENST00000445951.1 novel protein ENST00000475829.1 novel transcript ENST00000470798.1 novel transcript ENST00000466261.1 novel transcript ENST00000468462.1 novel transcript (FLJ21536) ENST00000469143.1 DnaJ (Hsp40) homolog, subfamily C, member 9 ENST00000372950.4 DnaJ (Hsp40) homolog, subfamily C, member 9 ENST00000455776.1 eukaryotic translation initiation factor 4A, isoform 2 (EIF4A2) pseudogene ENST00000453189.1 novel transcript ENST00000372945.3 mitochondrial ribosomal protein S16 ENST00000479005.1 mitochondrial ribosomal protein S16 ENST00000372940.3 mitochondrial ribosomal protein S16 ENST00000471251.1 mitochondrial ribosomal protein S16 ENST00000473427.1 mitochondrial ribosomal protein S16 ENST00000512551.1 novel transcript ENST00000457147.1 putative novel transcript ENST00000457758.1 putative novel transcript ENST00000394864.2 putative novel transcript ENST00000355577.2 tetratricopeptide repeat-containing protein (LOC118491) ENST00000340329.3 tetratricopeptide repeat-containing protein (LOC118491) ENST00000493787.1 tetratricopeptide repeat-containing protein (LOC118491) ENST00000372928.1 tetratricopeptide repeat-containing protein (LOC118491) ENST00000478007.1 tetratricopeptide repeat-containing protein (LOC118491) ENST00000433268.1 tetratricopeptide repeat-containing protein (LOC118491) (FLJ25765) ENST00000462684.1 tetratricopeptide repeat-containing protein (LOC118491) (isoform A) ENST00000495161.1 tetratricopeptide repeat-containing protein (LOC118491) (isoform B) ENST00000413597.1 putative novel transcript ENST00000372921.4 annexin A7 ENST00000372919.4 annexin A7 ENST00000463788.1 annexin A7 ENST00000492380.1 annexin A7 ENST00000394847.3 annexin A7 ENST00000427492.1 putative novel transcript ENST00000440913.1 ribosomal protein L26 (RPL26) pseudogene ENST00000487126.1 novel protein (FLJ39565) ENST00000372912.1 novel protein ENST00000360663.5 protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform (calcineurin A beta) ENST00000430762.1 protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform (calcineurin A beta) ENST00000342558.3 protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform (calcineurin A beta) ENST00000495897.1 protein phosphatase 3 (formerly 2B), catalytic subunit, beta isoform (calcineurin A beta) ENST00000442133.1 novel transcript ENST00000422977.1 putative novel transcript ENST00000439792.1 putative novel transcript ENST00000339859.4 alternative 5' UTR ENST00000339859.4 NP_689799 ENST00000413442.1 alternative 5' UTR ENST00000433394.1 alternative 5' UTR ENST00000474929.1 alternative 5' UTR ENST00000450370.1 ribosomal protein S26 (RPS26) pseudogene ENST00000466008.1 myozenin 1 ENST00000372873.4 FLJ12921 ENST00000372872.4 FLJ12921 ENST00000443782.2 novel protein similar to ARF GTPase-activating protein (MRIP2) ENST00000399449.2 novel transcript ENST00000415917.1 novel transcript ENST00000441263.1 KIAA0187 pseudogene ENST00000508551.1 glutamate dehydrogenase pseudogene 3 ENST00000422884.1 dual specificity phosphatase 8 (DUSP8) pseudogene ENST00000465076.1 SEC24 related gene family, member C (S. cerevisiae) ENST00000345254.4 SEC24 related gene family, member C (S. cerevisiae) ENST00000339365.2 variant 2; alternatively spliced in 5' UTR ENST00000339365.2 SEC24 related gene family, member C (S. cerevisiae) ENST00000477008.1 SEC24 related gene family, member C (S. cerevisiae) ENST00000496827.1 SEC24 related gene family, member C (S. cerevisiae) ENST00000372841.3 novel protein (MGC33202) ENST00000465695.1 putative novel transcript ENST00000489264.1 putative novel transcript ENST00000462704.1 novel transcript ENST00000372837.3 novel transcript (LOC118487) ENST00000372833.5 novel protein (LOC118487) ENST00000446546.1 novel protein ENST00000451629.1 this variant and one of variant fragments 15.1 and 15.2 could be part of one single variant ENST00000451629.1 novel protein ENST00000433366.1 this variant and variant fragment .15.4 could be part of one single variant ENST00000433366.1 novel protein (KIAA0913) ENST00000492395.1 this variant and variant fragment .15.4 could be part of one single variant ENST00000492395.1 novel protein ENST00000431225.1 novel protein ENST00000412198.1 novel protein ENST00000425051.1 novel protein ENST00000489234.1 novel transcript ENST00000487278.1 novel transcript ENST00000466354.1 novel transcript ENST00000466568.1 putative novel transcript ENST00000456638.1 novel transcript ENST00000309979.6 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2 ENST00000429742.1 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2 ENST00000463410.1 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2 ENST00000465929.1 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2 ENST00000398701.2 putative novel transcript ENST00000351293.3 calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma ENST00000322635.3 calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma ENST00000433289.1 calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma ENST00000305762.7 calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma ENST00000372765.1 calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma ENST00000441192.1 calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma ENST00000472912.1 calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma ENST00000474131.1 calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma ENST00000474131.1 this variant and variant fragment .4.12 could be part of a single variant ENST00000487167.1 this variant one or more of variant fragments .4.11 and .4.12 could be part of a single variant ENST00000487167.1 calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma, variant 8 (FLJ37455) ENST00000477205.1 this variant one or more of variant fragments .4.11 and .4.12 could be part of a single variant ENST00000477205.1 calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma ENST00000492020.1 calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma ENST00000492020.1 this variant and one of variants .4.8 and .4.10 could be part of a single variant ENST00000477652.1 calcium/calmodulin-dependent protein kinase (CaM kinase) II gamma ENST00000477652.1 this variant and one or more of variants .4.8 through .4.10 could be part of a single variant ENST00000434147.1 putative novel transcript ENST00000446730.1 putative novel transcript ENST00000481390.1 plasminogen activator, urokinase ENST00000496926.1 this variant and variant fragment .2.6 could be part of a single variant ENST00000496926.1 plasminogen activator, urokinase ENST00000494287.1 plasminogen activator, urokinase ENST00000496777.1 alternatively spliced 3' UTR, shares CDS with bA417O11.2.1 ENST00000496777.1 alternative 3' UTR ENST00000496777.1 plasminogen activator, urokinase ENST00000372764.3 plasminogen activator, urokinase ENST00000372761.1 plasminogen activator, urokinase ENST00000474995.1 this variant and variant fragment .2.5 could be part of a single variant ENST00000474995.1 plasminogen activator, urokinase ENST00000409178.1 novel protein (FLJ35198) ENST00000372755.3 vinculin ENST00000478896.1 vinculin ENST00000461383.1 vinculin ENST00000436396.1 vinculin ENST00000472585.1 vinculin ENST00000416076.1 putative novel transcript ENST00000426210.1 putative novel transcript ENST00000452836.1 putative novel transcript ENST00000355264.4 adaptor-related protein complex 3, mu 1 subunit ENST00000372745.1 alternatively spliced 5' UTR shares CDS with bA178G16.3.1 ENST00000372745.1 adaptor-related protein complex 3, mu 1 subunit ENST00000372745.1 alternative 5' UTR ENST00000480373.1 adaptor-related protein complex 3, mu 1 subunit ENST00000487653.1 adaptor-related protein complex 3, mu 1 subunit ENST00000286621.2 adenosine kinase ENST00000478611.1 adenosine kinase ENST00000372734.3 adenosine kinase ENST00000467840.1 adenosine kinase ENST00000395972.2 RAB5C, member RAS oncogene family (RABC5) pseudogene ENST00000430363.1 novel transcript ENST00000448214.1 contniued from Em:AC012046.2 in Em:AC012046 ENST00000448214.1 novel transcript ENST00000398689.2 polymerase (RNA) III (DNA directed) polypeptide D, 44kDa (POLR3D) pseudogene ENST00000454758.1 novel pseudogene ENST00000372725.1 monocytic leukemia zinc finger protein-related factor (MORF) ENST00000372725.1 alternatively spliced 5' UTR, shares CDS with Em:AC063962.1.1 ENST00000372725.1 alternatively spliced 5' UTR, shares CDS with Em:AC018511.1.1 ENST00000372725.1 alternative 5' UTR ENST00000372724.1 monocytic leukemia zinc finger protein-related factor (MORF) ENST00000287239.4 monocytic leukemia zinc finger protein-related factor (MORF) ENST00000372714.1 monocytic leukemia zinc finger protein-related factor (MORF) ENST00000372714.1 alternatively spliced 5' UTR, shares CDS with Em:AC063962.1.1 ENST00000372714.1 alternatively spliced 5' UTR, shares CDS with Em:AC018511.1.1 ENST00000372714.1 alternative 5' UTR ENST00000372711.1 monocytic leukemia zinc finger protein-related factor (MORF) ENST00000490365.1 novel transcript ENST00000413431.1 putative novel transcript ENST00000436608.1 putative novel transcript ENST00000434706.1 peptidylprolyl isomerase A (cyclophilin A)(PPIA) pseudogene ENST00000308475.5 dual specificity phosphatase 13 (BEDP, TMDP, FLJ32450) ENST00000472493.1 dual specificity phosphatase 13 (BEDP, TMDP, FLJ32450) ENST00000464872.1 dual specificity phosphatase 13 (BEDP, TMDP, FLJ32450) ENST00000479884.2 alternative 5' UTR ENST00000372702.2 NMD exception ENST00000394707.2 NP_001007274.1 ENST00000478873.1 dual specificity phosphatase 13 (BEDP, TMDP, FLJ32450) ENST00000473072.1 dual specificity phosphatase 13 (BEDP, TMDP, FLJ32450) ENST00000447533.1 novel protein ENST00000372690.3 novel protein ENST00000372687.3 novel protein (FLJ25082) ENST00000372538.3 novel protein (FLJ23841) ENST00000460899.1 putative novel transcript ENST00000494596.1 novel transcript ENST00000469299.1 novel transcript ENST00000470947.1 novel transcript ENST00000490521.1 novel transcript ENST00000491270.1 putative novel transcript ENST00000449384.1 ribosomal protein L39 (RPL39) pseudogene ENST00000416398.1 novel transcript (LOC253264) ENST00000412453.2 high mobility group AT-hook 1 (HMGA1) pseudogene ENST00000445450.1 putative novel transcript ENST00000372524.4 novel protein (MGC2555) ENST00000416656.1 sperm autoantigenic protein 17 (SPA17)(SP17, SP17-1) pseudogene ENST00000466942.2 putative novel transcript ENST00000486015.1 putative novel transcript ENST00000491557.2 putative novel transcript ENST00000484411.1 putative novel transcript ENST00000427610.1 putative novel transcript ENST00000354343.2 CDA017 protein ENST00000372499.1 CDA017 protein ENST00000496424.1 novel transcript ENST00000488655.1 novel transcript ENST00000468134.1 putative novel transcript ENST00000483375.1 putative novel transcript ENST00000488759.1 novel transcript ENST00000493194.1 putative novel transcript ENST00000493690.1 putative novel transcript ENST00000445111.1 putative novel transcript ENST00000423541.1 putative novel transcript ENST00000412137.1 putative novel transcript ENST00000416294.1 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 (ATP5G1) pseudogene ENST00000468471.1 putative novel transcript ENST00000475352.1 putative novel transcript ENST00000429850.1 putative novel transcript ENST00000426234.1 novel transcript ENST00000458661.1 putative novel transcript ENST00000428936.1 putative novel transcript ENST00000430464.1 putative novel transcript ENST00000413564.1 putative novel transcript ENST00000418515.1 novel transcript ENST00000426313.1 cytochrome c oxidase subunit VIc (COX6C) pseudogene ENST00000394628.2 novel zinc finger pseudogene (KIAA1629) ENST00000439688.1 IMP (inosine monophosphate) dehydrogenase 2 (IMPDH2) pseudogene ENST00000434097.1 putative novel transcript ENST00000424842.1 discs, large (Drosophila) homolog 5 (DLG5) (P-dlg, KIAA0583) ENST00000463362.1 discs, large (Drosophila) homolog 5 (DLG5) (P-dlg, KIAA0583) ENST00000463362.1 this variant and one or more of variant fragments .1.8 and .1.9 could be part of a single variant ENST00000475613.1 discs, large (Drosophila) homolog 5 (DLG5) (P-dlg, KIAA0583) ENST00000459739.1 discs, large (Drosophila) homolog 5 (DLG5) (P-dlg, KIAA0583) ENST00000459739.1 this variant and one or more of variant fragments .1.8 and .1.9 could be part of a single variant ENST00000489547.1 this variant and one or more of variant fragments .1.6 and .1.8 through .1.9 could be part of a single variant ENST00000489547.1 discs, large (Drosophila) homolog 5 (DLG5) (P-dlg, KIAA0583) ENST00000484525.1 discs, large (Drosophila) homolog 5 (DLG5) (P-dlg, KIAA0583) ENST00000476354.1 discs, large (Drosophila) homolog 5 (DLG5) (P-dlg, KIAA0583) ENST00000468332.1 this variant and one or more of variant fragments .1.2, .1.7 and .1.9 could be part of a single variant ENST00000468332.1 discs, large (Drosophila) homolog 5 (DLG5) (P-dlg, KIAA0583), variant 6 (FLJ30610) ENST00000466198.1 this variant and one or more of variant fragments .1.2 .1.3, .1.5, .1.7 and .1.9 could be part of a single variant ENST00000466198.1 discs, large (Drosophila) homolog 5 (DLG5) (P-dlg, KIAA0583) ENST00000449852.1 putative novel transcript ENST00000446960.1 H2A histone family, member Z (H2AFZ) pseudogene ENST00000480092.1 this variant and variant fragment .1.2 could be part of a single variant ENST00000480092.1 polymerase (RNA) III (DNA directed) (155kD) (RPC155) ENST00000480092.1 novel transcript ENST00000372371.3 polymerase (RNA) III (DNA directed) (155kD) (RPC155) ENST00000472014.1 novel transcript ENST00000473588.1 novel transcript ENST00000484760.1 this variant and variant fragment .1.3 could be part of a single variant ENST00000484760.1 novel transcript ENST00000485708.1 ribosomal protein S24 ENST00000478655.1 ribosomal protein S24 ENST00000372360.3 ribosomal protein S24 ENST00000464716.1 ribosomal protein S24 ENST00000476545.1 ribosomal protein S24 ENST00000360830.4 ribosomal protein S24 ENST00000466129.1 ribosomal protein S24 ENST00000475468.1 ribosomal protein S24 ENST00000482069.1 ribosomal protein S24 ENST00000465692.1 ribosomal protein S24 ENST00000467106.1 ribosomal protein S24 ENST00000480662.1 ribosomal protein S24 ENST00000417003.1 pseudogene similar to part of guanine nucleotide binding protein (G protein), alpha inhibiting activity (GNAI2) ENST00000434974.1 putative novel transcript (LOC283048) (FLJ33712) ENST00000432742.1 putative novel transcript ENST00000423770.1 putative novel transcript ENST00000461034.1 novel transcript ENST00000476909.1 novel transcript ENST00000459633.1 novel transcript ENST00000434440.1 putative novel transcript ENST00000416341.1 putative novel transcript ENST00000455498.1 putative novel transcript ENST00000456353.1 novel transcript (contains FLJ40930) ENST00000440151.1 novel transcript ENST00000455378.1 novel transcript ENST00000428862.1 novel transcript (contains FLJ40604) ENST00000427035.1 putative novel transcript (FLJ35875) ENST00000334512.5 retinoic acid induced 17 ENST00000472035.1 retinoic acid induced 17 ENST00000478357.1 retinoic acid induced 17 ENST00000498681.1 peptidylprolyl isomerase F (cyclophilin F) ENST00000225174.3 peptidylprolyl isomerase F (cyclophilin F) ENST00000472580.1 peptidylprolyl isomerase F (cyclophilin F) ENST00000492149.1 peptidylprolyl isomerase F (cyclophilin F) ENST00000448165.1 peptidylprolyl isomerase F (cyclophilin F) ENST00000372336.3 hypothetical protein FLJ90798 ENST00000372333.3 novel protein ENST00000438554.1 putative novel transcript ENST00000442381.1 ribosomal protein S12 (RPS12) pseudogene ENST00000372325.2 surfactant, pulmonary-associated protein A2 (SP-A2, SPAII, COLEC5) ENST00000417041.1 surfactant, pulmonary-associated protein A2 (SP-A2, SPAII, COLEC5) ENST00000417041.1 alternatively spliced 5' UTR, shares CDS with bA589B3.2.1 (partial) ENST00000417041.1 alternative 5' UTR ENST00000492049.1 surfactant, pulmonary-associated protein A2 (SP-A2, SPAII, COLEC5) ENST00000484410.1 surfactant, pulmonary-associated protein A2 (SP-A2, SPAII, COLEC5) ENST00000484410.1 non-canonical splice acceptor splice site at 3rd exon ENST00000491208.1 surfactant, pulmonary-associated protein A2 (SP-A2, SPAII, COLEC5) ENST00000486566.1 surfactant, pulmonary-associated protein A2 (SP-A2, SPAII, COLEC5) ENST00000402234.2 mannose-binding lectin (protein C) 2, soluble (opsonic defect) (MBL2) pseudogene ENST00000446429.1 pseudogene similar to part of surfactant pulmonary-associated protein ENST00000419470.2 NP_001087239.2 ENST00000429958.1 alternative 5' UTR ENST00000439264.1 alternative 5' UTR ENST00000429070.1 novel transcript ENST00000421256.1 novel transcript ENST00000479920.1 novel transcript ENST00000482985.1 novel transcript ENST00000452173.1 novel pseudogene ENST00000372321.1 novel protein similar to KIAA2020 ENST00000342531.2 novel protein similar to KIAA2020 ENST00000465857.1 novel transcript ENST00000445306.1 putative novel transcript ENST00000430963.1 novel transcript ENST00000419697.1 novel transcript ENST00000484794.1 novel transcript ENST00000477192.1 novel transcript ENST00000496359.1 novel transcript ENST00000488805.1 novel transcript ENST00000483080.1 novel transcript ENST00000470445.1 novel transcript ENST00000495430.1 novel transcript ENST00000431300.2 not best-in-genome evidence ENST00000518000.1 not best-in-genome evidence ENST00000429984.2 not best-in-genome evidence ENST00000456716.1 novel pseudogene ENST00000458273.2 cathepsin L (CTSL) pseudogene ENST00000398621.3 protein geranylgeranyltransferase type I beta subunit (PGGT1B) pseudogene ENST00000453174.2 mannose-binding lectin (protein A) 1, pseudogene 1 novel transcript ENST00000480805.1 mannose-binding lectin (protein A) 1, pseudogene 1 novel transcript ENST00000421889.1 novel transcript ENST00000372292.3 surfactant, pulmonary-associated protein D ENST00000444384.1 surfactant, pulmonary-associated protein D ENST00000424200.1 novel pseudogene ENST00000456300.1 novel pseudogene ENST00000417217.1 pseudogene similar to part of homeobox proteins ENST00000455013.1 nuclear DNA binding protein (C1D) pseudogene ENST00000418167.1 nuclear DNA binding protein (C1D) pseudogene ENST00000455429.1 nuclear DNA binding protein (C1D) pseudogene ENST00000448729.1 novel transcript (LOC219347) ENST00000412298.1 novel transcript (LOC219347) (FLJ39439) ENST00000432070.1 novel transcript (LOC219347) (FLJ11611) ENST00000472622.1 novel transcript ENST00000372281.3 novel protein (FLJ13263) ENST00000372275.1 novel protein ENST00000372274.1 novel protein ENST00000372273.3 novel protein (DKFZp686M1819) ENST00000467529.1 novel transcript (DKFZp667M1512) ENST00000463029.1 novel transcript ENST00000476173.1 novel transcript ENST00000483732.1 novel transcript ENST00000463209.1 novel transcript ENST00000450179.1 novel protein ENST00000417197.1 ribosomal protein L22 (RPL22) pseudogene ENST00000372270.1 novel protein ENST00000372267.2 novel protein ENST00000372263.3 novel protein ENST00000465660.1 novel transcript ENST00000372231.3 annexin A11 (isoform a) (FLJ20560) ENST00000372231.3 annexin A11 (isoform a) ENST00000422982.2 alternatively spliced in 5' UTR, shares CDS with bA40F6.1.1 ENST00000422982.2 alternative 5' UTR ENST00000422982.2 annexin A11 (isoform b) ENST00000438331.1 alternatively spliced in 5' UTR, shares CDS with bA40F6.1.1 ENST00000438331.1 annexin A11 (isoform c) ENST00000438331.1 alternative 5' UTR ENST00000372234.1 annexin A11 (FLJ31545) ENST00000372234.1 alternatively spliced in 5' UTR, shares CDS with bA40F6.1.1 ENST00000372234.1 alternative 5' UTR ENST00000463340.1 annexin A11 ENST00000447489.1 this fragment and variant fragment bA369J21.9.5 could be part of one single variant ENST00000447489.1 annexin A11 ENST00000475974.1 annexin A11 ENST00000481805.1 annexin A11 ENST00000445524.1 annexin A11 ENST00000437799.1 annexin A11 ENST00000463657.1 annexin A11 ENST00000474545.1 annexin A11 ENST00000422847.1 putative novel transcript ENST00000432308.1 putative novel transcript ENST00000439728.1 ribosomal protein S12 (RPS12) pseudogene ENST00000423182.1 pseudogene similar to nuclear pore complex interacting proteins (NPIP) ENST00000441206.1 eukaryotic translation initiation factor 5A (EIF5A) pseudogene ENST00000485270.1 methionine adenosyltransferase I, alpha (FLJ23278) ENST00000372213.3 methionine adenosyltransferase I, alpha ENST00000480845.1 methionine adenosyltransferase I, alpha ENST00000455001.1 methionine adenosyltransferase I, alpha ENST00000449011.1 novel zinc finger protein pseudogene ENST00000416657.1 putative novel transcript ENST00000372204.3 novel protein (LOC143241) ENST00000372202.1 novel protein (LOC143241) ENST00000372202.1 alternatively spliced in 5' UTR, shares CDS with bA36D19.5.1 ENST00000372202.1 alternative 5' UTR ENST00000454362.1 novel protein (LOC143241) ENST00000454362.1 alternatively spliced in 5' UTR, shares partial CDS with bA36D19.5.1 ENST00000454362.1 alternative 5' UTR ENST00000453477.1 novel protein (LOC143241) ENST00000453477.1 alternatively spliced in 5' UTR, shares partial CDS with bA36D19.5.1 ENST00000453477.1 alternative 5' UTR ENST00000372199.1 novel protein ENST00000372198.1 novel protein ENST00000372197.1 novel protein (MGC16186) ENST00000372197.1 alternatively spliced in 5' UTR, shares CDS with bA36D19.6.1 ENST00000372197.1 alternative 5' UTR ENST00000411538.1 novel protein ENST00000411538.1 alternatively spliced in 5' UTR, shares partial CDS with bA36D19.6.1 ENST00000411538.1 alternative 5' UTR ENST00000256039.2 novel protein (FLJ36059) ENST00000256039.2 alternatively spliced in 5' UTR, shares CDS with bA36D19.6.1 ENST00000256039.2 alternative 5' UTR ENST00000372188.1 5' UTR ENST00000372188.1 alternatively spliced in 5' UTR, shares CDS with Em:AC021028.1.1 ENST00000372188.1 novel protein (MGC4248) ENST00000372188.1 alternative 5' UTR ENST00000372187.5 novel protein (MGC4248) (FLJ90162) ENST00000372187.5 5' UTR ENST00000372185.1 5' UTR ENST00000372185.1 novel protein ENST00000372181.1 alternatively spliced in 5' UTR, shares CDS with Em:AC021028.1.1 ENST00000372181.1 novel protein (MGC4248) ENST00000372181.1 alternative 5' UTR ENST00000429989.2 tetraspanin similar to TM4SF9 (DC-TM4F2) (DKFZp564B1037) ENST00000481124.1 novel tetraspanin family domain-containing protein ENST00000372160.4 novel protein (FLJ90077) ENST00000372157.2 novel tetraspanin family domain-containing protein ENST00000469149.1 novel transcript ENST00000372164.3 novel tetraspanin family domain-containing protein ENST00000372158.1 novel tetraspanin family domain-containing protein ENST00000341863.6 novel tetraspanin family domain-containing protein ENST00000372156.1 novel tetraspanin family domain-containing protein ENST00000265450.5 novel transcript (FLJ30768) ENST00000417559.1 putative novel transcript ENST00000372147.1 novel protein ENST00000470604.1 novel SH2 domain-containing protein ENST00000372150.3 novel transcript ENST00000481537.1 novel transcript (FLJ34199) ENST00000436500.1 novel transcript ENST00000414704.1 ribosomal protein S7 (RPS7) pseudogene ENST00000456245.1 eukaryotic translation initiation factor 5A2 (EIF5A2) pseudogene ENST00000435808.1 phenylalanyl-tRNA synthetase beta-subunit (FRSB) pseudogene ENST00000429678.1 tryptophanyl tRNA synthetase 2 (mitochondrial) (WARS2) pseudogene ENST00000419698.1 replication protein A2, 32kDa (RPA2) pseudogene ENST00000372141.2 BC136811.1 ENST00000372142.2 neuregulin 3 ENST00000432204.1 serine/threonine protein kinase pseudogene ENST00000441776.1 novel transcript ENST00000446320.1 pseudogene similar to TRIM family of proteins ENST00000432108.1 putative novel transcript ENST00000372134.3 growth hormone inducible transmembrane protein ENST00000339736.6 growth hormone inducible transmembrane protein ENST00000372126.3 novel protein ENST00000472542.1 novel transcript ENST00000332904.3 MT-protocadherin (KIAA1775) ENST00000372117.3 MT-protocadherin (KIAA1775) ENST00000459673.1 novel transcript ENST00000372113.3 novel protein ENST00000359452.4 retinal G protein coupled receptor ENST00000469446.1 retinal G protein coupled receptor ENST00000469446.1 this variant and one of variant fragments .6.7 or .6.8 could be part of a single variant ENST00000478727.1 retinal G protein coupled receptor ENST00000483660.1 retinal G protein coupled receptor ENST00000372092.3 retinal G protein coupled receptor ENST00000483771.1 retinal G protein coupled receptor ENST00000483744.1 retinal G protein coupled receptor ENST00000483744.1 this variant and variant fragment .6.7 could be part of a single variant ENST00000497161.1 retinal G protein coupled receptor ENST00000497161.1 this variant and variant fragment .6.4 could be part of a single variant ENST00000479725.1 retinal G protein coupled receptor ENST00000479725.1 this variant and one of variant fragments .6.4 or .6.5 could be part of a single variant ENST00000437892.1 novel transcript ENST00000494144.1 novel transcript, variant 2 (FLJ25809) ENST00000494586.1 novel transcript ENST00000493409.1 novel transcript ENST00000498300.1 novel transcript ENST00000466105.1 novel transcript ENST00000480006.1 novel transcript ENST00000425565.1 ribosomal protein L12 (RPL12) pseudogene ENST00000423641.1 pseudogene similar to part of karyopherin (importin) beta 2 (KPNB2) ENST00000438592.1 Siah-interacting protein (SIP) (calcyclin binding protein) pseudogene ENST00000454178.1 novel transcript ENST00000444137.1 putative novel transcript ENST00000435367.1 putative novel transcript ENST00000441457.1 novel transcript ENST00000327946.7 glutamate receptor, ionotropic, delta 1 ENST00000552278.1 glutamate receptor, ionotropic, delta 1 ENST00000464741.1 glutamate receptor, ionotropic, delta 1 ENST00000474115.1 glutamate receptor, ionotropic, delta 1 ENST00000443311.1 putative novel transcript ENST00000412054.1 acid phosphatase 1, soluble (ACP1) pseudogene ENST00000342368.3 friend of EBNA2 ENST00000342368.3 friend of EBNA2 (FOE) ENST00000484070.1 novel transcript ENST00000372075.1 friend of EBNA2 ENST00000495124.1 novel transcript ENST00000489996.1 novel transcript ENST00000428940.1 putative novel transcript ENST00000241891.5 novelopsin 4 (melanopsin) ENST00000443292.1 novel protopsin 4 (melanopsin) ENST00000372066.3 LIM domain binding 3 ENST00000361373.3 LIM domain binding 3 ENST00000472076.1 LIM domain binding 3 ENST00000489700.1 LIM domain binding 3 ENST00000480727.1 LIM domain binding 3 ENST00000477489.1 LIM domain binding 3 ENST00000372037.1 bone morphogenetic protein receptor type 1A ENST00000474620.1 bone morphogenetic protein receptor type 1A ENST00000480152.1 bone morphogenetic protein receptor type 1A ENST00000488950.1 novel transcript ENST00000474994.1 novel transcript ENST00000465679.1 synuclein gamma breast cancer-specific protein 1 ENST00000348795.4 synuclein gamma breast cancer-specific protein 1 ENST00000372017.3 synuclein gamma breast cancer-specific protein 1 ENST00000483064.1 synuclein gamma breast cancer-specific protein 1 ENST00000418273.1 novel transcript ENST00000440490.1 putative novel transcript ENST00000372013.3 adipose specific 2 (APM2) ENST00000416348.1 novel protein ENST00000433214.1 novel transcript ENST00000444431.1 novel transcript (KIAA1975) ENST00000372011.4 KIAA0187 pseudogene ENST00000451760.1 putative novel transcript ENST00000343959.4 novel protein ENST00000465914.1 novel transcript ENST00000277865.4 glutamate dehydrogenase 1 ENST00000487058.1 glutamate dehydrogenase 1 ENST00000465164.1 glutamate dehydrogenase 1 ENST00000474574.1 glutamate dehydrogenase 1 ENST00000437629.1 putative novel transcript ENST00000358313.2 novel protein (FLJ12916) ENST00000342900.5 novel protein ENST00000454709.1 putative novel transcript ENST00000456104.1 novel transcript ENST00000413961.1 novel transcript ENST00000433530.1 novel transcript ENST00000451940.1 novel transcript ENST00000420424.1 novel transcript ENST00000413722.1 novel transcript ENST00000366446.4 novel transcript ENST00000433920.1 novel transcript ENST00000417860.1 novel transcript ENST00000444062.1 novel transcript ENST00000447424.1 novel transcript ENST00000446751.1 novel transcript (FLJ34397) ENST00000458739.1 novel transcript ENST00000451286.1 novel protein similar to KIAA2020 ENST00000439559.1 novel transcript ENST00000412718.1 novel protein (KIAA2020) ENST00000465545.1 novel transcript ENST00000451669.1 novel protein ENST00000432327.1 novel pseudogene ENST00000457530.1 cathepsin L-like 1 pseudogene ENST00000429129.1 novel transcript ENST00000447936.1 novel transcript ENST00000417713.1 pseudogene similar to part of ring finger protein 3 (RNF3) ENST00000371996.4 multiple inositol polyphosphate histidine phosphatase, 1 ENST00000371994.4 multiple inositol polyphosphate histidine phosphatase, 1 ENST00000472891.1 multiple inositol polyphosphate histidine phosphatase, 1 ENST00000446794.1 putative novel transcript ENST00000439051.1 novel transcript ENST00000438082.1 novel transcript ENST00000354527.2 novel transcript ENST00000414476.1 ribosomal protein S26 (RPS26) pseudogene ENST00000361175.4 3'-phosphoadenosine 5'-phosphosulfate synthase 2 ENST00000465996.1 3'-phosphoadenosine 5'-phosphosulfate synthase 2 ENST00000482258.1 3'-phosphoadenosine 5'-phosphosulfate synthase 2 ENST00000308448.7 novel protein (FLJ90742) ENST00000328142.3 alternative 5' UTR ENST00000328142.3 novel protein (FLJ90742) ENST00000328142.3 alternatively spliced 5' UTR, shares CDS with Em:AC022016.1.1 ENST00000495903.1 novel transcript ENST00000478142.1 novel transcript ENST00000371953.3 phosphatase and tensin homolog (mutated in multiple advanced cancers 1) ENST00000487939.1 phosphatase and tensin homolog (mutated in multiple advanced cancers 1) ENST00000487939.1 this fragment and one or more of variant fragments .1.4 and .1.5 could be part of a single variant. ENST00000462694.1 phosphatase and tensin homolog (mutated in multiple advanced cancers 1) ENST00000462694.1 this fragment and one or more of variant fragments 1.4 and .1.5 could be part of a single variant. ENST00000498703.1 this fragment and one or more of variant fragments .1.2, .1.3 and .1.5 could be part of a single variant. ENST00000498703.1 phosphatase and tensin homolog (mutated in multiple advanced cancers 1) ENST00000472832.1 phosphatase and tensin homolog (mutated in multiple advanced cancers 1) ENST00000472832.1 this fragment and one or more of variant fragments .1.2 through .1.4 could be part of a single variant. ENST00000416679.1 putative novel transcript ENST00000395256.2 ribosomal protein L11 (RPL11) pseudogene ENST00000439659.1 mediator of RNA polymerase II transcription, subunit 6 homolog (yeast) (MED6) pseudogene ENST00000371947.3 novel protein (FLJ11218) ENST00000331772.4 novel protein (FLJ11218) ENST00000466945.1 novel transcript ENST00000481793.1 novel transcript ENST00000433316.1 ribosomal protein L7 (RPL7) pseudogene ENST00000238983.4 lipase, gastric ENST00000355843.2 lipase, gastric ENST00000355843.2 alternative 5' UTR ENST00000355843.2 alternatively spliced 5' UTR, shares CDS witn bA186O14.1.1 ENST00000496797.1 lipase, gastric ENST00000441370.1 keratin 8 (KRT8) pseudogene ENST00000491766.1 novel transcript ENST00000453021.1 CHC1L (chromosome condensation 1-like, RCC1-like G exchanging factor RLG) pseudogene ENST00000371930.4 novel protein (MGC22805) ENST00000476963.1 novel transcript ENST00000415579.1 novel pseudogene (FLJ12598) ENST00000371926.3 novel Mov34/MPN/PAD-1 family domain containing protein ENST00000371927.3 novel Mov34/MPN/PAD-1 family domain containing protein (KIAA1373) ENST00000461650.1 novel transcript ENST00000468698.1 putative novel transcript ENST00000371924.1 novel Mov34/MPN/PAD-1 family domain containing protein (FLJ35627) ENST00000371922.1 novel Mov34/MPN/PAD-1 family domain containing protein (FLJ33359) ENST00000437930.1 novel transcript (FLJ36021) ENST00000224784.6 actin, alpha 2, smooth muscle, aorta ENST00000480297.1 actin, alpha 2, smooth muscle, aorta ENST00000415557.1 actin, alpha 2, smooth muscle, aorta ENST00000458159.1 actin, alpha 2, smooth muscle, aorta ENST00000488967.1 actin, alpha 2, smooth muscle, aorta ENST00000482085.1 actin, alpha 2, smooth muscle, aorta ENST00000355740.2 tumor necrosis factor receptor superfamily, member 6 ENST00000484444.1 tumor necrosis factor receptor superfamily, member 6, variant 4 (FAS soluble protein) ENST00000357339.2 tumor necrosis factor receptor superfamily, member 6, variant 2 (FAS soluble protein) ENST00000494410.1 tumor necrosis factor receptor superfamily, member 6, variant 3 (FAS soluble protein) ENST00000479522.1 tumor necrosis factor receptor superfamily, member 6, variant 5 (FAS soluble protein truncated variant) ENST00000488877.1 tumor necrosis factor receptor superfamily, member 6 ENST00000492756.1 tumor necrosis factor receptor superfamily, member 6 ENST00000355279.2 tumor necrosis factor receptor superfamily, member 6 ENST00000460510.1 tumor necrosis factor receptor superfamily, member 6 ENST00000477270.1 tumor necrosis factor receptor superfamily, member 6 ENST00000466081.1 tumor necrosis factor receptor superfamily, member 6 ENST00000494799.1 tumor necrosis factor receptor superfamily, member 6 ENST00000487314.1 tumor necrosis factor receptor superfamily, member 6 ENST00000453728.1 novel zinc finger pseudogene ENST00000336233.5 lipase A, lysosomal acid, cholesterol esterase (Wolman disease) ENST00000371837.1 lipase A, lysosomal acid, cholesterol esterase (Wolman disease) ENST00000371829.1 lipase A, lysosomal acid, cholesterol esterase (Wolman disease) ENST00000428800.1 lipase A, lysosomal acid, cholesterol esterase (Wolman disease) ENST00000282673.4 lipase A, lysosomal acid, cholesterol esterase (Wolman disease) ENST00000487618.1 lipase A, lysosomal acid, cholesterol esterase (Wolman disease) ENST00000463623.1 lipase A, lysosomal acid, cholesterol esterase (Wolman disease) ENST00000489359.1 lipase A, lysosomal acid, cholesterol esterase (Wolman disease) ENST00000448897.1 putative novel transcript ENST00000444849.1 putative novel transcript ENST00000354541.3 putative novel transcript ENST00000437032.1 putative novel transcript ENST00000371826.3 interferon-induced protein with tetratricopeptide repeats 2 ENST00000371818.4 interferon-induced protein with tetratricopeptide repeats 4 ENST00000371811.4 interferon-induced protein with tetratricopeptide repeats 4 ENST00000418257.1 interferon-induced protein with tetratricopeptide repeats 1 (IFIT1) pseudogene ENST00000371809.3 novel protein similar to interferon-induced protein with tetratricopeptide repeats 1 (IFIT1) ENST00000371804.3 interferon-induced protein with tetratricopeptide repeats 1 ENST00000371795.4 retinoic acid- and interferon-inducible protein (58kD) (RI58) ENST00000475682.1 alternative 5' UTR ENST00000454270.1 putative novel transcript ENST00000423474.1 putative novel transcript ENST00000342512.3 pantothenate kinase 1 ENST00000322191.6 pantothenate kinase 1 ENST00000461829.1 this variant and variant 3 could be part of the same variant ENST00000461829.1 pantothenate kinase 1 ENST00000488482.1 pantothenate kinase 1 ENST00000488482.1 this variant and variant 4 could be part of the same variant ENST00000425814.1 Homo sapiens miR-107-precursor-10 micro RNA ENST00000507624.1 pantothenate kinase 1 (PANK1) pseudogene ENST00000454174.1 novel transcript ENST00000451733.1 novel transcript ENST00000428166.1 putative novel transcript ENST00000449882.1 novel transcript ENST00000455699.1 putative novel transcript ENST00000260753.4 M-phase phosphoprotein 1 ENST00000371728.3 M-phase phosphoprotein 1 ENST00000439656.1 M-phase phosphoprotein 1 ENST00000447580.1 M-phase phosphoprotein 1 ENST00000478929.1 M-phase phosphoprotein 1 ENST00000448963.1 novel transcript ENST00000448490.1 novel transcript (DKFZp434P0810) ENST00000428485.1 novel transcript (FLJ35900) ENST00000418379.1 novel transcript ENST00000422206.1 novel transcript ENST00000439157.1 novel transcript ENST00000453889.1 putative novel transcript ENST00000414903.1 novel transcript ENST00000425365.1 novel transcript ENST00000336152.3 5-hydroxytryptamine receptor 7 (adenylate cyclase-coupled) ENST00000277874.6 5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled) ENST00000371719.2 5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled) ENST00000371721.2 5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled) ENST00000371703.3 ribonuclease P (30kD) (RPP30) ENST00000487998.1 ribonuclease P (30kD) (RPP30) ENST00000277882.3 ribonuclease P (30kD) (RPP30) ENST00000414836.1 ribonuclease P (30kD) (RPP30) ENST00000466462.1 ribonuclease P (30kD) (RPP30) ENST00000480635.1 ribonuclease P (30kD) (RPP30) ENST00000489806.1 ribonuclease P (30kD) (RPP30) ENST00000480406.1 ribonuclease P (30kD) (RPP30) ENST00000479678.1 ribonuclease P (30kD) (RPP30) ENST00000470933.1 ribonuclease P (30kD) (RPP30) ENST00000371697.3 cardiac ankyrin repeat protein (CARP) ENST00000455465.1 putative novel transcript ENST00000412362.1 putative novel transcript ENST00000423621.1 novel transcript ENST00000450119.1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 18 (Myc-regulated) (DDX18) pseudogene ENST00000496708.1 novel transcript ENST00000490164.1 novel transcript ENST00000336126.5 novel protein ENST00000336126.5 continued_from Em:AC023902.1 in Em:AC023902 ENST00000371681.4 continued_from Em:AC023902.1.1 in Em:AC023902 ENST00000371681.4 novel protein (FLJ37306) ENST00000487511.1 continued_from Em:AC023902.2.2 in Em:AC023902 ENST00000487511.1 novel transcript ENST00000498446.1 novel transcript ENST00000371667.1 novel protein ENST00000450552.1 ribosomal protein S27 (metallopanstimulin 1) (RPS27) pseudogene ENST00000238994.5 protein phosphatase 1, regulatory (inhibitor) subunit 3C ENST00000455134.1 glyceraldehyde-3-phosphate dehydrogenase (GAPD) pseudogene ENST00000429974.1 pseudogene similar to KIAA0887 ENST00000432938.1 putative novel transcript ENST00000432246.1 putative novel transcript ENST00000371627.4 tankyrase,TRF1-interacting ankyrin-related ADP-ribose polymerase 2 (tankyrase 2, TNKL, TANK2) ENST00000311575.5 novel protein similar to brain-specific angiogenesis inhibitor 3 ENST00000265990.5 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) ENST00000471217.1 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) ENST00000476401.1 BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa (Mot1 homolog, S. cerevisiae) ENST00000394210.1 KIAA0940 protein ENST00000265997.4 novel protein ENST00000398565.2 succinate dehydrogenase complex pseudogene ENST00000394444.2 translational eukaryotic inititation factor 4 pseudogene ENST00000358935.2 novel protein (FLJ20445) ENST00000467521.1 novel transcript ENST00000462465.1 novel transcript ENST00000492319.1 novel transcript ENST00000430958.1 MAP/microtubule affinity-regulating kinase 2 (MARK2) pseudogene ENST00000265986.6 insulin-degrading enzyme ENST00000496903.1 insulin-degrading enzyme ENST00000478361.1 insulin-degrading enzyme ENST00000463640.1 insulin-degrading enzyme ENST00000462988.1 insulin-degrading enzyme ENST00000492362.1 insulin-degrading enzyme ENST00000436178.1 insulin-degrading enzyme ENST00000260731.3 kinesin family member 11 ENST00000332269.6 ribosomal protein L11 (RPL11) pseudogene ENST00000371543.1 SEC15 (S. cerevisiae)-like (SEC15L) ENST00000260762.6 SEC15 (S. cerevisiae)-like (SEC15L) ENST00000497262.1 putative novel transcript ENST00000495132.1 SEC15 (S. cerevisiae)-like (SEC15L) ENST00000458552.1 SEC15 (S. cerevisiae)-like (SEC15L) ENST00000447000.1 pseudogene similar to part of nuclease sensitive element binding protein 1 (NSEP1) ENST00000444965.1 putative novel transcript ENST00000371531.1 cytochrome P450, family 26, subfamily A, polypeptide 1 ENST00000224356.4 cytochrome P450, family 26, subfamily A, polypeptide 1 ENST00000224356.4 alternative 5' UTR ENST00000433227.1 novel pseudogene (HSPC031) ENST00000420392.1 thyroid autoantigen 70kDa (Ku antigen)(G22P1) pseudogene ENST00000394133.2 ribosomal protein L17 (RPL17) pseudogene ENST00000463743.1 fer-1-like 3, myoferlin (C. elegans) ENST00000358334.5 fer-1-like 3, myoferlin (C. elegans) ENST00000359263.4 fer-1-like 3, myoferlin (C. elegans) ENST00000463541.1 fer-1-like 3, myoferlin (C. elegans) ENST00000474161.1 fer-1-like 3, myoferlin (C. elegans) ENST00000485212.1 fer-1-like 3, myoferlin (C. elegans) ENST00000475358.1 fer-1-like 3, myoferlin (C. elegans) ENST00000371489.1 fer-1-like 3, myoferlin (C. elegans) ENST00000371488.3 fer-1-like 3, myoferlin (C. elegans) ENST00000488645.1 fer-1-like 3, myoferlin (C. elegans) ENST00000371485.3 chromosome 10 open reading frame 3 ENST00000445435.1 chromosome 10 open reading frame 3 ENST00000496302.1 chromosome 10 open reading frame 3 ENST00000371464.3 retinol binding protein 4, plasma ENST00000371469.1 retinol binding protein 4, plasma ENST00000371467.1 retinol binding protein 4, plasma ENST00000371467.1 alternative 5' UTR ENST00000471469.1 retinol binding protein 4, plasma ENST00000471333.1 retinol binding protein 4, plasma ENST00000371447.3 phosphodiesterase 6C, cGMP-specific, cone, alpha prime ENST00000371447.3 phosphodiesterase 6C, cGMP-specific, cone, alpha prime (PDEA2) ENST00000475427.1 phosphodiesterase 6C, cGMP-specific, cone, alpha prime (PDEA2) ENST00000359204.4 chromosome 10 open reading frame 4 ENST00000460752.1 chromosome 10 open reading frame 4 ENST00000483229.1 chromosome 10 open reading frame 4 ENST00000462771.1 chromosome 10 open reading frame 4 ENST00000472153.1 chromosome 10 open reading frame 4 ENST00000482719.1 chromosome 10 open reading frame 4 ENST00000371418.4 leucine-rich, glioma inactivated 1 ENST00000371413.3 leucine-rich, glioma inactivated 1 ENST00000478763.1 leucine-rich, glioma inactivated 1 ENST00000485458.1 leucine-rich, glioma inactivated 1 ENST00000464250.1 leucine-rich, glioma inactivated 1 ENST00000442978.1 RAB11B, member RAS oncogene family (H-YPT3) pseudogene ENST00000371408.3 novel protein (FLJ33990) ENST00000483386.1 novel transcript ENST00000494992.1 novel transcript ENST00000371380.1 phospholipase C, epsilon 1 (PLCE, KIAA1516) ENST00000371375.1 phospholipase C, epsilon 1 (PLCE, KIAA1516) ENST00000464214.1 phospholipase C, epsilon 1 (PLCE, KIAA1516) ENST00000438899.1 novel transcript ENST00000432782.1 novel transcript ENST00000433038.1 novel transcript ENST00000419353.1 novel transcript ENST00000453183.1 novel transcript ENST00000432707.1 putative novel transcript ENST00000455482.1 histone deacetylase 1 (HDAC1) pseudogene ENST00000447227.1 putative novel transcript ENST00000425267.1 putative novel transcript ENST00000440198.1 putative novel transcript ENST00000371361.3 AD24 protein (FLJ12820) ENST00000463649.1 novel transcript ENST00000461562.1 novel transcript ENST00000225235.4 novel protein (KIAA0608) ENST00000482498.1 non-canonical donor splice site at 1st exon. ENST00000482498.1 novel transcript ENST00000485048.1 novel transcript ENST00000457045.1 putative novel transcript ENST00000419900.1 helicase, lymphoid-specific (LSH, PASG, SMARCA6, FLJ10339) ENST00000348459.5 helicase, lymphoid-specific (LSH, PASG, SMARCA6, FLJ10339) ENST00000462057.1 helicase, lymphoid-specific (LSH, PASG, SMARCA6, FLJ10339) ENST00000466552.1 helicase, lymphoid-specific (LSH, PASG, SMARCA6, FLJ10339) ENST00000371327.1 helicase, lymphoid-specific (LSH, PASG, SMARCA6, FLJ10339) ENST00000464030.1 helicase, lymphoid-specific (LSH, PASG, SMARCA6, FLJ10339) ENST00000475263.1 helicase, lymphoid-specific (LSH, PASG, SMARCA6, FLJ10339) ENST00000432120.1 putative novel transcript ENST00000434549.1 C-terminal binding protein 2 (CTBP2) pseudogene ENST00000476630.1 cytochrome P450, family 2, subfamily C, polypeptide 18 ENST00000285979.6 cytochrome P450, family 2, subfamily C, polypeptide 18 ENST00000464755.1 cytochrome P450, family 2, subfamily C, polypeptide 19 ENST00000371321.3 cytochrome P450, family 2, subfamily C, polypeptide 19 ENST00000480405.1 cytochrome P450, family 2, subfamily C, polypeptide 19 ENST00000446659.1 pseudogene similar to part of NADH dehydrogenase 4 (MTND4) ENST00000436281.1 cytochrome P450, family 2, subfamily C pseudogene ENST00000458096.1 ribosomal protein L7a (RPL7A) pseudogene ENST00000461906.1 cytochrome P450, family 2, subfamily C, polypeptide 9 ENST00000260682.6 cytochrome P450, family 2, subfamily C, polypeptide 9 ENST00000473496.1 cytochrome P450, family 2, subfamily C, polypeptide 9 ENST00000424125.1 mitochondrial NADH dehydrogenase 4 (MTND4) pseudogene ENST00000457790.1 pseudogene similar to part of cytochrome P450, family 2, subfamily C ENST00000442302.1 novel pseudogene ENST00000371270.3 cytochrome P450, family 2, subfamily C, polypeptide 8 ENST00000526880.1 non-canonical splice donor site between exons 2 and 3 ENST00000479946.2 cytochrome P450, family 2, subfamily C, polypeptide 8 ENST00000527488.1 non-canonical splice donor site between exons 2 and 3 ENST00000422744.1 putative novel transcript ENST00000451083.1 pseudogene similar to part of PRKC, apoptosis, WT1, regulator (PAWR) ENST00000394005.3 novel AMP-binding enzyme ENST00000451737.1 putative novel transcript ENST00000329399.6 PDZ and LIM domain 1 (elfin) ENST00000492511.1 PDZ and LIM domain 1 (elfin) ENST00000477757.1 PDZ and LIM domain 1 (elfin) ENST00000490391.1 PDZ and LIM domain 1 (elfin) ENST00000493949.1 PDZ and LIM domain 1 (elfin) ENST00000371245.2 sorbin and SH3 domain containing 1 (CAP, SH3D5, SORB1, SH3P12, ponsin, sh3p12) ENST00000470320.1 this variant and one or more of variants .2.3, .2.10, .2.11, .2.12 and .2.14 could be part of a single variant. ENST00000470320.1 sorbin and SH3 domain containing 1 (CAP, SH3D5, SORB1, SH3P12, ponsin, sh3p12) ENST00000306402.6 sorbin and SH3 domain containing 1 (CAP, SH3D5, SORB1, SH3P12, ponsin, sh3p12), variant 1 (KIAA1296) ENST00000371249.2 sorbin and SH3 domain containing 1 (CAP, SH3D5, SORB1, SH3P12, ponsin, sh3p12), variant 2 (DKFZp586P1422) ENST00000361941.3 sorbin and SH3 domain containing 1 (CAP, SH3D5, SORB1, SH3P12, ponsin, sh3p12) ENST00000277982.5 sorbin and SH3 domain containing 1 (CAP, SH3D5, SORB1, SH3P12, ponsin, sh3p12) ENST00000371241.1 sorbin and SH3 domain containing 1 (CAP, SH3D5, SORB1, SH3P12, ponsin, sh3p12) ENST00000354106.3 sorbin and SH3 domain containing 1 (CAP, SH3D5, SORB1, SH3P12, ponsin, sh3p12) ENST00000371239.1 sorbin and SH3 domain containing 1 (CAP, SH3D5, SORB1, SH3P12, ponsin, sh3p12) ENST00000472854.1 sorbin and SH3 domain containing 1 (CAP, SH3D5, SORB1, SH3P12, ponsin, sh3p12) ENST00000472854.1 this variant and one or more of variant fragments .2.3, .2.11 and .2.12 could be part of a single variant ENST00000486141.1 this variant and one or more of variant fragments .2.12 and .2.14 could be part of a single variant. ENST00000486141.1 sorbin and SH3 domain containing 1 (CAP, SH3D5, SORB1, SH3P12, ponsin, sh3p12) ENST00000465489.1 this variant and one or more of variant fragments .2.11 through .2.13 could be part of a single variant. ENST00000465489.1 sorbin and SH3 domain containing 1 (CAP, SH3D5, SORB1, SH3P12, ponsin, sh3p12) ENST00000470039.1 sorbin and SH3 domain containing 1 (CAP, SH3D5, SORB1, SH3P12, ponsin, sh3p12), variant 3 (FLJ12406) ENST00000492542.1 sorbin and SH3 domain containing 1 (CAP, SH3D5, SORB1, SH3P12, ponsin, sh3p12) ENST00000474353.1 this variant and one or more of variant fragments .2.10, .2.11, .2.13 and .2.14 could be part of a single variant. ENST00000474353.1 sorbin and SH3 domain containing 1 (CAP, SH3D5, SORB1, SH3P12, ponsin, sh3p12) ENST00000482068.1 sorbin and SH3 domain containing 1 (CAP, SH3D5, SORB1, SH3P12, ponsin, sh3p12) ENST00000371228.1 novel protein (KIAA0894) ENST00000398190.2 ribosomal protein S3A (RPS3A) pseudogene ENST00000371224.2 pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase) (GSAS, P5CS) ENST00000371221.3 pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase) (GSAS, P5CS) ENST00000485428.1 this variant and one or more of variant fragments .2.3 and .2.4 could be part of a single variant ENST00000485428.1 pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase) (GSAS, P5CS) ENST00000489386.1 this variant and one or more of variant fragments .2.4 and .2.5 could be part of a single variant ENST00000489386.1 pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase) (GSAS, P5CS) ENST00000483788.1 pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase) (GSAS, P5CS) ENST00000483788.1 this variant and one or more of variant fragments .2.3 and .2.5 could be part of a single variant ENST00000480852.1 FLJ40976 ENST00000467470.1 this variant and one of variant fragments .3.5 or .3.6 could be part of a single variant ENST00000467470.1 novel transcript ENST00000488566.1 ectonucleoside triphosphate diphosphohydrolase 1 ENST00000453258.2 ectonucleoside triphosphate diphosphohydrolase 1 ENST00000371206.1 ectonucleoside triphosphate diphosphohydrolase 1 ENST00000481316.1 ectonucleoside triphosphate diphosphohydrolase 1 ENST00000371205.4 ectonucleoside triphosphate diphosphohydrolase 1 ENST00000483213.1 ectonucleoside triphosphate diphosphohydrolase 1 ENST00000490659.1 ectonucleoside triphosphate diphosphohydrolase 1 ENST00000494070.1 ectonucleoside triphosphate diphosphohydrolase 1 ENST00000461927.1 ectonucleoside triphosphate diphosphohydrolase 1 ENST00000422161.2 ectonucleoside triphosphate diphosphohydrolase 1 ENST00000466637.1 ectonucleoside triphosphate diphosphohydrolase 1 ENST00000458228.1 novel transcript ENST00000454638.1 novel transcript, variant 3 (FLJ39150) ENST00000452728.1 novel transcript ENST00000416301.1 novel transcript, variant 1 (FLJ34077) ENST00000449419.1 novel transcript ENST00000414006.1 novel transcript ENST00000452942.1 novel transcript ENST00000427300.1 novel transcript ENST00000451364.1 novel transcript ENST00000449197.1 novel transcript ENST00000427846.1 novel transcript ENST00000444375.1 novel transcript ENST00000433113.1 putative novel transcript ENST00000491114.1 novel protein ENST00000371202.1 novel protein ENST00000415692.1 ribosomal protein L21 (RPL21) pseudogene ENST00000465148.1 FLJ35041 ENST00000471424.1 novel transcript, variant 2 (FLJ10895) ENST00000371192.1 suspected genomic sequence error affecting CDS in exon 2 ENST00000429734.1 nucleophosmin (nucleolar phosphoprotein B23, numatrin), NPM1 pseudogene ENST00000224337.5 B-cell linker (Ly57, SLP65, BLNK-s, SLP-65) ENST00000371176.2 B-cell linker (Ly57, SLP65, BLNK-s, SLP-65) ENST00000485193.1 this variant and one or more of variant fragments .1.3 and .1.5 could be part of a single variant ENST00000485193.1 B-cell linker (Ly57, SLP65, BLNK-s, SLP-65) ENST00000467799.1 B-cell linker (Ly57, SLP65, BLNK-s, SLP-65) ENST00000468252.1 B-cell linker (Ly57, SLP65, BLNK-s, SLP-65) ENST00000472763.1 B-cell linker (Ly57, SLP65, BLNK-s, SLP-65) ENST00000472763.1 this variant and one or more of variant fragments .1.3 and .1.6 could be part of a single variant ENST00000495266.1 this variant and one or more of variant fragments .1.5 and .1.6 could be part of a single variant ENST00000495266.1 B-cell linker (Ly57, SLP65, BLNK-s, SLP-65) ENST00000442635.1 putative novel transcript ENST00000454484.1 novel transcript ENST00000371174.2 deoxynucleotidyltransferase, terminal (TDT) ENST00000371172.3 transmembrane protein 10 (TMP10, HTMP10) ENST00000357947.3 tolloid-like 2 ENST00000469598.1 tolloid-like 2 ENST00000506028.1 putative novel transcript ENST00000371142.4 SM-11044 binding protein (SMBP)(EP70-P-iso) ENST00000485093.1 novel transcript ENST00000490192.1 novel transcript ENST00000443638.1 SM-11044 binding protein (SMBP)(EP70-P-iso) ENST00000464654.1 novel transcript ENST00000475401.1 novel transcript ENST00000426339.1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1)(B23, NPM, NUMATRIN) pseudogene ENST00000371110.2 FLJ35564 ENST00000467625.1 novel transcript ENST00000489982.1 novel transcript ENST00000461252.1 novel transcript ENST00000456516.1 ribosomal protein S2 (RPS2) pseudogene ENST00000371103.3 novel protein (likely ortholog of mouse transcription factor MLR2)(MLR2) ENST00000371097.3 novel protein (likely ortholog of mouse transcription factor MLR2)(MLR2) ENST00000356016.2 novel protein (likely ortholog of mouse transcription factor MLR2)(MLR2)(KIAA1795) ENST00000493486.1 novel transcript ENST00000469510.1 putative novel transcript ENST00000498444.1 novel transcript ENST00000463415.1 novel transcript ENST00000412164.1 high mobility group nucleosomal binding domain 4 (HMGN4)(NHC, HMG17L3, MGC5145) pseudogene ENST00000358531.4 novel protein (MGC14258) ENST00000492211.1 novel transcript ENST00000487035.1 novel transcript ENST00000371027.1 novel protein (MGC14258), variant 2 (FLJ36122) ENST00000479633.1 novel protein (MGC14258), variant 1 (FLJ35997) ENST00000466484.1 novel transcript ENST00000493068.1 novel transcript ENST00000266058.4 slit homolog 1 (Drosophila) ENST00000494968.1 slit homolog 1 (Drosophila) ENST00000371070.4 slit homolog 1 (Drosophila) ENST00000314867.5 slit homolog 1 (Drosophila) ENST00000456008.1 slit homolog 1 (Drosophila) ENST00000371041.3 slit homolog 1 (Drosophila) ENST00000497714.1 slit homolog 1 (Drosophila) ENST00000475285.1 slit homolog 1 (Drosophila) ENST00000424428.1 novel transcript ENST00000456509.1 CD164 antigen, sialomucin (CD164) pseudogene ENST00000414870.1 ribosomal protein L12 (RPL12) pseudogene ENST00000490980.1 frequently rearranged in advanced T-cell lymphomas ENST00000445808.1 putative novel transcript ENST00000491313.1 novel transcript ENST00000479481.1 novel transcript ENST00000370992.4 novel protein (FLJ12434) ENST00000315563.6 novel protein (KIAA0690) ENST00000465394.1 putative novel transcript ENST00000487612.1 putative novel transcript ENST00000490815.1 novel transcript ENST00000479317.1 putative novel transcript ENST00000442771.1 ribosomal protein L34 (RPL34) pseudogene ENST00000422848.1 putative novel transcript ENST00000334828.5 phosphoglycerate mutase 1 (brain) ENST00000473929.1 phosphoglycerate mutase 1 (brain) ENST00000469305.1 phosphoglycerate mutase 1 (brain) ENST00000467867.1 phosphoglycerate mutase 1 (brain) ENST00000464440.1 novel transcript ENST00000370902.3 exosomal core protein CSL4 (CSL4) ENST00000477692.1 novel transcript ENST00000370886.4 exosomal core protein CSL4 (CSL4) ENST00000370885.4 exosomal core protein CSL4 (CSL4) ENST00000461413.1 novel transcript ENST00000370884.4 exosomal core protein CSL4 (CSL4) ENST00000485122.1 novel transcript ENST00000471049.1 novel transcript ENST00000472345.1 novel transcript ENST00000476234.1 novel transcript ENST00000489158.1 novel transcript ENST00000474309.1 novel transcript ENST00000370854.3 zinc finger, DHHC domain containing 16 ENST00000414567.1 zinc finger, DHHC domain containing 16 ENST00000459777.1 zinc finger, DHHC domain containing 16 ENST00000466895.1 zinc finger, DHHC domain containing 16 ENST00000370846.4 zinc finger, DHHC domain containing 16 ENST00000352634.4 zinc finger, DHHC domain containing 16 ENST00000353979.3 zinc finger, DHHC domain containing 16 ENST00000370842.1 zinc finger, DHHC domain containing 16 ENST00000345745.5 zinc finger, DHHC domain containing 16 ENST00000462924.1 zinc finger, DHHC domain containing 16 ENST00000433086.1 zinc finger, DHHC domain containing 16 ENST00000492610.1 zinc finger, DHHC domain containing 16 ENST00000495735.1 zinc finger, DHHC domain containing 16 ENST00000420089.1 zinc finger, DHHC domain containing 16 ENST00000417044.1 zinc finger, DHHC domain containing 16 ENST00000487315.1 zinc finger, DHHC domain containing 16 ENST00000492733.1 zinc finger, DHHC domain containing 16 ENST00000370782.1 alternative 5' UTR ENST00000370664.3 novel protein (FLJ11807) ENST00000370655.1 ankyrin repeat domain 2 (stretch responsive muscle) ENST00000455090.1 ankyrin repeat domain 2 (stretch responsive muscle) ENST00000465608.1 FLJ37472 ENST00000478953.1 FLJ25925 ENST00000515674.1 alternative 5' UTR ENST00000451097.1 novel transcript ENST00000285605.6 NMD exception ENST00000449755.1 FLJ23440 ENST00000497994.1 FLJ32919 ENST00000359980.3 FLJ90395, FLJ40626 ENST00000423811.1 DFKZp547E092 ENST00000473237.1 novel transcript ENST00000427379.1 novel transcript ENST00000413387.1 FLJ10320 ENST00000468549.1 novel transcript ENST00000423054.1 putative novel transcript ENST00000494941.1 novel transcript ENST00000462874.1 novel transcript ENST00000462743.1 novel transcript ENST00000497527.1 novel transcript ENST00000474873.1 novel transcript ENST00000465957.1 novel transcript ENST00000356713.4 NP_065081 ENST00000452391.1 putative novel transcript ENST00000370489.4 lysosomal apyrase-like protein 1 ENST00000472998.1 novel transcript ENST00000418955.1 estrogen receptor binding site associated antigen 9 (EBAG9) pseudogene ENST00000493385.1 novel transcript ENST00000370476.5 CGI-32 protein ENST00000471520.1 CGI-32 protein ENST00000370472.4 CGI-32 protein ENST00000370483.5 COX15 homolog cytochrome c oxidase assembly protein (yeast) ENST00000016171.5 COX15 homolog cytochrome c oxidase assembly protein (yeast) ENST00000497381.1 COX15 homolog cytochrome c oxidase assembly protein (yeast) ENST00000485884.1 COX15 homolog cytochrome c oxidase assembly protein (yeast) ENST00000370449.4 ATP-binding cassette sub-family C (CFTR/MRP) member 2 ENST00000370434.1 ATP-binding cassette sub-family C (CFTR/MRP) member 2 ENST00000496621.1 ATP-binding cassette sub-family C (CFTR/MRP) member 2 ENST00000429190.1 novel pseudogene ENST00000342239.3 novel protein (KIAA1010) ENST00000472036.1 novel transcript ENST00000422692.1 novel protein (KIAA1010) ENST00000434409.1 novel transcript (FLJ40792) ENST00000370418.3 carboxypeptidase N polypeptide 1 50 kD ENST00000477709.1 carboxypeptidase N polypeptide 1 50 kD ENST00000441382.1 carboxypeptidase N polypeptide 1 50 kD ENST00000472355.1 carboxypeptidase N polypeptide 1 50 kD ENST00000436100.1 tropomyosin 4 (TPM4) pseudogene ENST00000407654.3 alternative 5' UTR ENST00000370408.2 alternative 5' UTR ENST00000370397.5 conserved helix-loop ubiquitous kinase ENST00000485693.1 conserved helix-loop ubiquitous kinase ENST00000474023.1 conserved helix-loop ubiquitous kinase ENST00000462242.1 conserved helix-loop ubiquitous kinase ENST00000443919.1 putative novel transcript ENST00000444359.1 novel transcript ENST00000485266.1 novel transcript ENST00000472872.1 novel protein (FLJ10998) ENST00000468709.1 novel transcript (FLJ40576) ENST00000482452.1 novel protein (FLJ13922) ENST00000478047.1 novel transcript (FLJ30751) ENST00000370379.1 novel protein ENST00000466955.1 novel protein ENST00000466408.1 novel transcript ENST00000496796.1 novel transcript ENST00000473842.1 novel transcript ENST00000453578.1 prohibitin (PHB) pseudogene ENST00000361832.1 novel protein (FLJ30135) ENST00000370372.1 novel protein ENST00000429420.1 novel transcript ENST00000423840.1 stearoyl-CoA desaturase (delta-9-desaturase) ENST00000370355.2 stearoyl-CoA desaturase (delta-9-desaturase) ENST00000454935.1 novel transcript (FLJ12974) ENST00000343737.5 wingless-type MMTV integration site family member 8B ENST00000485800.1 novel transcript ENST00000492667.1 novel transcript ENST00000462434.1 secretory pathway component Sec31B-1 ENST00000469824.1 novel transcript ENST00000480905.1 novel transcript ENST00000529568.1 subject to nonsense-mediated decay ENST00000527595.1 subject to nonsense-mediated decay ENST00000557395.1 subject to nonsense-mediated decay ENST00000528174.1 subject to nonsense-mediated decay ENST00000533549.1 subject to nonsense-mediated decay ENST00000370320.4 NADH dehydrogenase (ubiquinone) 1 beta subcomplex 8, 19kDa ENST00000483202.2 paired box gene 2 ENST00000238961.3 chromosome 10 open reading frame 6 ENST00000370271.3 chromosome 10 open reading frame 6 ENST00000370269.3 chromosome 10 open reading frame 6 ENST00000481654.1 chromosome 10 open reading frame 6 ENST00000318325.2 mitochondrial ribosomal protein L43 ENST00000370241.3 mitochondrial ribosomal protein L43 ENST00000370242.4 mitochondrial ribosomal protein L43 ENST00000476012.1 mitochondrial ribosomal protein L43 ENST00000448244.1 mitochondrial ribosomal protein L43 ENST00000299179.5 mitochondrial ribosomal protein L43 ENST00000370236.1 mitochondrial ribosomal protein L43 ENST00000493646.1 mitochondrial ribosomal protein L43 ENST00000318364.8 mitochondrial ribosomal protein L43 ENST00000477279.1 mitochondrial ribosomal protein L43 ENST00000370234.4 mitochondrial ribosomal protein L43 ENST00000487059.1 mitochondrial ribosomal protein L43 ENST00000519649.1 alternative 5' UTR ENST00000518124.1 alternative 5' UTR ENST00000370250.4 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G ENST00000210633.3 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G ENST00000519756.1 not organism-supported ENST00000476171.1 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G ENST00000447344.1 putative novel transcript ENST00000476766.1 chromosome 10 open reading frame 2 ENST00000473656.1 chromosome 10 open reading frame 2 ENST00000459764.1 chromosome 10 open reading frame 2 ENST00000311916.2 chromosome 10 open reading frame 2 ENST00000370228.1 chromosome 10 open reading frame 2 ENST00000426584.1 novel protein ENST00000370223.3 novel protein ENST00000489526.1 novel transcript ENST00000429732.1 novel protein ENST00000481129.1 novel transcript ENST00000370220.1 novel protein (KIAA1813) (LAPSER1) ENST00000454422.1 novel protein ENST00000459989.1 novel transcript ENST00000438367.1 putative novel transcript ENST00000474125.1 novel transcript (FLJ00011) ENST00000433616.1 novel protein ENST00000370215.3 novel protein (FLJ23209) ENST00000476306.1 novel transcript ENST00000470414.1 novel transcript ENST00000393459.1 novel tricarboxylate carrier domain containing protein ENST00000489434.1 novel transcript ENST00000465383.1 novel transcript ENST00000487721.1 novel transcript ENST00000466982.1 novel transcript (FLJ34185) ENST00000470252.1 novel transcript (FLJ35692) ENST00000456391.1 novel transcript ENST00000434878.1 novel transcript ENST00000430651.1 novel transcript (FLJ39379) ENST00000454527.1 novel transcript ENST00000422661.1 novel transcript (FLJ34886) ENST00000442188.1 putative novel transcript ENST00000450669.1 putative novel transcript ENST00000370187.3 beta-transducin repeat containing ENST00000475200.1 split hand/foot malformation (ectrodactyly) type 3 ENST00000475200.1 beta-transducin repeat containing ENST00000408038.2 beta-transducin repeat containing ENST00000465182.1 beta-transducin repeat containing ENST00000370183.2 beta-transducin repeat containing ENST00000493877.1 beta-transducin repeat containing ENST00000470165.1 novel transcript ENST00000370151.4 novel protein (DKFZP566F084) ENST00000370147.1 novel protein ENST00000434727.1 novel protein ENST00000475443.1 novel transcript ENST00000299206.4 alternatively spliced 5' UTR; shares CDS with bA529I10.2.3 ENST00000299206.4 polymerase (DNA directed), lambda ENST00000299206.4 alternative 5' UTR ENST00000370174.1 polymerase (DNA directed), lambda ENST00000370169.1 alternatively spliced 5' UTR; shares CDS with bA529I10.2.1 ENST00000370169.1 polymerase (DNA directed), lambda ENST00000370169.1 alternative 5' UTR ENST00000339310.3 polymerase (DNA directed), lambda ENST00000370172.1 polymerase (DNA directed), lambda ENST00000370168.3 polymerase (DNA directed), lambda ENST00000463515.1 polymerase (DNA directed), lambda ENST00000415897.1 polymerase (DNA directed), lambda ENST00000485369.1 polymerase (DNA directed), lambda ENST00000429502.1 polymerase (DNA directed), lambda ENST00000470140.1 polymerase (DNA directed), lambda ENST00000426919.1 polymerase (DNA directed), lambda ENST00000454524.1 polymerase (DNA directed), lambda ENST00000413344.1 polymerase (DNA directed), lambda ENST00000461587.1 polymerase (DNA directed), lambda ENST00000430045.1 polymerase (DNA directed), lambda ENST00000331272.6 split hand/foot malformation (ectrodactyly) type 3 ENST00000470093.1 split hand/foot malformation (ectrodactyly) type 3 ENST00000482428.1 split hand/foot malformation (ectrodactyly) type 3 ENST00000457105.1 split hand/foot malformation (ectrodactyly) type 3 ENST00000431477.1 split hand/foot malformation (ectrodactyly) type 3 ENST00000489578.1 split hand/foot malformation (ectrodactyly) type 3 ENST00000458489.1 putative novel transcript ENST00000344255.3 fibroblast growth factor 8 (androgen-induced) ENST00000485728.1 fibroblast growth factor 8 (androgen-induced) ENST00000320185.2 fibroblast growth factor 8 (androgen-induced) ENST00000346714.3 fibroblast growth factor 8 (androgen-induced) ENST00000469792.1 fibroblast growth factor 8 (androgen-induced) ENST00000347978.2 fibroblast growth factor 8 (androgen-induced) ENST00000370110.5 nucleophosmin/nucleoplasmin, 3 ENST00000474993.1 nucleophosmin/nucleoplasmin, 3 ENST00000462391.1 nucleophosmin/nucleoplasmin, 3 ENST00000468544.1 nucleophosmin/nucleoplasmin, 3 ENST00000361464.3 meningioma expressed antigen 5 (hyaluronidase) ENST00000357797.4 meningioma expressed antigen 5 (hyaluronidase) ENST00000462994.1 meningioma expressed antigen 5 (hyaluronidase) ENST00000482611.1 meningioma expressed antigen 5 (hyaluronidase) ENST00000494347.1 meningioma expressed antigen 5 (hyaluronidase) ENST00000479811.1 meningioma expressed antigen 5 (hyaluronidase) ENST00000461645.1 meningioma expressed antigen 5 (hyaluronidase) ENST00000476030.1 FLJ10126 ENST00000492204.1 meningioma expressed antigen 5 (hyaluronidase) ENST00000370094.3 meningioma expressed antigen 5 (hyaluronidase) ENST00000429860.1 meningioma expressed antigen 5 (hyaluronidase) ENST00000437697.1 putative novel transcript ENST00000412353.1 novel transcript ENST00000348850.5 Kv channel interacting protein 2 ENST00000355657.2 Kv channel interacting protein 2 ENST00000370059.4 Kv channel interacting protein 2 ENST00000356640.2 Kv channel interacting protein 2 ENST00000460388.1 Kv channel interacting protein 2 ENST00000370046.1 Kv channel interacting protein 2 ENST00000472764.1 Kv channel interacting protein 2 ENST00000434163.1 Kv channel interacting protein 2 ENST00000353068.3 Kv channel interacting protein 2 ENST00000461105.1 Kv channel interacting protein 2 ENST00000343195.4 Kv channel interacting protein 2 ENST00000239117.3 Kv channel interacting protein 2 ENST00000468905.1 Kv channel interacting protein 2 ENST00000483385.1 Kv channel interacting protein 2 ENST00000370033.4 novel protein (FLJ13114) ENST00000495001.1 novel transcript (FLJ40653) ENST00000456149.1 novel protein ENST00000311122.5 novel protein ENST00000470043.1 novel transcript ENST00000448532.1 transcription elongation factor B (SIII), polypeptide 1 pseudogene ENST00000454105.1 transcription elongation factor B (SIII) pseudogene ENST00000361198.5 LIM domain binding 1 ENST00000461873.1 LIM domain binding 1 ENST00000490751.1 LIM domain binding 1 ENST00000440123.1 putative novel transcript ENST00000278070.2 novel protein (KIAA0595) ENST00000370012.1 novel protein ENST00000489648.1 novel transcript ENST00000462933.1 novel transcript ENST00000495914.1 novel transcript ENST00000370007.4 nucleolar and coiled-body phosphoprotein 1 ENST00000488254.1 nucleolar and coiled-body phosphoprotein 1 ENST00000461421.1 nucleolar and coiled-body phosphoprotein 1 ENST00000476468.1 nucleolar and coiled-body phosphoprotein 1 ENST00000464969.1 nucleolar and coiled-body phosphoprotein 1 ENST00000477977.1 nucleolar and coiled-body phosphoprotein 1 ENST00000369983.3 golgi-specific brefeldin A resistance factor 1 ENST00000369983.3 continued from bA346A7.1 in Em:AL356420 ENST00000476019.1 novel transcript ENST00000369966.3 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) ENST00000471698.1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) ENST00000467116.1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) ENST00000189444.5 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) ENST00000473400.1 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) ENST00000020673.5 pleckstrin and Sec7 domain protein ENST00000479172.1 pleckstrin and Sec7 domain protein ENST00000473507.1 pleckstrin and Sec7 domain protein ENST00000461698.1 pleckstrin and Sec7 domain protein ENST00000488194.1 pleckstrin and Sec7 domain protein ENST00000466551.1 pleckstrin and Sec7 domain protein ENST00000472685.1 pleckstrin and Sec7 domain protein ENST00000492902.1 pleckstrin and Sec7 domain protein ENST00000369956.2 novel protein ENST00000465409.1 novel protein ENST00000369937.4 novel protein ENST00000486762.1 novel transcript ENST00000477994.1 novel transcript ENST00000494270.1 novel transcript ENST00000239125.1 novel protein ENST00000473970.1 novel transcript ENST00000492465.1 novel transcript ENST00000369930.1 novel protein (FLJ22529) ENST00000469294.1 novel transcript ENST00000483550.1 novel transcript ENST00000421225.1 novel transcript ENST00000416612.1 novel transcript ENST00000450947.1 novel transcript ENST00000421873.1 novel transcript ENST00000428200.1 novel transcript ENST00000419871.1 novel transcript ENST00000369905.4 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ENST00000470322.1 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ENST00000487599.1 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ENST00000494549.1 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ENST00000480947.1 ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ENST00000369902.3 continued from bA18I14.10.1 in Em:AL121928 ENST00000369902.3 continued from bA170J3.1.1 in Em:AL157386 ENST00000369902.3 suppressor of fused homolog (Drosophila) ENST00000369899.2 continued from bA18I14.10.4 in Em:AL121928 ENST00000369899.2 suppressor of fused homolog (Drosophila) ENST00000369899.2 continued from bA170J3.1.4 in Em:AL157386 ENST00000423559.2 continued from bA170J3.1.3 in Em:AL157386 ENST00000423559.2 suppressor of fused homolog (Drosophila) ENST00000471000.1 continued from bA170J3.1.5 in Em:AL157386 ENST00000471000.1 suppressor of fused homolog (Drosophila) ENST00000440453.1 60S ribosomal protein L23a (RPL23A) pseudogene ENST00000369896.1 tripartite motif-containing 8 ENST00000462202.1 novel transcript ENST00000487927.1 novel transcript ENST00000479004.1 novel transcript ENST00000260746.4 ADP-ribosylation factor-like 3 ENST00000369893.4 sideroflexin 2 ENST00000459894.1 sideroflexin 2 ENST00000473178.1 sideroflexin 2 ENST00000480358.1 sideroflexin 2 ENST00000489268.1 FLJ36787 ENST00000426243.1 unactive progesterone receptor, 23 kD (TEBP) pseudogene ENST00000339834.5 NP_653192.2 ENST00000369883.3 alternative 3' UTR ENST00000438729.1 ribosomal protein L22 (RPL22) pseudogene ENST00000404739.3 5'-nucleotidase, cytosolic II ENST00000461461.1 novel transcript ENST00000458345.1 novel protein ENST00000369839.3 TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa ENST00000309579.3 DKFZp566D211 ENST00000369797.3 programmed cell death 11 ENST00000493610.1 novel transcript ENST00000471061.1 novel transcript ENST00000490787.1 novel transcript ENST00000466959.1 novel transcript ENST00000478543.1 novel transcript ENST00000369788.3 FLJ12133 ENST00000494180.1 novel transcript ENST00000463878.1 novel transcript ENST00000480642.1 novel transcript ENST00000461631.1 novel transcript ENST00000474797.1 novel transcript ENST00000411906.1 putative novel transcript ENST00000329905.5 novel protein ENST00000369783.4 novel protein ENST00000453753.1 novel transcript ENST00000447820.1 novel transcript ENST00000369780.4 neuralized-like (Drosophila) ENST00000437579.1 neuralized-like (Drosophila) ENST00000455386.1 neuralized-like (Drosophila) ENST00000457120.1 putative novel transcript ENST00000315994.5 KIAA0418 ENST00000420222.1 FLJ31907 ENST00000224950.3 FLJ22559 ENST00000369764.1 FLJ22559 ENST00000335753.4 KIAA0204 ENST00000474260.1 novel transcript ENST00000353479.5 NP_000485 ENST00000433822.1 alternative 3' UTR ENST00000457071.1 FLJ36006 ENST00000434629.1 DKFZp434L086 ENST00000278064.2 FLJ22944 ENST00000369720.1 DKFZp434P078 ENST00000369719.1 FLJ22944 ENST00000470554.1 novel transcript ENST00000493946.1 novel transcript ENST00000369713.5 glutathione transferase omega 1 (GSTO1) ENST00000445155.1 novel protein ENST00000369708.1 novel glutathione-S-transferase (LOC119391) ENST00000473401.1 novel transcript ENST00000477078.1 novel transcript ENST00000369707.1 novel glutathione-S-transferase (LOC119391) ENST00000467629.1 novel transcript ENST00000498052.1 novel transcript ENST00000337478.1 novel protien (KIAA1754) ENST00000472915.1 novel transcript ENST00000358187.2 novel protien (KIAA1754) ENST00000358187.2 alternative 5' UTR ENST00000458723.1 novel protien (KIAA1754) ENST00000458723.1 alternative 5' UTR ENST00000434792.1 novel transcript ENST00000435434.1 putative novel transcript ENST00000369704.3 novel protein ENST00000369704.3 novel protein (FLJ35908) ENST00000369703.1 novel protein ENST00000447860.1 novel transcript ENST00000450054.1 putative novel transcript ENST00000369701.3 VPS10 domain receptor protein SORCS 3 (SORCS3) ENST00000393176.2 VPS10 domain receptor protein SORCS 3 (SORCS3) ENST00000449805.1 putative novel transcript ENST00000429680.1 putative novel transcript ENST00000450091.1 peptidylprolyl isomerase A (cyclophilin A) (PPIA) pseudogene ENST00000419975.1 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (KCIP-1) (YWHAZ) pseudogene ENST00000447757.1 novel transcript ENST00000449761.1 novel transcript ENST00000424701.1 novel transcript ENST00000426752.1 novel transcript ENST00000452286.1 novel transcript ENST00000399415.2 RPL23A (60S ribosmal protein 23A) pseudogene ENST00000369698.1 VPS10 domain receptor protein SORCS 1 ENST00000263054.5 VPS10 domain receptor protein SORCS 1 ENST00000473866.1 novel transcript ENST00000452214.1 VPS10 domain receptor protein SORCS 1 ENST00000478809.1 novel transcript ENST00000486192.1 novel transcript ENST00000472196.1 novel transcript ENST00000429110.1 non-canonical donor splice site at 3rd exon ENST00000429110.1 novel transcript ENST00000425050.1 novel transcript ENST00000455109.1 unactive progesterone receptor, 23 kD (TEBP) pseudogene ENST00000366253.2 novel transcript ENST00000421481.1 putative novel transcript ENST00000431810.1 mitogen-activated protein kinase-activated protein kinase 5 (MAPKAPK5) pseudogene ENST00000434943.1 repressor of estrogen receptor activity (BAP) (REA) pseudogene ENST00000455606.1 basic transcription factor 3, like 1 (OPG, OCIF, HUMBTFB, TNFRSF11B) (BTF3L1) pseudogene ENST00000429231.1 ribosomal protein L21 (RPL21) pseudogene ENST00000502935.1 NP_065116.3 ENST00000494499.1 X-prolyl aminopeptidase (aminopeptidase P) 1, soluble (SAMP, XPNPEP, XPNPEPL) ENST00000494564.1 X-prolyl aminopeptidase (aminopeptidase P) 1, soluble (SAMP, XPNPEP, XPNPEPL) ENST00000460055.1 X-prolyl aminopeptidase (aminopeptidase P) 1, soluble (SAMP, XPNPEP, XPNPEPL) ENST00000460523.1 X-prolyl aminopeptidase (aminopeptidase P) 1, soluble (SAMP, XPNPEP, XPNPEPL) ENST00000475123.1 X-prolyl aminopeptidase (aminopeptidase P) 1, soluble (SAMP, XPNPEP, XPNPEPL) ENST00000369657.1 novel protein ENST00000369655.1 novel protein ENST00000468251.1 adducin 3 (gamma) ENST00000360162.3 adducin 3 (gamma) ENST00000356080.4 adducin 3 (gamma) ENST00000277900.8 adducin 3 (gamma) ENST00000480344.1 adducin 3 (gamma) ENST00000484622.1 adducin 3 (gamma) ENST00000487085.1 adducin 3 (gamma) ENST00000459738.1 adducin 3 (gamma) ENST00000495661.1 adducin 3 (gamma) ENST00000497125.1 adducin 3 (gamma) ENST00000475954.1 adducin 3 (gamma) ENST00000496517.1 adducin 3 (gamma) ENST00000468345.1 adducin 3 (gamma) ENST00000473669.1 adducin 3 (gamma) ENST00000486014.1 adducin 3 (gamma) ENST00000462926.1 adducin 3 (gamma) ENST00000488104.1 adducin 3 (gamma) ENST00000488837.1 adducin 3 (gamma) ENST00000472568.1 adducin 3 (gamma) ENST00000492162.1 adducin 3 (gamma) ENST00000488799.1 adducin 3 (gamma) ENST00000479805.1 adducin 3 (gamma) ENST00000449481.1 small nuclear ribonucleoprotein polypeptide G (SNRPG) pseudogene ENST00000332674.5 MAX interacting protein 1 (MAD2,MXD2) ENST00000453116.1 MAX interacting protein 1 (MAD2,MXD2) ENST00000361248.4 MAX interacting protein 1 (MAD2,MXD2) ENST00000239007.7 MAX interacting protein 1 (MAD2,MXD2) ENST00000460667.1 MAX interacting protein 1 (MAD2,MXD2) ENST00000393134.1 MAX interacting protein 1 (MAD2,MXD2) ENST00000369614.1 MAX interacting protein 1 (MAD2,MXD2) ENST00000369613.1 MAX interacting protein 1 (MAD2,MXD2) ENST00000484030.1 MAX interacting protein 1 (MAD2,MXD2) ENST00000442296.1 MAX interacting protein 1 (MAD2,MXD2) ENST00000485566.1 MAX interacting protein 1 (MAD2,MXD2) ENST00000369612.1 MAX interacting protein 1 (MAD2,MXD2) ENST00000451656.1 putative novel transcript ENST00000397433.2 ribosomal protein L21 (RPL21) pseudogene ENST00000369603.4 splicing factor 30, survival of motor neuron-related (SPF30)(SMNR) ENST00000369592.1 splicing factor 30, survival of motor neuron-related (SPF30)(SMNR) ENST00000460483.1 novel transcript ENST00000471297.1 novel transcript ENST00000477763.1 novel transcript ENST00000445730.1 novel transcript ENST00000428894.1 high-mobility group box 3 (HMGB3) pseudogene ENST00000476681.1 dual specificity phosphatase 5 (HVH3) ENST00000468749.1 dual specificity phosphatase 5 (HVH3) ENST00000456985.1 putative novel transcript ENST00000446943.1 ribosomal protein L7 (RPL7) pseudogene ENST00000361804.4 chondroitin sulfate proteoglycan 6 (bamacan)(BAM, HCAP, SMC3, SMC3L1) ENST00000462899.1 chondroitin sulfate proteoglycan 6 (bamacan)(BAM, HCAP, SMC3, SMC3L1) ENST00000416249.1 putative novel transcript ENST00000420367.1 putative novel transcript ENST00000280154.7 programmed cell death 4 (neoplastic transformation inhibitor)(H731, MGC33046, MGC33047) ENST00000467574.1 programmed cell death 4 (neoplastic transformation inhibitor)(H731, MGC33046, MGC33047) ENST00000483670.1 programmed cell death 4 (neoplastic transformation inhibitor)(H731, MGC33046, MGC33047) ENST00000444997.1 programmed cell death 4 (neoplastic transformation inhibitor)(H731, MGC33046, MGC33047) ENST00000492932.1 programmed cell death 4 (neoplastic transformation inhibitor)(H731, MGC33046, MGC33047) ENST00000481353.1 programmed cell death 4 (neoplastic transformation inhibitor)(H731, MGC33046, MGC33047) ENST00000462577.1 programmed cell death 4 (neoplastic transformation inhibitor)(H731, MGC33046, MGC33047) ENST00000489049.1 programmed cell death 4 (neoplastic transformation inhibitor)(H731, MGC33046, MGC33047) ENST00000483595.1 programmed cell death 4 (neoplastic transformation inhibitor)(H731, MGC33046, MGC33047) ENST00000498367.1 programmed cell death 4 (neoplastic transformation inhibitor)(H731, MGC33046, MGC33047) ENST00000369452.4 soc-2 suppressor of clear homolog (C. elegans)(SOC2, SUR8, SOC-2, SUR-8, KIAA0862, SIAA0862) ENST00000480155.1 soc-2 suppressor of clear homolog (C. elegans)(SOC2, SUR8, SOC-2, SUR-8, KIAA0862, SIAA0862) ENST00000489390.1 soc-2 suppressor of clear homolog (C. elegans)(SOC2, SUR8, SOC-2, SUR-8, KIAA0862, SIAA0862) ENST00000489783.1 soc-2 suppressor of clear homolog (C. elegans)(SOC2, SUR8, SOC-2, SUR-8, KIAA0862, SIAA0862) ENST00000451838.1 soc-2 suppressor of clear homolog (C. elegans)(SOC2, SUR8, SOC-2, SUR-8, KIAA0862, SIAA0862) ENST00000497305.1 soc-2 suppressor of clear homolog (C. elegans)(SOC2, SUR8, SOC-2, SUR-8, KIAA0862, SIAA0862) ENST00000424331.1 HSPC023 protein (HSPC023) pseudogene ENST00000441962.1 novel pseudogene similar to part of FLJ10648 ENST00000421597.1 putative novel transcript ENST00000431996.1 ribosomal protein S6 (RPS6) pseudogene ENST00000348367.4 glycerol 3-phosphate acyltransferase, mitochondrial (KIAA1560) (GPAM, MGC26846) ENST00000369425.1 glycerol 3-phosphate acyltransferase, mitochondrial (KIAA1560) (GPAM, MGC26846) ENST00000480130.1 novel transcript ENST00000498541.1 novel transcript ENST00000369422.3 tectorin beta ENST00000494328.1 tectorin beta ENST00000479705.1 guanylate cyclase type protein pseudogene ENST00000354655.4 fatty-acid-Coenzyme A ligase, long-chain 5 ENST00000354655.4 alternatively spliced 5' UTR shares CDS with bA324O2.2.1 ENST00000354655.4 alternative 5' UTR ENST00000479936.1 this variant and one or more of variant fragments .2.4 and .2.5 could be part of a single variant ENST00000479936.1 fatty-acid-Coenzyme A ligase, long-chain 5 ENST00000354273.4 fatty-acid-Coenzyme A ligase, long-chain 5 ENST00000495539.1 fatty-acid-Coenzyme A ligase, long-chain 5 ENST00000495539.1 this variant and one or more of variant fragments .2.3 and .2.5 could be part of a single variant ENST00000467340.1 fatty-acid-Coenzyme A ligase, long-chain 5 ENST00000496328.1 fatty-acid-Coenzyme A ligase, long-chain 5 ENST00000496328.1 this variant and one or more of variant fragments .2.3 and .2.4 could be part of a single variant ENST00000449782.1 novel transcript ENST00000424422.1 novel transcript ENST00000369405.3 zinc finger, DHHC domain containing 6 ENST00000369404.3 zinc finger, DHHC domain containing 6 ENST00000482410.1 zinc finger, DHHC domain containing 6 ENST00000471035.1 zinc finger, DHHC domain containing 6 ENST00000483122.1 vesicle transport through interaction with t-SNAREs homolog 1A (yeast), variant 2, FLJ38157 ENST00000472892.1 vesicle transport through interaction with t-SNAREs homolog 1A (yeast) ENST00000489142.1 vesicle transport through interaction with t-SNAREs homolog 1A (yeast) ENST00000496445.1 vesicle transport through interaction with t-SNAREs homolog 1A (yeast) ENST00000494728.1 vesicle transport through interaction with t-SNAREs homolog 1A (yeast) ENST00000489357.1 vesicle transport through interaction with t-SNAREs homolog 1A (yeast) ENST00000480057.1 vesicle transport through interaction with t-SNAREs homolog 1A (yeast) ENST00000430685.1 pseudogene similar to part of eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) ENST00000443652.1 novel transcript ENST00000420207.1 putative novel transcript ENST00000428766.1 novel transcript ENST00000369397.4 transcription factor 7-like 2 (T-cell specific, HMG-box) ENST00000349937.2 transcription factor 7-like 2 (T-cell specific, HMG-box) ENST00000369395.1 transcription factor 7-like 2 (T-cell specific, HMG-box) ENST00000346198.4 transcription factor 7-like 2 (T-cell specific, HMG-box) ENST00000369389.1 transcription factor 7-like 2 (T-cell specific, HMG-box) ENST00000277945.7 transcription factor 7-like 2 (T-cell specific, HMG-box) ENST00000369386.1 transcription factor 7-like 2 (T-cell specific, HMG-box) ENST00000466338.1 transcription factor 7-like 2 (T-cell specific, HMG-box) ENST00000470254.1 transcription factor 7-like 2 (T-cell specific, HMG-box) ENST00000480888.1 transcription factor 7-like 2 (T-cell specific, HMG-box) ENST00000471569.1 transcription factor 7-like 2 (T-cell specific, HMG-box) ENST00000476887.1 transcription factor 7-like 2 (T-cell specific, HMG-box) ENST00000494353.1 transcription factor 7-like 2 (T-cell specific, HMG-box) ENST00000369391.3 putative novel transcript ENST00000420976.1 ribosomal protein S15 (RPS15) pseudogene ENST00000420773.1 putative novel transcript (FLJ21484) ENST00000415988.1 FK506 binding protein 1B (FKBP1B) pseudogene ENST00000351270.3 novel protein similar to HGF activator (HGFAC) ENST00000369358.3 nebulin-related anchoring protein ENST00000369360.3 nebulin-related anchoring protein ENST00000369350.1 nebulin-related anchoring protein ENST00000429617.1 caspase 7, apoptosis-related cysteine protease ENST00000369331.3 caspase 7, apoptosis-related cysteine protease ENST00000345633.4 caspase 7, apoptosis-related cysteine protease ENST00000369318.3 caspase 7, apoptosis-related cysteine protease ENST00000369316.1 caspase 7, apoptosis-related cysteine protease ENST00000369315.1 caspase 7, apoptosis-related cysteine protease ENST00000468790.1 caspase 7, apoptosis-related cysteine protease ENST00000487232.1 caspase 7, apoptosis-related cysteine protease ENST00000448834.1 novel transcript ENST00000369310.3 novel protein ENST00000369309.1 novel protein (FLJ23537 version 1) ENST00000354462.3 novel protein (FLJ23537 version 2) ENST00000369305.1 DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae) ENST00000361384.2 DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae) ENST00000476112.1 DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae) ENST00000369301.3 novel NHL repeat domain containing protein (FLJ33312, FLJ25621, DKFZp313F0131, FLJ30653, FLJ36994, FLJ20147) ENST00000369301.3 novel NHL repeat domain containing protein (FLJ33312) ENST00000369301.3 novel NHL repeat domain containing protein (FLJ33312, FLJ25621) ENST00000468890.1 putative novel transcript ENST00000440070.1 ubiquitin-conjugating enzyme E2 variant 1 (UBE2V1) pseudogene ENST00000369287.3 CTCL tumor antigen L14-2 (FLJ10188, DKFZp762M1412, FLJ32946, FLJ37179, FLJ21086) ENST00000428953.1 CTCL tumor antigen L14-2 (FLJ32946) ENST00000497592.1 CTCL tumor antigen L14-2 ENST00000490661.1 CTCL tumor antigen L14-2 ENST00000369286.1 CTCL tumor antigen L14-2 ENST00000369285.3 CTCL tumor antigen L14-2 (FLJ35301) ENST00000369282.1 tudor domain containing 1 ENST00000369280.1 tudor domain containing 1 ENST00000392982.3 novel von Willebrand factor type A domain containing protein ENST00000454983.1 serine/threonine kinase 6 (STK6) pseudogene ENST00000369271.3 novel protein (FLJ14564) ENST00000304129.4 novel protein (FLJ14564) ENST00000491814.1 novel transcript (KIAA1914) ENST00000481462.1 novel transcript ENST00000486300.1 novel transcript ENST00000419268.1 novel protein ENST00000483496.1 novel transcript ENST00000336585.6 actin binding LIM protein 1 ENST00000369252.4 actin binding LIM protein 1 ENST00000392955.2 actin binding LIM protein 1 ENST00000392952.3 actin binding LIM protein 1 ENST00000369257.1 actin binding LIM protein 1 ENST00000369256.1 actin binding LIM protein 1 ENST00000277895.4 actin binding LIM protein 1 ENST00000369253.1 actin binding LIM protein 1 ENST00000485570.1 actin binding LIM protein 1 ENST00000440467.1 actin binding LIM protein 1 ENST00000428430.1 actin binding LIM protein 1 ENST00000466400.1 actin binding LIM protein 1 ENST00000481974.1 actin binding LIM protein 1 ENST00000477638.1 actin binding LIM protein 1 ENST00000412744.1 pseudogene similar to part of small nuclear ribonucleoprotein polypeptide B (SNRPB2) ENST00000436932.1 novel transcript ENST00000400856.2 TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 31kDa (TAF9L) pseudogene ENST00000369248.4 novel protein (KIAA1600) ENST00000369250.3 novel protein (KIAA1600) ENST00000369246.1 novel protein ENST00000411414.1 novel protein (KIAA1600) ENST00000414329.1 ribosomal protein L15 (RPL15) pseudogene ENST00000298746.3 TruB pseudouridine (psi) synthase homolog 1 (E. coli) ENST00000485065.1 TruB pseudouridine (psi) synthase homolog 1 (E. coli) ENST00000433085.1 putative novel transcript ENST00000369236.1 GDNF family receptor alpha 1 ENST00000355422.5 alternatively spliced 5' UTR shares CDS with Em:AC012470.1.1 ENST00000355422.5 GDNF family receptor alpha 1 ENST00000355422.5 alternative 5' UTR ENST00000369234.3 alternatively spliced 5' UTR shares CDS with Em:AC012470.1.1 ENST00000369234.3 GDNF family receptor alpha 1 ENST00000369234.3 alternative 5' UTR ENST00000490345.1 GDNF family receptor alpha 1 ENST00000333254.3 novel protein ENST00000423072.1 novel protein ENST00000451124.1 small nuclear ribonucleoprotein polypeptide G (SNRPG) pseudogene ENST00000369230.3 novel protein (LOC119548) ENST00000481306.1 novel transcript ENST00000449709.1 HMG-1 pseudogene ENST00000369221.2 pancreatic lipase ENST00000470562.1 pancreatic lipase ENST00000439233.1 pseudogene similar to part of pancreatic lipase (PNLIP) ENST00000531984.1 alternative 5' UTR ENST00000482159.1 pancreatic lipase-related protein 1 ENST00000528052.1 alternative 5' UTR ENST00000471549.1 alternative 5' UTR ENST00000534537.1 not organism-supported ENST00000444825.1 pancreatic lipase-related protein 2 ENST00000429325.1 pancreatic lipase-related protein 2 ENST00000431527.1 pancreatic lipase-related protein 2 ENST00000298771.6 There is a SNP (rs4751995) in exon 11 which causes a premature stop ENST00000369210.3 novel protein (MGC33547) ENST00000467153.1 novel transcript ENST00000433600.1 novel transcript ENST00000369209.3 novel protein (KIAA0417) ENST00000480802.1 this variant and one or more of variant fragments .6.3 and .6.4 could be part of a single variant ENST00000480802.1 novel transcript ENST00000481291.1 this variant and one or more of variant fragments .6.2 and .6.4 could be part of a single variant ENST00000481291.1 novel transcript ENST00000468935.1 this variant and one or more of variant fragments .6.2 and .6.3 could be part of a single variant ENST00000468935.1 novel transcript ENST00000437011.1 ribosomal protein L5 (RPL5) pseudogene ENST00000453491.1 putative novel transcript ENST00000434227.1 putative novel transcript ENST00000369207.1 novel protein ENST00000512864.1 putative novel transcript ENST00000260777.10 novel protein (KIAA1598) ENST00000497044.1 novel transcript, variant 2 (FLJ34259) ENST00000469231.1 novel transcript, variant 3 (FLJ34062) ENST00000490615.1 novel transcript ENST00000451232.1 novel pseudogene ENST00000369206.4 not organism-supported ENST00000419373.1 putative novel transcript ENST00000452430.1 ribosomal protein L12 (RPL12) pseudogene ENST00000425264.1 novel transcript ENST00000298472.5 solute carrier family 18 (vesicular monoamine), member 2 ENST00000497497.1 solute carrier family 18 (vesicular monoamine), member 2 ENST00000334464.5 novel protein (LOC118987) ENST00000482496.1 novel transcript ENST00000489302.1 novel transcript ENST00000489491.1 novel transcript ENST00000412075.1 novel transcript ENST00000424371.1 novel transcript ENST00000450314.1 novel transcript ENST00000440007.1 novel transcript ENST00000423419.1 novel transcript ENST00000450247.1 novel transcript ENST00000445647.1 putative novel transcript ENST00000355624.3 rab11-family interacting protein 2 (Rab11-FIP2) (KIAA0941) ENST00000476207.1 novel transcript ENST00000483413.1 novel transcript ENST00000451610.1 novel transcript ENST00000417968.1 novel transcript ENST00000414722.1 novel transcript ENST00000435944.1 novel transcript ENST00000426021.1 novel transcript (FLJ30622) ENST00000454781.1 novel transcript ENST00000454857.1 novel transcript ENST00000439517.1 novel transcript ENST00000431695.1 novel transcript ENST00000436975.1 novel transcript ENST00000436430.1 novel transcript ENST00000413810.1 novel transcript ENST00000369183.4 novel protein (FLJ13188) ENST00000488152.1 novel transcript ENST00000491416.1 novel transcript ENST00000470476.1 novel protein ENST00000469758.1 novel transcript ENST00000369172.4 alternatively spliced in 5' UTR, shares CDS with bA319I23.1.1 ENST00000369172.4 novel protein ENST00000369172.4 alternative 5' UTR ENST00000469780.1 novel transcript ENST00000369170.4 novel protein ENST00000369170.4 alternatively spliced in 5' UTR, shares partial CDS with bA319I23.1.1 ENST00000369170.4 alternative 5' UTR ENST00000490048.1 novel transcript ENST00000487269.1 novel transcript ENST00000452252.1 novel transcript ENST00000445161.1 novel transcript ENST00000411666.1 novel transcript ENST00000453236.1 novel transcript ENST00000415417.1 novel transcript ENST00000449385.1 pseudogene similar to part of solute carrier family 25, (mitochondrial carrier), member 18 (SLC25A18) ENST00000369169.1 G protein-coupled receptor 10 (GR3, PrRPR) ENST00000416399.1 translocase of outer mitochondrial membrane 22 homolog (yeast) (TOM22) (TOMM22) pseudogene ENST00000369156.1 non-canonical acceptor splice site at 2nd exon ENST00000369156.1 N-terminal extension of 95 amino acids not present in translation of Em:AK097728.1 ENST00000369156.1 novel protein (MGC33215) ENST00000483833.1 non-canonical donor splice site a 1st exon ENST00000483833.1 novel transcript ENST00000493518.1 novel protein (MGC33215) ENST00000490610.1 novel transcript ENST00000489169.1 novel transcript ENST00000481360.1 novel transcript ENST00000477583.1 novel transcript ENST00000420302.1 ribosomal protein L17 (RPL17) pseudogene ENST00000394996.2 pseudogene similar to part of lactate dehydrogenase A (LDH1) (LDHD) ENST00000437838.1 putative novel transcript ENST00000340087.5 nanos 1 (LOC340719) ENST00000450645.1 putative novel transcript ENST00000369144.3 eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa (P167, EIF3A, KIAA0139, eIF3-p170,eIF3-theta) ENST00000478852.1 non-canonical donor splice site at 2nd exon and acceptor splice site at 3rd exon ENST00000478852.1 eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa (P167, EIF3A, KIAA0139, eIF3-p170,eIF3-theta) ENST00000486248.1 eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa (P167, EIF3A, KIAA0139, eIF3-p170,eIF3-theta) ENST00000462527.1 eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa (P167, EIF3A, KIAA0139, eIF3-p170,eIF3-theta) ENST00000472379.1 novel transcript ENST00000497903.1 novel transcript ENST00000493766.1 novel transcript ENST00000487888.1 novel transcript ENST00000361432.2 novel protein similar to uncharacterized hypothalamus protein HT011 ENST00000461435.1 novel transcript ENST00000448258.2 novel transcript ENST00000489988.1 novel transcript ENST00000498549.1 novel transcript ENST00000462327.1 novel transcript ENST00000489936.1 novel transcript ENST00000490417.1 novel protein ENST00000355697.2 novel protein ENST00000484960.1 novel transcript ENST00000461438.1 novel protein ENST00000369131.4 novel protein ENST00000466218.1 novel transcript ENST00000419372.1 novel protein ENST00000462913.1 novel transcript ENST00000298510.2 peroxiredoxin 3 (AOP1, MER5, AOP-1, SP-22) ENST00000494433.1 peroxiredoxin 3 (AOP1, MER5, AOP-1, SP-22) ENST00000463322.1 peroxiredoxin 3 (AOP1, MER5, AOP-1, SP-22) ENST00000369106.1 G protein-coupled receptor kinase 5 (GRK5) ENST00000392870.2 G protein-coupled receptor kinase 5 (GRK5) ENST00000473264.1 G protein-coupled receptor kinase 5 (GRK5) ENST00000421206.1 putative novel transcript ENST00000457948.1 putative novel transcript ENST00000369103.2 regulator of G-protein signalling 10 ENST00000369101.3 regulator of G-protein signalling 10 ENST00000469575.1 regulator of G-protein signalling 10 ENST00000473563.1 regulator of G-protein signalling 10 ENST00000448423.1 putative novel trancript ENST00000369093.2 TIA1 cytotoxic granule-associated RNA binding protein-like 1 ENST00000463089.1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 ENST00000489822.1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 ENST00000497671.1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 ENST00000470781.1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 ENST00000436547.2 TIA1 cytotoxic granule-associated RNA binding protein-like 1 ENST00000369087.1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 ENST00000495821.1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 ENST00000470635.1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 ENST00000412524.1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 ENST00000369086.1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 ENST00000462373.1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 ENST00000479729.1 TIA1 cytotoxic granule-associated RNA binding protein-like 1 ENST00000231383.8 pseudogene similar to RAD1 homolog isoform 2 ENST00000454541.1 ribosomal protein S8 (RPS8) pseudogene ENST00000369085.3 BCL2-associated athanogene 3 ENST00000450186.1 BCL2-associated athanogene 3 ENST00000436838.1 putative novel transcript ENST00000433708.1 putative novel transcript ENST00000441872.1 thioredoxin 1 pseudogene 2 (LOC93202) ENST00000361976.2 Sac domain-containing inositol phosphatase 2 ENST00000369081.1 Sac domain-containing inositol phosphatase 2 ENST00000369080.3 Sac domain-containing inositol phosphatase 2 ENST00000490818.1 Sac domain-containing inositol phosphatase 2 ENST00000360003.3 novel protein (FLJ13081) ENST00000369077.3 novel protein (FLJ13081) ENST00000466047.1 novel protein (FLJ13081) ENST00000495407.1 novel protein (FLJ13081) ENST00000369075.3 SEC23 interacting protein ENST00000470478.1 SEC23 interacting protein ENST00000442952.1 SEC23 interacting protein ENST00000446561.1 SEC23 interacting protein ENST00000462222.1 SEC23 interacting protein ENST00000475542.1 SEC23 interacting protein ENST00000483890.1 SEC23 interacting protein ENST00000444568.1 putative novel transcript ENST00000318548.6 nascent-polypeptide-associated complex alpha polypeptide (NACA) pseudogene ENST00000425391.1 ribosomal protein L3 (RPL3) pseudogene ENST00000411599.1 novel transcript ENST00000495531.1 ribosomal protein L21 (RPL21) pseudogene ENST00000447093.1 spermatogenesis associated 7 (SPATA7) pseudogene ENST00000427079.1 novel protein (LOC196051) ENST00000369073.3 novel protein (LOC196051) ENST00000496437.1 novel transcript ENST00000369071.2 novel protein (LOC283088) ENST00000456120.1 novel transcript ENST00000451706.1 novel transcript ENST00000263461.5 WD repeat domain 11 ENST00000470052.1 WD repeat domain 11 ENST00000497136.1 WD repeat domain 11 ENST00000462529.1 WD repeat domain 11 ENST00000478567.1 WD repeat domain 11 ENST00000414774.1 putative novel transcript ENST00000433839.1 ribosomal protein L19 (RPL19) pseudogene ENST00000429809.1 putative novel transcript ENST00000358487.5 non canonical conserved ENST00000358487.5 upstream_ATG-19 ENST00000478859.1 fibroblast growth factor receptor 2 ENST00000478859.1 non canonical conserved ENST00000356226.4 upstream_ATG-19 ENST00000369060.4 upstream_ATG-19 ENST00000369059.1 non canonical conserved ENST00000369059.1 upstream_ATG-19 ENST00000467584.1 fibroblast growth factor receptor 2 ENST00000429361.1 non canonical conserved ENST00000346997.2 fibroblast growth factor receptor 2 ENST00000457416.2 non canonical conserved ENST00000457416.2 upstream_ATG-19 ENST00000360144.3 non canonical conserved ENST00000360144.3 upstream_ATG-19 ENST00000369056.1 non canonical conserved ENST00000369058.3 non canonical conserved ENST00000369058.3 upstream_ATG-19 ENST00000336553.6 upstream_ATG-19 ENST00000463870.1 fibroblast growth factor receptor 2 ENST00000490349.1 fibroblast growth factor receptor 2 ENST00000359354.2 variant 14 ENST00000359354.2 upstream_ATG-19 ENST00000491475.1 fibroblast growth factor receptor 2 ENST00000491111.1 fibroblast growth factor receptor 2 ENST00000434988.1 putative novel transcript ENST00000447943.1 novel transcript ENST00000369043.3 arginyltransferase 1 ENST00000423243.1 arginyltransferase 1 ENST00000485281.1 arginyltransferase 1 ENST00000470613.1 arginyltransferase 1 ENST00000481784.1 arginyltransferase 1 ENST00000455628.1 arginyltransferase 1 ENST00000437593.1 putative novel transcript ENST00000369023.3 novel protein (FLJ20003) ENST00000477289.1 putative novel transcript ENST00000492346.1 novel transcript ENST00000459911.1 putative novel transcript ENST00000489266.1 novel transcript ENST00000468209.1 novel transcript ENST00000483541.1 novel transcript ENST00000482078.1 novel transcript ENST00000369017.5 novel protein ENST00000464321.1 novel transcript ENST00000481320.1 novel transcript ENST00000472431.1 novel transcript ENST00000465189.1 novel transcript ENST00000492689.1 transforming, acidic coiled-coil containing protein 2 (AZU-1) ENST00000498721.1 transforming, acidic coiled-coil containing protein 2 (AZU-1) ENST00000489754.1 transforming, acidic coiled-coil containing protein 2 (AZU-1) ENST00000491540.1 transforming, acidic coiled-coil containing protein 2 (AZU-1) ENST00000493951.1 transforming, acidic coiled-coil containing protein 2 (AZU-1) ENST00000360561.3 NP_996742.1 ENST00000368999.1 transforming, acidic coiled-coil containing protein 2 (AZU-1) ENST00000260733.3 NP_008928.1 ENST00000368997.3 This was originally made as coding, but swissprot sequence O95359 isform 3 has been withdrawn ENST00000440764.2 transforming, acidic coiled-coil containing protein 2 (AZU-1) ENST00000496913.2 transforming, acidic coiled-coil containing protein 2 (AZU-1) ENST00000474201.1 transforming, acidic coiled-coil containing protein 2 (AZU-1) ENST00000490979.1 transforming, acidic coiled-coil containing protein 2 (AZU-1) ENST00000465600.1 transforming, acidic coiled-coil containing protein 2 (AZU-1) ENST00000479786.1 novel transcript ENST00000368990.3 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 ENST00000368989.1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 ENST00000409427.1 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1 ENST00000481451.1 novel transcript ENST00000420892.1 protease, serine, 11 (IGF binding) ENST00000338354.3 deleted in malignant brain tumors 1 ENST00000338354.3 Due to the repetitive nature of the exons of this locus (where the same exon can be placed at different genomic locations with 100% identity), more variants than are represented could be made (which would yield exactly the same mRNAs as the ones presented here). ENST00000368915.1 deleted in malignant brain tumors 1 ENST00000368915.1 Due to the repetitive nature of the exons of this locus (where the same exon can be placed at different genomic locations with 100% identity), more variants than are represented could be made (which would yield exactly the same mRNAs as the ones presented here). ENST00000341278.4 Due to the repetitive nature of the exons of this locus (where the same exon can be placed at different genomic locations with 100% identity), more variants than are represented could be made (which would yield exactly the same mRNAs as the ones presented here). ENST00000341278.4 deleted in malignant brain tumors 1 ENST00000368953.1 deleted in malignant brain tumors 1 ENST00000368953.1 Due to the repetitive nature of the exons of this locus (where the same exon can be placed at different genomic locations with 100% identity), more variants than are represented could be made (which would yield exactly the same mRNAs as the ones presented here). ENST00000339871.3 Due to the repetitive nature of the exons of this locus (where the same exon can be placed at different genomic locations with 100% identity), more variants than are represented could be made (which would yield exactly the same mRNAs as the ones presented here). ENST00000339871.3 deleted in malignant brain tumors 1 ENST00000368942.1 deleted in malignant brain tumors 1 ENST00000368942.1 Due to the repetitive nature of the exons of this locus (where the same exon can be placed at different genomic locations with 100% identity), more variants than are represented could be made (which would yield exactly the same mRNAs as the ones presented here). ENST00000327438.5 Due to the repetitive nature of the exons of this locus (where the same exon can be placed at different genomic locations with 100% identity), more variants than are represented could be made (which would yield exactly the same mRNAs as the ones presented here). ENST00000327438.5 deleted in malignant brain tumors 1 ENST00000344338.3 Due to the repetitive nature of the exons of this locus (where the same exon can be placed at different genomic locations with 100% identity), more variants than are represented could be made (which would yield exactly the same mRNAs as the ones presented here). ENST00000344338.3 deleted in malignant brain tumors 1 ENST00000339712.3 deleted in malignant brain tumors 1 ENST00000339712.3 Due to the repetitive nature of the exons of this locus (where the same exon can be placed at different genomic locations with 100% identity), more variants than are represented could be made (which would yield exactly the same mRNAs as the ones presented here). ENST00000330163.4 deleted in malignant brain tumors 1 ENST00000330163.4 Due to the repetitive nature of the exons of this locus (where the same exon can be placed at different genomic locations with 100% identity), more variants than are represented could be made (which would yield exactly the same mRNAs as the ones presented here). ENST00000329446.4 novel protein ENST00000432000.1 novel protein ENST00000439464.1 deleted in malignant brain tumors 1 (DMBT1) pseudogene ENST00000368904.1 estrogen regulated gene 1 (ERG-1)(UO-44) ENST00000368901.1 estrogen regulated gene 1 (ERG-1)(UO-44) ENST00000368901.1 alternatively spliced 5' UTR; shares CDS with bA107C16.2.3 and bA107C16.2.5 ENST00000368901.1 alternative 5' UTR ENST00000368900.1 estrogen regulated gene 1 (ERG-1)(UO-44) ENST00000368900.1 alternatively spliced 5' UTR; shares CDS with bA107C16.2.2 and bA107C16.2.5 ENST00000368900.1 alternative 5' UTR ENST00000338948.3 estrogen regulated gene 1 (ERG-1)(UO-44) ENST00000368899.1 estrogen regulated gene 1 (ERG-1)(UO-44) ENST00000368899.1 alternative 5' UTR ENST00000368899.1 alternatively spliced 5' UTR; shares CDS with bA107C16.2.2 and bA107C16.2.3 ENST00000368898.3 novel protein (MGC45962) ENST00000462859.1 novel transcript ENST00000368896.1 novel protein (MGC45962) ENST00000489000.1 novel transcript ENST00000368895.2 novel pseudogene similar to FLJ13490 ENST00000368894.1 novel protein ENST00000368891.5 novel transcript ENST00000481909.1 novel protein (FLJ13490) ENST00000462191.1 putative novel transcript ENST00000470158.1 novel transcript ENST00000465232.1 novel transcript ENST00000368887.3 novel protein (MGC35392) ENST00000406217.2 novel protein (MGC35392) ENST00000483455.1 novel transcript ENST00000497219.1 novel transcript ENST00000493461.1 novel transcript ENST00000483755.1 novel transcript ENST00000496079.1 novel transcript ENST00000488518.1 novel transcript ENST00000368886.5 zinc finger protein, subfamily 1A, 5 (Pegasus)(PEGASUS)(ZNFN1A5) ENST00000496605.1 novel transcript ENST00000469821.1 novel transcript ENST00000479103.1 novel transcript ENST00000358776.4 acyl-Coenzyme A dehydrogenase, short/branched chain (SBCAD) ENST00000411816.1 acyl-Coenzyme A dehydrogenase, short/branched chain (SBCAD) ENST00000496730.1 acyl-Coenzyme A dehydrogenase, short/branched chain (SBCAD) ENST00000357878.4 not organism-supported ENST00000368865.4 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) (BUB3L) ENST00000368859.1 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) (BUB3L) ENST00000368858.5 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) (BUB3L) ENST00000490143.1 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) (BUB3L) ENST00000407911.2 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) (BUB3L) ENST00000481952.1 BUB3 budding uninhibited by benzimidazoles 3 homolog (yeast) (BUB3L) ENST00000469206.1 ribosomal protein S26 (RPS26) pseudogene ENST00000448347.1 novel transcript ENST00000448671.1 novel transcript ENST00000415509.1 putative novel transcript ENST00000451295.1 novel transcript ENST00000284674.1 G protein coupled receptor 26 ENST00000241305.3 novel protein similar to carboxypeptidase X (M14 family) (CPXM) (LOC119587) ENST00000474277.1 novel transcript ENST00000481775.1 novel transcript ENST00000446888.1 putative novel transcript ENST00000435782.1 putative novel transcript ENST00000394192.2 Y-box protein pseudogene ENST00000455505.1 novel pseudogene ENST00000346248.5 B cell RAG associated protein (GALNAC4S-6ST) ENST00000476765.1 novel transcript ENST00000462406.1 novel transcript ENST00000368845.5 ornithine aminotransferase (gyrate atrophy) ENST00000471127.1 ornithine aminotransferase (gyrate atrophy) ENST00000471127.1 this variant and one or more of variant fragments .1.3, .1.5 and .1.7 could be part of a single variant ENST00000467675.1 ornithine aminotransferase (gyrate atrophy) ENST00000483711.1 ornithine aminotransferase (gyrate atrophy) ENST00000483711.1 this variant and one or more of variant fragments .1.2, .1.5 and .1.7 could be part of a single variant ENST00000476917.1 this variant and one or more of variant fragments .1.2 and .1.3 could be part of a single variant. ENST00000476917.1 novel transcript ENST00000490096.1 ornithine aminotransferase (gyrate atrophy) ENST00000492376.1 ornithine aminotransferase (gyrate atrophy) ENST00000492376.1 this variant and one or more of variant fragments .1.2 and .1.3 could be part of a single variant. ENST00000451024.3 not organism-supported ENST00000392757.4 phospholysine phosphohistidine inorganic pyrophosphate phosphatase ENST00000368842.5 phospholysine phosphohistidine inorganic pyrophosphate phosphatase ENST00000368839.1 phospholysine phosphohistidine inorganic pyrophosphate phosphatase ENST00000487190.1 phospholysine phosphohistidine inorganic pyrophosphate phosphatase ENST00000481452.1 phospholysine phosphohistidine inorganic pyrophosphate phosphatase ENST00000493240.1 phospholysine phosphohistidine inorganic pyrophosphate phosphatase ENST00000482963.1 phospholysine phosphohistidine inorganic pyrophosphate phosphatase ENST00000486535.1 phospholysine phosphohistidine inorganic pyrophosphate phosphatase ENST00000492187.1 phospholysine phosphohistidine inorganic pyrophosphate phosphatase ENST00000494792.1 subject to nonsense-mediated decay ENST00000392754.3 alternative 5' UTR ENST00000448422.1 putative novel transcript ENST00000432699.1 putative novel transcript ENST00000495711.1 this variant and variant fragment .3.7 could be part of a single variant ENST00000495711.1 novel transcript ENST00000498770.1 novel transcript ENST00000468738.1 this variant and variant fragment .3.7 could be part of a single variant ENST00000468738.1 novel transcript ENST00000399021.2 nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1) pseudogene ENST00000508096.1 putative novel transcript ENST00000446713.1 putative novel transcript ENST00000359653.4 zinc finger, RAN-binding domain containing 1 ENST00000471421.1 zinc finger, RAN-binding domain containing 1 ENST00000449984.1 putative novel transcript ENST00000337195.5 C-terminal binding protein 2 ENST00000531469.1 alternative 5' UTR ENST00000494626.2 alternative 5' UTR ENST00000411419.2 alternative 5' UTR ENST00000460976.1 C-terminal binding protein 2 ENST00000459668.1 C-terminal binding protein 2 ENST00000493552.1 C-terminal binding protein 2 ENST00000476817.1 C-terminal binding protein 2 ENST00000530884.1 alternative 5' UTR ENST00000415184.1 mitochondrial ribosomal protein S21 (MRPS21) pseudogene ENST00000431701.1 ribosomal protein S27 (metallopanstimulin 1) (MPS1, MPS-1) (RPS27) pseudogene ENST00000446081.1 novel transcript ENST00000431861.1 novel transcript ENST00000368821.3 novel protein ENST00000398050.3 aldolase A, fructose-bisphosphate pseudogene 2 ENST00000415305.1 Translation in Em:BC033536.1 looks ambiguous so not used ENST00000415305.1 novel transcript ENST00000449693.1 novel transcript ENST00000419400.1 novel transcript ENST00000423178.2 translation given in Em:AK094354.1 looks ambiguous so not used ENST00000423178.2 novel transcript ENST00000430970.1 putative novel transcript ENST00000481600.1 erythroid differentiation-related factor 1 (EDRF1) ENST00000356792.4 nag/nag splice junction compared to -008 ENST00000337623.3 erythroid differentiation-related factor 1 (DKFZp586F1019) (EDRF1) ENST00000368813.1 erythroid differentiation-related factor 1 (FLJ21617) (EDRF1) ENST00000469725.1 novel transcript ENST00000368812.1 erythroid differentiation-related factor 1 (EDRF1) ENST00000449436.1 novel transcript ENST00000368808.3 matrix metalloproteinase 21 ENST00000470483.1 uroporphyrinogen III synthase (congenital erythropoietic porphyria) ENST00000368797.4 uroporphyrinogen III synthase (congenital erythropoietic porphyria) ENST00000484541.1 uroporphyrinogen III synthase (congenital erythropoietic porphyria) ENST00000368786.1 alternatively spliced 5' UTR, shares CDS with bA124H7.2.1 ENST00000368786.1 uroporphyrinogen III synthase (congenital erythropoietic porphyria) ENST00000368786.1 alternative 5' UTR ENST00000465577.1 uroporphyrinogen III synthase (congenital erythropoietic porphyria) ENST00000464267.1 uroporphyrinogen III synthase (congenital erythropoietic porphyria) ENST00000465260.1 uroporphyrinogen III synthase (congenital erythropoietic porphyria) ENST00000462490.1 uroporphyrinogen III synthase (congenital erythropoietic porphyria) ENST00000420761.1 uroporphyrinogen III synthase (congenital erythropoietic porphyria) ENST00000368778.3 uroporphyrinogen III synthase (congenital erythropoietic porphyria) ENST00000368774.1 uroporphyrinogen III synthase (congenital erythropoietic porphyria) ENST00000278100.6 BRCA2 and CDKN1A interacting protein (TOK-1) ENST00000299130.3 BRCA2 and CDKN1A interacting protein (TOK-1) ENST00000368759.5 BRCA2 and CDKN1A interacting protein (TOK-1) ENST00000463330.1 BRCA2 and CDKN1A interacting protein (TOK-1) ENST00000478798.1 BRCA2 and CDKN1A interacting protein (TOK-1) ENST00000368721.1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32 (FLJ21216) ENST00000284690.3 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32 (FLJ10694, FLJ10889) ENST00000415732.1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32 (FLJ10694, FLJ10889) ENST00000415732.1 alternative 5' UTR ENST00000415732.1 alternatively spliced 5' UTR, shares CDS with bA124H7.4.1 (partial) ENST00000368695.1 novel protein (LOC92565) ENST00000417114.1 novel protein (LOC92565) ENST00000417114.1 alternatively spliced 5' UTR, shares CDS with Em:AC063963.1.1 (partial) ENST00000417114.1 alternative 5' UTR ENST00000494896.1 novel transcript ENST00000445510.1 alternatively spliced 5' UTR, shares CDS with Em:AC063963.1.4 (partial) ENST00000445510.1 novel protein (LOC92565) ENST00000445510.1 alternative 5' UTR ENST00000368691.1 novel protein (LOC92565) ENST00000368689.1 novel protein (LOC92565) ENST00000492670.1 novel transcript ENST00000456942.1 novel protein (LOC92565) ENST00000464130.1 novel transcript ENST00000477963.1 novel transcript ENST00000452289.1 guanine nucleotide binding protein (G protein), gamma 10 (GNG10) pseudogene ENST00000445458.1 putative novel transcript ENST00000368679.4 a disintegrin and metalloproteinase domain 12 (meltrin alpha) (MCMP, MLTN, MLTNA, MCMPMltna) ENST00000368676.4 a disintegrin and metalloproteinase domain 12 (meltrin alpha) (MCMP, MLTN, MLTNA, MCMPMltna) ENST00000467145.1 a disintegrin and metalloproteinase domain 12 (meltrin alpha) (MCMP, MLTN, MLTNA, MCMPMltna) ENST00000482291.1 a disintegrin and metalloproteinase domain 12 (meltrin alpha) (MCMP, MLTN, MLTNA, MCMPMltna) ENST00000485388.1 a disintegrin and metalloproteinase domain 12 (meltrin alpha) (MCMP, MLTN, MLTNA, MCMPMltna) ENST00000448723.1 a disintegrin and metalloproteinase domain 12 (meltrin alpha) (MCMP, MLTN, MLTNA, MCMPMltna) ENST00000494661.1 a disintegrin and metalloproteinase domain 12 (meltrin alpha) (MCMP, MLTN, MLTNA, MCMPMltna) ENST00000456514.1 novel transcript ENST00000356858.2 novel protein ENST00000424927.1 novel protein ENST00000480379.1 novel transcript ENST00000432642.1 novel protein (FLJ32938) ENST00000368674.1 novel protein ENST00000488181.1 novel transcript ENST00000463082.1 novel transcript ENST00000280333.6 gap between first two exons but only intron lies within it ENST00000473861.1 dedicator of cyto-kinesis 1 ENST00000484400.1 dedicator of cyto-kinesis 1 ENST00000495574.1 dedicator of cyto-kinesis 1 ENST00000464466.1 dedicator of cyto-kinesis 1 ENST00000420941.1 novel transcript ENST00000432554.1 putative novel transcript ENST00000388920.4 NP_997309.2 ENST00000368671.3 novel protein (MGC32871) ENST00000254667.3 5' UTR ENST00000254667.3 protein tyrosine phosphatase, receptor type, E ENST00000442830.1 5' UTR ENST00000442830.1 alternatively spliced in 5' UTR, shares partial CDS with bA380J17.1.1 ENST00000442830.1 protein tyrosine phosphatase, receptor type, E ENST00000442830.1 alternative 5' UTR ENST00000471218.1 protein tyrosine phosphatase, receptor type, E ENST00000455661.1 alternatively spliced in 5' UTR, shares partial CDS with bA380J17.1.1 ENST00000455661.1 protein tyrosine phosphatase, receptor type, E ENST00000455661.1 alternative 5' UTR ENST00000467366.1 protein tyrosine phosphatase, receptor type, E ENST00000306042.5 protein tyrosine phosphatase, receptor type, E ENST00000487428.1 protein tyrosine phosphatase, receptor type, E ENST00000495530.1 protein tyrosine phosphatase, receptor type, E ENST00000479896.1 protein tyrosine phosphatase, receptor type, E ENST00000492479.1 protein tyrosine phosphatase, receptor type, E ENST00000463727.1 protein tyrosine phosphatase, receptor type, E (DKFZp313F1310) ENST00000420845.1 putative novel transcript ENST00000433110.1 putative novel transcript ENST00000368654.3 antigen identified by monoclonal antibody Ki-67 ENST00000368653.3 antigen identified by monoclonal antibody Ki-67 ENST00000464771.1 antigen identified by monoclonal antibody Ki-67 ENST00000484853.1 antigen identified by monoclonal antibody Ki-67 ENST00000478293.1 antigen identified by monoclonal antibody Ki-67 ENST00000454492.1 putative novel transcript ENST00000443888.1 putative novel transcript ENST00000446589.1 novel transcript ENST00000453367.1 putative novel transcript ENST00000414581.1 putative novel transcript ENST00000482653.1 O-6-methylguanine-DNA methyltransferase ENST00000482547.1 O-6-methylguanine-DNA methyltransferase ENST00000428178.1 novel transcript ENST00000428273.1 putative novel transcript ENST00000430326.1 novel transcript ENST00000355311.4 early B-cell factor 3 ENST00000368648.3 early B-cell factor 3 ENST00000440978.1 early B-cell factor 3 ENST00000471715.1 early B-cell factor 3 ENST00000423976.1 putative novel transcript ENST00000456581.1 novel transcript ENST00000449940.1 peptidylprolyl isomerase A (cyclophilin A) (PPIA) pseudogene ENST00000331244.5 novel protein similar thioredoxin-like 2 (TXNL2) ENST00000368644.1 novel protein similar thioredoxin-like 2 (TXNL2) ENST00000368644.1 alternative 3' UTR ENST00000481034.1 novel protein similar thioredoxin-like 2 (TXNL2) ENST00000481034.1 alternative 3' UTR ENST00000486974.1 novel protein similar thioredoxin-like 2 (TXNL2) ENST00000496195.1 novel protein similar thioredoxin-like 2 (TXNL2) ENST00000440388.1 putative novel transcript ENST00000449936.1 putative novel transcript ENST00000439421.1 putative novel transcript ENST00000436942.1 putative novel transcript ENST00000445868.1 novel transcript ENST00000368636.4 BCL2/adenovirus E1B 19kD-interacting protein 3 ENST00000298622.4 FLJ45017 ENST00000298622.4 NMD exception ENST00000414106.1 putative novel transcript ENST00000443922.1 putative novel transcript ENST00000338492.3 dihydropyrimidinase-like 4 (CRMP3, DRP-4, ULIP4) ENST00000493927.1 dihydropyrimidinase-like 4 (CRMP3, DRP-4, ULIP4) ENST00000493882.1 dihydropyrimidinase-like 4 (CRMP3, DRP-4, ULIP4) ENST00000368627.1 dihydropyrimidinase-like 4 (CRMP3, DRP-4, ULIP4) ENST00000471544.1 dihydropyrimidinase-like 4 (CRMP3, DRP-4, ULIP4) ENST00000478542.1 novel transcript ENST00000368622.1 protein kinase (PKE) ENST00000298630.3 novel protein ENST00000462160.1 novel protein ENST00000368620.2 novel protein ENST00000368619.3 novel protein ENST00000456004.1 novel protein ENST00000344079.5 novel protein ENST00000368614.3 novel protein (KIAA1674) ENST00000462656.1 novel protein ENST00000368613.4 novel protein ENST00000368612.1 novel transcript ENST00000450442.1 novel protein ENST00000490055.1 novel transcript ENST00000489204.1 novel transcript ENST00000472387.1 novel transcript ENST00000475747.1 novel transcript ENST00000472556.1 novel transcript ENST00000476889.1 novel transcript ENST00000487000.1 novel transcript ENST00000305233.5 NP_612508.3 ENST00000428814.1 putative novel transcript ENST00000450206.1 putative novel transcript ENST00000490765.1 novel transcript ENST00000455414.1 putative novel transcript ENST00000445190.1 putative novel transcript ENST00000368594.3 inositol polyphosphate-5-phosphatase, 40kDa ENST00000368593.3 inositol polyphosphate-5-phosphatase, 40kDa ENST00000451873.1 inositol polyphosphate-5-phosphatase, 40kDa ENST00000423490.1 inositol polyphosphate-5-phosphatase, 40kDa ENST00000342652.6 inositol polyphosphate-5-phosphatase, 40kDa ENST00000487614.1 inositol polyphosphate-5-phosphatase, 40kDa ENST00000498337.1 inositol polyphosphate-5-phosphatase, 40kDa ENST00000445580.1 inositol polyphosphate-5-phosphatase, 40kDa ENST00000368585.3 FLJ25954 ENST00000475340.1 novel protein ENST00000443633.1 alternative 5' exon. It is impossible to tell whether exon 1 of this variant or variant .4.1 is the true 5' exon of this gene as the genomic sequences are identical in this region ENST00000443633.1 putative novel transcript (FLJ38184) ENST00000423232.1 putative novel transcript ENST00000461291.1 FLJ43861 ENST00000418634.1 60S ribosomal protein L5 (RPL5) pseudogene ENST00000478074.1 novel transcript ENST00000485110.1 novel transcript ENST00000465195.1 novel transcript (FLJ00378) ENST00000497778.1 novel protein (FLJ00252) ENST00000532588.1 non-canonical splice site ENST00000304477.2 undifferentiated embryonic cell transcription factor 1 ENST00000559180.1 NMD likely if extended ENST00000252936.3 tubulin gamma complex associated protein 2 ENST00000477923.1 tubulin gamma complex associated protein 2 ENST00000368562.1 tubulin gamma complex associated protein 2 ENST00000482278.1 tubulin gamma complex associated protein 2 ENST00000487796.1 tubulin gamma complex associated protein 2 ENST00000470829.1 tubulin gamma complex associated protein 2 ENST00000480198.1 tubulin gamma complex associated protein 2 ENST00000361518.5 novel protein ENST00000359035.3 novel protein (FLJ34392) ENST00000463816.1 novel transcript ENST00000368555.3 calcyon D1 dopamine receptor-interacting protein (CALCYON) ENST00000252939.4 calcyon D1 dopamine receptor-interacting protein (CALCYON) ENST00000467433.1 novel transcript ENST00000467611.1 novel transcript ENST00000368558.1 calcyon D1 dopamine receptor-interacting protein (CALCYON) ENST00000452591.1 putative novel transcript ENST00000463201.1 novel transcript ENST00000433452.2 uterine-specific proline-rich acidic protein (UPA) ENST00000447176.1 novel protein ENST00000465384.1 novel transcript ENST00000368551.1 novel protein ENST00000478895.1 novel transcript ENST00000368547.3 enoyl Coenzyme A hydratase, short chain 1, mitachondrial ENST00000317502.6 novel protein (LOC92170) ENST00000460848.1 FLJ90495 ENST00000463137.1 FLJ45320 ENST00000488261.1 FLJ00268 ENST00000475114.1 putative novel transcript ENST00000463117.2 cytochrome P450, family 2, subfamily E, polypeptide 1 ENST00000541261.1 alternative 5' UTR ENST00000477500.1 this variant and variant fragment .6.5 could be part of a single variant ENST00000477500.1 cytochrome P450, family 2, subfamily E, polypeptide 1 ENST00000480558.1 this variant and variant fragment .6.5 could be part of a single variant ENST00000480558.1 cytochrome P450, family 2, subfamily E, polypeptide 1 ENST00000368520.1 this variant and variant fragment .6.5 could be part of a single variant ENST00000368520.1 cytochrome P450, family 2, subfamily E, polypeptide 1 ENST00000469258.1 this variant and one of variant fragments .6.2, .6.3 and .6.4 could be part of a single variant ENST00000469258.1 cytochrome P450, family 2, subfamily E, polypeptide 1 ENST00000479535.1 novel transcript ENST00000368517.3 novel protein (LOC93426) ENST00000460441.1 novel transcript ENST00000482127.1 novel transcript ENST00000441446.1 olfactory receptor protein pseudogene ENST00000443774.1 novel protein similar to FSHD Region Gene 2 protein ENST00000495459.1 novel transcript ENST00000394842.2 retinoic acid receptor responder (tazarotenenduced) 2 (TIG2, HP10433) (RARRES2) pseudogene ENST00000426656.1 novel pseudogene ENST00000411632.1 novel pseudogene ENST00000450011.1 ribosomal protein L23a (RPL23A) pseudogene ENST00000531209.1 non-canonical splice donor site between exons 3 and 4 ENST00000532373.1 not organism-supported ENST00000528469.1 alternative 5' UTR ENST00000525776.1 alternative 5' UTR ENST00000525237.1 alternative 5' UTR ENST00000528780.1 alternative 5' UTR ENST00000328221.5 alternative 5' UTR ENST00000533249.1 alternative 5' UTR ENST00000527442.1 alternative 5' UTR ENST00000528036.1 alternative 5' UTR ENST00000530695.1 not organism-supported ENST00000532587.1 non-canonical splice donor site between exons 6 and 7 ENST00000532587.1 not organism-supported ENST00000431843.2 alternative 5' UTR ENST00000397632.3 alternative 5' UTR ENST00000534797.1 alternative 5' UTR ENST00000397615.2 alternative 5' UTR ENST00000397604.3 alternative 5' UTR ENST00000533410.1 alternative 5' UTR ENST00000438658.2 alternative 5' UTR ENST00000354420.2 alternative 5' UTR ENST00000527485.1 alternative 5' UTR ENST00000529368.1 alternative 5' UTR ENST00000529306.1 alternative 5' UTR ENST00000526013.1 non-canonical splice acceptor site between exons 4 and 5 ENST00000532055.1 alternative 5' UTR ENST00000533592.1 confirm experimentally ENST00000531540.1 alternative 5' UTR ENST00000526295.1 alternative 5' UTR ENST00000397596.2 alternative 5' UTR ENST00000493230.1 PMID: 9563009 and PMID: 14500341 support that this is not subject to NMD ENST00000431809.1 alternative 5' UTR ENST00000454668.2 NP_001137466 ENST00000528736.1 alternative 5' UTR ENST00000413872.2 NAGNAG splice site ENST00000416188.2 NP_065952.2 ENST00000416188.2 NAGNAG splice site ENST00000524763.1 alternative 5' UTR ENST00000527199.1 alternative 5' UTR ENST00000533256.1 alternative 5' UTR ENST00000534755.1 alternative 5' UTR ENST00000533500.1 alternative 5' UTR ENST00000531348.1 alternative 5' UTR ENST00000530636.1 alternative 5' UTR ENST00000531214.1 alternative 5' UTR ENST00000533385.1 alternative 5' UTR ENST00000526152.1 alternative 5' UTR ENST00000528606.1 alternative 5' UTR ENST00000527723.1 alternative 5' UTR ENST00000531514.1 alternative 5' UTR ENST00000528936.1 alternative 5' UTR ENST00000456706.2 alternative 5' UTR ENST00000532484.1 alternative 5' UTR ENST00000529066.1 alternative 5' UTR ENST00000531534.1 alternative 5' UTR ENST00000530360.1 alternative 5' UTR ENST00000530797.1 alternative 5' UTR ENST00000528315.1 alternative 5' UTR ENST00000533803.1 alternative 5' UTR ENST00000527089.1 alternative 5' UTR ENST00000530183.1 alternative 5' UTR ENST00000525718.1 alternative 5' UTR ENST00000526693.1 alternative 5' UTR ENST00000524748.1 alternative 5' UTR ENST00000527341.1 alternative 5' UTR ENST00000528867.1 alternative 5' UTR ENST00000530320.1 alternative 5' UTR ENST00000526439.1 alternative 5' UTR ENST00000397411.2 alternative 5' UTR ENST00000530404.1 alternative 5' UTR ENST00000525334.1 alternative 5' UTR ENST00000409543.2 alternative 5' UTR ENST00000525201.1 NP_001020410.1 ENST00000409531.1 not organism-supported ENST00000527644.1 alternative 5' UTR ENST00000529539.1 alternative 3' UTR ENST00000436108.2 alternative 5' UTR ENST00000533056.1 alternative 5' UTR ENST00000533059.1 alternative 5' UTR ENST00000530939.1 alternative 5' UTR ENST00000525225.1 alternative 5' UTR ENST00000525840.1 alternative 5' UTR ENST00000528154.1 alternative 5' UTR ENST00000528596.1 alternative 5' UTR ENST00000524702.1 alternative 5' UTR ENST00000526462.1 There is a suspected genomic sequencing error affecting the 5' of this locus (HG-152) ENST00000526462.1 The alignment for the first 62bp of this transcript are likely to be found when the error has been corrected ENST00000529380.1 There is a suspected genomic sequence error (HG-152) at the 5' of this locus. Presumably the alignment for the first 88bp of this transcript will be found once the error has been corrected ENST00000399682.1 179 bp of alignment is missing within the central repetitive domain. This may be due to sequencing error in either the clone or the cDNA, or it may reflect polymorphism. ORF stays in frame ENST00000340134.4 LOC402778 ENST00000482459.1 novel transcript ENST00000479276.1 FLJ16250 ENST00000490707.1 DKFZp434K0322 ENST00000482118.1 Novel transcript ENST00000381911.1 alternative 5' UTR ENST00000381775.1 FLJ34752 ENST00000406638.2 FLJ32014 ENST00000485341.1 FLJ36340 ENST00000381589.3 DKFZp779M2348 ENST00000381557.2 the CDS of this variant is predicted to break a Pfam domain by Michael Tress (CNB Madrid) - analysis done as part of the ENCODE/Biosapiens project ENST00000381558.1 FLJ32406 ENST00000381519.1 alternative 3' UTR ENST00000381395.1 alternative 5' UTR ENST00000434045.2 NP_001121070.1 ENST00000381392.1 alternative 5' UTR ENST00000381389.1 alternative 5' UTR ENST00000418738.2 alternative 5' UTR ENST00000337883.6 alternative 5' UTR ENST00000381379.1 alternative 5' UTR ENST00000397270.1 NP_001035835.1 ENST00000397262.1 alternative 5' UTR ENST00000250971.3 alternative 5' UTR ENST00000470369.1 novel transcript ENST00000461200.1 FLJ46034 ENST00000530648.1 alternative 5' UTR ENST00000492627.1 alternative 5' UTR ENST00000526072.1 not organism-supported ENST00000524805.1 not organism-supported ENST00000437110.1 alternative 5' UTR ENST00000435795.1 alternative 5' UTR ENST00000485682.2 alternative 5' UTR ENST00000440813.1 alternative 5' UTR ENST00000496468.1 alternative 5' UTR ENST00000557213.1 confirm experimentally ENST00000526203.1 alternative 5' UTR ENST00000347936.2 alternative 5' UTR ENST00000380574.1 alternative 5' UTR ENST00000485423.1 alternative 5' UTR ENST00000430811.1 alternative 5' UTR ENST00000529361.1 alternative 5' UTR ENST00000528968.1 alternative 5' UTR ENST00000530064.1 alternative 5' UTR ENST00000526842.1 alternative 5' UTR ENST00000531291.1 alternative 5' UTR ENST00000455338.2 alternative 5' UTR ENST00000534372.1 alternative 5' UTR ENST00000525498.1 184226 ENST00000348039.5 alternative 5' UTR ENST00000533234.1 alternative 5' UTR ENST00000526122.1 alternative 5' UTR ENST00000530372.1 alternative 5' UTR ENST00000533721.1 alternative 5' UTR ENST00000534157.1 alternative 5' UTR ENST00000531711.1 alternative 5' UTR ENST00000420873.2 alternative 5' UTR ENST00000529678.1 alternative 5' UTR ENST00000534569.1 alternative 5' UTR ENST00000359918.4 alternative 5' UTR ENST00000425767.2 not organism-supported ENST00000300730.6 NP_001138910.1 ENST00000396979.1 alternative 5' UTR ENST00000396978.1 alternative 5' UTR ENST00000533217.1 alternative 5' UTR ENST00000300737.4 corf ENST00000532610.1 alternative 5' UTR ENST00000532919.1 alternative 5' UTR ENST00000524822.1 alternative 5' UTR ENST00000525055.1 alternative 5' UTR ENST00000528656.1 alternative 5' UTR ENST00000532990.1 alternative 5' UTR ENST00000418718.1 unitary_pseudogene ENST00000435309.1 unitary_pseudogene ENST00000414298.1 unitary_pseudogene ENST00000360213.1 NM_001004137.1 ENST00000396952.5 NP_689643.2 ENST00000422578.2 unitary_pseudogene ENST00000532598.1 alternative 5' UTR ENST00000415429.1 unitary_pseudogene ENST00000427016.1 unitary_pseudogene ENST00000452083.1 unitary_pseudogene ENST00000511110.1 unitary_pseudogene ENST00000321255.1 NP_001004760.2 ENST00000510214.1 unitary_pseudogene ENST00000307165.4 unitary_pseudogene ENST00000514607.1 unitary_pseudogene ENST00000380097.3 NP_001003818.1 ENST00000515022.1 alternative 5' UTR ENST00000514226.1 alternative 5' UTR ENST00000439752.1 unitary_pseudogene ENST00000438474.1 unitary_pseudogene ENST00000413417.1 unitary_pseudogene ENST00000329564.6 not organism-supported ENST00000446117.1 unitary_pseudogene ENST00000534405.1 not organism-supported ENST00000299402.6 alternative 5' UTR ENST00000525074.1 alternative 5' UTR ENST00000254584.2 alternative 5' UTR ENST00000420936.2 alternative 5' UTR ENST00000396751.2 alternative 5' UTR ENST00000299427.6 There is an upstream M, but other species use the down stream M ENST00000414517.2 alternative 5' UTR ENST00000414517.2 not organism-supported ENST00000530135.1 alternative 5' UTR ENST00000526873.1 alternative 5' UTR ENST00000528947.1 alternative 5' UTR ENST00000527790.1 alternative 5' UTR ENST00000526046.1 alternative 5' UTR ENST00000299498.6 alternative 5' UTR ENST00000531096.1 alternative 5' UTR ENST00000527542.1 alternative 5' UTR ENST00000436351.2 alternative 5' UTR ENST00000534193.1 non canonical genome sequence error ENST00000534193.1 not organism-supported ENST00000424698.1 unitary_pseudogene ENST00000299512.2 unitary_pseudogene ENST00000305754.2 unitary_pseudogene ENST00000309838.2 NM_001004461 ENST00000526590.1 alternative 5' UTR ENST00000534484.1 not organism-supported ENST00000447869.1 alternative 5' UTR ENST00000396672.1 alternative 5' UTR ENST00000534493.1 alternative 5' UTR ENST00000524760.1 not organism-supported ENST00000422559.2 alternative 5' UTR ENST00000457885.2 alternative 5' UTR ENST00000532336.1 not organism-supported ENST00000431279.2 alternative 5' UTR ENST00000454443.2 alternative 5' UTR ENST00000526360.1 alternative 5' UTR ENST00000402157.2 not organism-supported ENST00000529211.1 not organism-supported ENST00000525788.1 not organism-supported ENST00000530022.1 alternative 5' UTR ENST00000526562.1 alternative 5' UTR ENST00000530913.1 alternative 5' UTR ENST00000313726.6 NP_998783 ENST00000530438.1 alternative 5' UTR ENST00000533020.1 alternative 5' UTR ENST00000528527.1 alternative 5' UTR ENST00000526057.1 alternative 5' UTR ENST00000530580.1 alternative 5' UTR ENST00000531093.1 alternative 5' UTR ENST00000533225.1 alternative 5' UTR ENST00000526126.1 alternative 5' UTR ENST00000528523.1 alternative 5' UTR ENST00000533681.1 alternative 5' UTR ENST00000526241.1 alternative 5' UTR ENST00000530959.1 alternative 5' UTR ENST00000526155.1 alternative 5' UTR ENST00000534248.1 alternative 5' UTR ENST00000527347.1 alternative 5' UTR ENST00000527516.1 alternative 5' UTR ENST00000527473.1 alternative 5' UTR ENST00000530938.1 alternative 5' UTR ENST00000533471.1 alternative 5' UTR ENST00000524757.1 alternative 5' UTR ENST00000527392.1 alternative 5' UTR ENST00000526828.1 alternative 5' UTR ENST00000525169.1 alternative 5' UTR ENST00000534665.1 alternative 5' UTR ENST00000531578.1 alternative 5' UTR ENST00000524577.1 alternative 5' UTR ENST00000534506.1 alternative 5' UTR ENST00000396648.2 alternative 5' UTR ENST00000534147.1 alternative 5' UTR ENST00000326053.5 NP_065694 ENST00000531618.1 CCDS7795.1 ENST00000531618.1 NP_065697 ENST00000309134.5 alternative 5' UTR ENST00000530136.1 alternative 5' UTR ENST00000299596.4 alternative 3' UTR ENST00000531943.1 alternative 5' UTR ENST00000438144.2 alternative 5' UTR ENST00000534265.1 alternative 5' UTR ENST00000412390.2 alternative 5' UTR ENST00000414370.1 alternative 5' UTR ENST00000417726.1 alternative 5' UTR ENST00000299613.5 NP_001137448 ENST00000528655.1 alternative 5' UTR ENST00000525063.1 alternative 3' UTR ENST00000528544.1 alternative 5' UTR ENST00000532250.1 alternative 5' UTR ENST00000524866.1 alternative 5' UTR ENST00000529507.1 alternative 5' UTR ENST00000529744.1 not organism-supported ENST00000533412.1 alternative 5' UTR ENST00000558540.1 NP_001093637.1 ENST00000534266.1 non-canonical splice acceptor site between exons 1 and 2 ENST00000534266.1 alternative 5' UTR ENST00000526414.1 non-canonical splice acceptor site between exons 1 and 2 ENST00000532037.1 non-canonical splice acceptor site between exons 2 and 3 ENST00000526148.1 non-ATG start codon ENST00000526148.1 alternative 5' UTR ENST00000525681.1 non-ATG start codon ENST00000525681.1 not organism-supported ENST00000525681.1 alternative 5' UTR ENST00000339995.5 non-ATG start codon ENST00000396525.2 non-ATG start codon ENST00000528839.1 non-ATG start codon ENST00000531416.1 non-ATG start codon ENST00000531647.1 non-ATG start codon ENST00000532082.1 non-ATG start codon ENST00000532082.1 alternative 5' UTR ENST00000524932.1 non-ATG start codon ENST00000524932.1 alternative 5' UTR ENST00000527419.1 non-ATG start codon ENST00000528562.1 non-ATG start codon ENST00000532570.1 non-ATG start codon ENST00000532570.1 alternative 5' UTR ENST00000526591.1 non-ATG start codon ENST00000526591.1 alternative 5' UTR ENST00000530211.1 non-ATG start codon ENST00000530211.1 alternative 5' UTR ENST00000527526.1 non-ATG start codon ENST00000530702.1 non-ATG start codon ENST00000413761.2 alternative 5' UTR ENST00000526020.1 alternative 5' UTR ENST00000526852.1 alternative 5' UTR ENST00000528289.1 alternative 5' UTR ENST00000396505.2 alternative 5' UTR ENST00000533813.1 alternative 5' UTR ENST00000532179.1 alternative 5' UTR ENST00000526065.1 alternative 5' UTR ENST00000530823.1 alternative 5' UTR ENST00000532420.1 alternative 5' UTR ENST00000524685.1 alternative 5' UTR ENST00000525119.1 alternative 5' UTR ENST00000533389.1 alternative 5' UTR ENST00000533534.1 alternative 5' UTR ENST00000527636.1 NP_068780.2 ENST00000527636.1 not organism-supported ENST00000527376.1 alternative 5' UTR ENST00000529050.1 alternative 5' UTR ENST00000534544.1 alternative 5' UTR ENST00000527998.1 alternative 5' UTR ENST00000533520.1 alternative 5' UTR ENST00000529825.1 alternative 5' UTR ENST00000529388.1 alternative 5' UTR ENST00000530357.1 alternative 5' UTR ENST00000403510.3 NP_001025444 ENST00000482049.1 alternative 5' UTR ENST00000529708.1 alternative 5' UTR ENST00000526841.1 alternative 5' UTR ENST00000529816.1 alternative 5' UTR ENST00000533633.1 rs5789821 ENST00000414023.2 alternative 5' UTR ENST00000534746.1 alternative 5' UTR ENST00000526063.1 alternative 5' UTR ENST00000531421.1 alternative 5' UTR ENST00000439561.2 alternative 5' UTR ENST00000555531.1 subject to nonsense-mediated decay ENST00000533068.1 alternative 5' UTR ENST00000532256.1 alternative 5' UTR ENST00000455098.2 alternative 5' UTR ENST00000533448.1 alternative 3' UTR ENST00000396372.2 alternative 5' UTR ENST00000530161.1 alternative 5' UTR ENST00000528252.1 NP_001139283 ENST00000533411.1 alternative 5' UTR ENST00000526673.1 alternative 5' UTR ENST00000529469.1 alternative 5' UTR ENST00000531066.1 not organism-supported ENST00000532035.1 alternative 5' UTR ENST00000528644.1 alternative 5' UTR ENST00000530527.1 alternative 5' UTR ENST00000533773.1 non-canonical splice acceptor site between exons 4 and 5 ENST00000526120.1 alternative 5' UTR ENST00000533738.1 alternative 5' UTR ENST00000531172.1 alternative 5' UTR ENST00000530964.1 alternative 5' UTR ENST00000529313.1 alternative 5' UTR ENST00000533926.1 alternative 5' UTR ENST00000530403.1 alternative 3' UTR ENST00000526912.1 alternative 5' UTR ENST00000005226.7 NP_710142 ENST00000005226.7 not organism-supported ENST00000399397.1 not organism-supported ENST00000498332.1 not organism-supported ENST00000342528.2 FLJ46346 ENST00000265969.6 NP_001106212 ENST00000265969.6 not organism-supported ENST00000530613.1 alternative 5' UTR ENST00000532389.1 alternative 5' UTR ENST00000531264.1 alternative 5' UTR ENST00000340135.3 alternative 5' UTR ENST00000534640.1 alternative 3' UTR ENST00000414546.2 NP_001120852 ENST00000529528.1 alternative 5' UTR ENST00000526900.1 alternative 5' UTR ENST00000532858.1 alternative 5' UTR ENST00000438420.2 alternative 5' UTR ENST00000352460.3 not organism-supported ENST00000531848.1 not organism-supported ENST00000453096.2 alternative 5' UTR ENST00000525831.1 alternative 5' UTR ENST00000543445.1 alternative 5' UTR ENST00000535451.1 alternative 5' UTR ENST00000478970.2 alternative 5' UTR ENST00000495052.1 alternative 5' UTR ENST00000379412.5 alternative 5' UTR ENST00000542179.1 alternative 5' UTR ENST00000280704.4 alternative 5' UTR ENST00000536880.1 not organism-supported ENST00000280706.2 alternative 5' UTR ENST00000477854.1 Made from Macaque cDNA ENST00000477854.1 Translation different to that in Macaque ENST00000477854.1 not organism-supported ENST00000446113.2 non canonical U12 ENST00000399351.3 NP_001128711.1 ENST00000399351.3 non canonical U12 ENST00000525490.1 non canonical U12 ENST00000250024.4 alternative 5' UTR ENST00000396085.1 NP_892009 ENST00000349880.4 NP_660093 ENST00000524983.2 not organism-supported ENST00000530266.1 alternative 5' UTR ENST00000421577.2 alternative 5' UTR ENST00000443524.2 alternative 5' UTR ENST00000532505.1 alternative 5' UTR ENST00000437750.2 NP_001138638 ENST00000532434.1 NP_963845 ENST00000528582.1 alternative 5' UTR ENST00000533363.1 alternative 5' UTR ENST00000278187.3 alternative 5' UTR ENST00000534801.1 alternative 5' UTR ENST00000532398.1 alternative 5' UTR ENST00000499625.1 ENSEMBL transcript id:ENST00000499625 long non-coding RNA (lincRNA) ENST00000529533.1 NP_001128563 ENST00000527569.1 NP_001128564 ENST00000533566.1 alternative 5' UTR ENST00000528583.1 alternative 5' UTR ENST00000525090.1 alternative 5' UTR ENST00000439476.2 alternative 5' UTR ENST00000525528.1 alternative 5' UTR ENST00000533131.1 non-canonical splice donor site between exons 1 and 2 ENST00000533131.1 alternative 5' UTR ENST00000356660.4 alternative 5' UTR ENST00000418212.1 alternative 5' UTR ENST00000533246.1 alternative 5' UTR ENST00000530861.1 alternative 5' UTR ENST00000395983.3 alternative 5' UTR ENST00000395980.2 alternative 5' UTR ENST00000532997.1 alternative 5' UTR ENST00000395981.3 alternative 5' UTR ENST00000395978.3 alternative 5' UTR ENST00000528035.1 non-canonical splice donor site between exons 2 and 3 ENST00000303459.6 FLJ33979 ENST00000254122.3 not organism-supported ENST00000254122.3 alternative 5' UTR ENST00000417547.1 not organism-supported ENST00000417547.1 alternative 5' UTR ENST00000530909.1 alternative 5' UTR ENST00000358117.4 NP_001138871 ENST00000528686.1 alternative 5' UTR ENST00000444572.2 This gene fragment and fragment RP4-535H23.1-001 are part of the same variant. The exact exon structure linking the variants remains to be determined ENST00000437348.1 This gene fragment and fragment RP4-535H23.1-006 are part of the same variant. The exact exon structure linking the variants remains to be determined ENST00000530125.1 not organism-supported ENST00000532287.1 alternative 5' UTR ENST00000534812.1 alternative 5' UTR ENST00000529749.1 alternative 5' UTR ENST00000530023.1 alternative 5' UTR ENST00000350638.5 NP_061913.3 ENST00000379132.2 not organism-supported ENST00000531633.1 not organism-supported ENST00000379107.2 not organism-supported ENST00000464174.1 not organism-supported ENST00000241001.8 alternative 5' UTR ENST00000379115.4 alternative 5' UTR ENST00000379111.2 alternative 5' UTR ENST00000379123.5 alternative 5' UTR ENST00000379109.2 alternative 5' UTR ENST00000524853.1 alternative 5' UTR ENST00000423822.1 alternative 5' UTR ENST00000438681.1 alternative 5' UTR ENST00000525535.1 alternative 5' UTR ENST00000400416.2 non-canonical splice donor site between exons 2 and 3 ENST00000379077.3 non-ATG start codon ENST00000332351.3 non-ATG start codon ENST00000452863.3 non-ATG start codon ENST00000448076.3 NP_077742.2 ENST00000533439.1 alternative 5' UTR ENST00000528155.1 alternative 5' UTR ENST00000311388.3 NP_631899 ENST00000530419.1 alternative 5' UTR ENST00000528107.1 alternative 5' UTR ENST00000531632.1 alternative 5' UTR ENST00000528898.1 alternative 5' UTR ENST00000438862.2 NP_001028677 ENST00000431742.2 NP_001028678 ENST00000524775.1 alternative 5' UTR ENST00000525975.1 alternative 5' UTR ENST00000379016.3 NP_001041665 ENST00000531504.1 alternative 5' UTR ENST00000526400.1 not organism-supported ENST00000379011.4 not organism-supported ENST00000531145.1 confirm experimentally ENST00000395850.3 alternative 5' UTR ENST00000415002.2 alternative 5' UTR ENST00000445143.2 alternative 5' UTR ENST00000426650.2 alternative 5' UTR ENST00000437761.2 alternative 5' UTR ENST00000527577.1 alternative 5' UTR ENST00000528700.1 alternative 5' UTR ENST00000534136.1 not organism-supported ENST00000257818.2 NP_005565.2 ENST00000341394.4 not organism-supported ENST00000389645.3 not organism-supported ENST00000532820.1 alternative 5' UTR ENST00000530820.1 not organism-supported ENST00000531159.2 NP_001137502.1 ENST00000435224.2 NP_665803.2 ENST00000241052.4 Catalase ENST00000530286.1 alternative 5' UTR ENST00000448838.2 NP_001128496 ENST00000278386.6 NP_001001392 ENST00000395750.1 alternative 5' UTR ENST00000527605.1 alternative 5' UTR ENST00000527172.1 alternative 5' UTR ENST00000532121.1 alternative 5' UTR ENST00000526728.1 alternative 5' UTR ENST00000378867.3 alternative 5' UTR ENST00000524380.1 alternative 5' UTR ENST00000526682.1 alternative 5' UTR ENST00000530252.1 alternative 5' UTR ENST00000530050.1 alternative 5' UTR ENST00000526679.1 alternative 5' UTR ENST00000348124.5 alternative 5' UTR ENST00000529083.1 alternative 5' UTR ENST00000527033.1 alternative 5' UTR ENST00000532616.1 alternative 5' UTR ENST00000531554.1 alternative 5' UTR ENST00000534635.1 alternative 5' UTR ENST00000530697.1 alternative 5' UTR ENST00000527108.1 alternative 5' UTR ENST00000532470.1 alternative 5' UTR ENST00000527150.1 alternative 5' UTR ENST00000528697.1 alternative 5' UTR ENST00000530763.1 alternative 5' UTR ENST00000533474.1 alternative 5' UTR ENST00000531273.1 NP_001136402 ENST00000420461.2 NP_001136403 ENST00000524742.1 alternative 5' UTR ENST00000524990.1 alternative 5' UTR ENST00000533404.1 alternative 5' UTR ENST00000532479.1 alternative 5' UTR ENST00000527014.1 alternative 5' UTR ENST00000343631.3 alternative 5' UTR ENST00000342935.3 NP_001020015.1 ENST00000532544.1 alternative 5' UTR ENST00000525210.1 alternative 5' UTR ENST00000524704.1 alternative 5' UTR ENST00000525813.1 alternative 5' UTR ENST00000533786.1 alternative 5' UTR ENST00000533202.1 alternative 5' UTR ENST00000520999.2 alternative 5' UTR ENST00000395648.3 alternative 5' UTR ENST00000533940.1 alternative 5' UTR ENST00000525680.1 NP_006025.2 ENST00000528473.1 alternative 5' UTR ENST00000528473.1 not organism-supported ENST00000533955.1 non-canonical splice donor site between exons 5 and 6 ENST00000525683.1 alternative 5' UTR ENST00000533443.1 alternative 5' UTR ENST00000530035.1 alternative 5' UTR ENST00000527685.1 alternative 5' UTR ENST00000533937.1 alternative 5' UTR ENST00000530656.1 NP_064614.2 ENST00000530656.1 BC148347 ENST00000530656.1 AB527203 ENST00000528980.1 not organism-supported ENST00000442528.2 NP_001138737.1 ENST00000526817.1 alternative 5' UTR ENST00000530670.1 non-canonical splice acceptor site between exons 2 and 3 ENST00000530471.1 alternative 5' UTR ENST00000417225.2 NP_001120929.1 ENST00000443527.2 NP_066940.2 ENST00000478807.1 Non-canonical donor slice site at exon three and non-canonical acceptor splice site at exon four ENST00000449465.1 NP_001073915.2 ENST00000532554.1 not organism-supported ENST00000531526.1 alternative 5' UTR ENST00000529734.1 alternative 5' UTR ENST00000533757.1 alternative 5' UTR ENST00000525438.1 alternative 5' UTR ENST00000527782.1 alternative 5' UTR ENST00000532010.1 alternative 5' UTR ENST00000529193.1 non-canonical splice acceptor site between exons 11 and 12 ENST00000529193.1 suspected genomic sequence error affecting CDS in exon 12 ENST00000530244.1 non-canonical splice acceptor site between exons 11 and 12 ENST00000530244.1 Note that there is a strong possibility of a missing 'g' directly adjacent to the splice acceptor site ENST00000530244.1 suspected genomic sequence error affecting CDS in exon 12 ENST00000528615.1 not organism-supported ENST00000531879.1 NAGNAG at exon 4 ENST00000524984.1 NAGNAG at exon 4 ENST00000532868.1 NAGNAG variation at exon 3 ENST00000532868.1 NAGNAG variation at exon 4 ENST00000421244.2 NP_963291.1 ENST00000534215.1 NAGNAG at exon 4 ENST00000528173.1 NAGNAG at exon 3 ENST00000405308.2 alternative 5' UTR ENST00000441869.1 alternative 5' UTR ENST00000533952.1 alternative 5' UTR ENST00000395566.4 alternative 5' UTR ENST00000407067.1 alternative 5' UTR ENST00000526606.1 alternative 5' UTR ENST00000529192.1 alternative 5' UTR ENST00000532281.1 alternative 5' UTR ENST00000529655.1 alternative 5' UTR ENST00000526508.1 alternative 5' UTR ENST00000526508.1 not organism-supported ENST00000534610.1 not organism-supported ENST00000526078.1 non-canonical splice donor site between exons 1 and 2 ENST00000526078.1 alternative 5' UTR ENST00000525488.1 alternative 5' UTR ENST00000530231.1 not organism-supported ENST00000527333.1 114019 -113976 ENST00000526496.1 alternative 5' UTR ENST00000378618.2 not organism-supported ENST00000532478.1 non-canonical splice donor site between exons 8 and 9 ENST00000532457.1 NAGNAG at exon 9 ENST00000528462.1 alternative 5' UTR ENST00000531226.1 alternative 5' UTR ENST00000525725.1 alternative 5' UTR ENST00000530405.1 alternative 5' UTR ENST00000524509.1 alternative 5' UTR ENST00000436778.1 alternative 5' UTR ENST00000444396.1 alternative 5' UTR ENST00000457932.1 alternative 5' UTR ENST00000412937.1 alternative 5' UTR ENST00000449369.1 alternative 5' UTR ENST00000437276.1 alternative 5' UTR ENST00000405853.3 alternative 5' UTR ENST00000395344.3 NP_001129416.1 ENST00000402192.2 NP_569832.2 ENST00000227163.4 NAGNAG splice site ENST00000227163.4 NP_001129416.1 ENST00000524487.1 not organism-supported ENST00000543178.1 alternative 5' UTR ENST00000535982.1 alternative 5' UTR ENST00000528538.1 alternative 5' UTR ENST00000526277.1 alternative 5' UTR ENST00000525123.1 non-canonical splice donor site between exons 1 and 2 ENST00000528244.1 non-canonical splice donor site between exons 1 and 2 ENST00000532595.1 non-canonical splice donor site between exons 1 and 2 ENST00000529154.1 alternative 5' UTR ENST00000531835.1 non canonical conserved ENST00000530969.1 alternative 5' UTR ENST00000534003.1 not organism-supported ENST00000440289.2 NP_001091973 ENST00000459641.1 unitary_pseudogene ENST00000449290.2 NP_116070 ENST00000425717.1 unitary_pseudogene ENST00000440707.1 unitary_pseudogene ENST00000528418.1 non-canonical splice donor site between exons 3 and 4 ENST00000435756.1 unitary_pseudogene ENST00000417375.1 unitary_pseudogene ENST00000257254.3 NMD exception ENST00000528882.1 non-canonical splice donor site between exons 6 and 7 ENST00000532437.1 alternative 5' UTR ENST00000527207.1 alternative 5' UTR ENST00000525955.1 alternative 5' UTR ENST00000395124.1 alternative 5' UTR ENST00000529554.1 alternative 5' UTR ENST00000530005.1 alternative 5' UTR ENST00000525474.1 alternative 5' UTR ENST00000529112.1 alternative 5' UTR ENST00000529494.1 alternative 5' UTR ENST00000533245.1 alternative 5' UTR ENST00000533235.1 alternative 5' UTR ENST00000524863.1 alternative 5' UTR ENST00000532795.1 alternative 5' UTR ENST00000533051.1 alternative 5' UTR ENST00000529896.1 alternative 5' UTR ENST00000526621.1 alternative 5' UTR ENST00000530316.1 alternative 5' UTR ENST00000529748.1 alternative 5' UTR ENST00000532278.1 alternative 5' UTR ENST00000528450.1 alternative 5' UTR ENST00000534298.1 non-canonical splice acceptor site between exons 2 and 3 ENST00000533263.1 alternative 5' UTR ENST00000525587.1 alternative 5' UTR ENST00000525158.1 alternative 5' UTR ENST00000527022.1 alternative 5' UTR ENST00000405496.1 alternative 5' UTR ENST00000524669.1 alternative 5' UTR ENST00000534711.1 alternative 5' UTR ENST00000534810.1 alternative 5' UTR ENST00000529773.1 alternative 5' UTR ENST00000533905.1 alternative 5' UTR ENST00000525602.1 alternative 5' UTR ENST00000528395.1 subject to nonsense-mediated decay ENST00000528798.1 alternative 5' UTR ENST00000531074.1 subject to nonsense-mediated decay ENST00000527995.1 alternative 5' UTR ENST00000532463.1 alternative 5' UTR ENST00000529986.1 alternative 5' UTR ENST00000358694.6 alternative 5' UTR ENST00000532245.1 alternative 5' UTR ENST00000534579.1 NAGNAG at exon 3 ENST00000526938.1 not organism-supported ENST00000526131.1 non-canonical splice donor site between exons 3 and 4 ENST00000427941.1 unitary_pseudogene ENST00000456493.1 unitary_pseudogene ENST00000389919.4 subject to nonsense-mediated decay ENST00000422974.1 subject to nonsense-mediated decay ENST00000344743.3 NP_964011 ENST00000529732.1 alternative 5' UTR ENST00000532258.1 alternative 5' UTR ENST00000525608.1 alternative 5' UTR ENST00000532726.1 alternative 5' UTR ENST00000534403.1 alternative 5' UTR ENST00000528737.1 alternative 5' UTR ENST00000527629.1 alternative 5' UTR ENST00000531408.1 alternative 5' UTR ENST00000533703.1 alternative 5' UTR ENST00000531147.1 alternative 5' UTR ENST00000529177.1 NP_001171511 ENST00000528805.1 confirm experimentally ENST00000530221.1 alternative 3' UTR ENST00000395032.2 NP_001026836 ENST00000524868.1 alternative 5' UTR ENST00000527254.1 not organism-supported ENST00000534596.1 alternative 5' UTR ENST00000531531.1 alternative 5' UTR ENST00000533409.1 alternative 5' UTR ENST00000425663.1 confirm experimentally ENST00000526086.1 confirm experimentally ENST00000528394.1 confirm experimentally ENST00000534016.1 NP_996823.1 ENST00000530614.1 alternative 5' UTR ENST00000524807.1 alternative 5' UTR ENST00000532491.1 alternative 5' UTR ENST00000530007.1 alternative 5' UTR ENST00000529752.1 not organism-supported ENST00000529108.1 not best-in-genome evidence ENST00000278853.5 NP_997224.2 ENST00000278853.5 not organism-supported ENST00000540407.1 non canonical U12 ENST00000536171.1 alternative 5' UTR ENST00000453848.2 NAGNAG splice site ENST00000005286.4 NAGNAG splice site ENST00000539899.1 non canonical TEC ENST00000537307.1 not organism-supported ENST00000538036.1 alternative 5' UTR ENST00000542337.1 alternative 5' UTR ENST00000543627.1 alternative 5' UTR ENST00000532173.2 alternative 5' UTR ENST00000524968.1 alternative 5' UTR ENST00000536915.1 alternative 5' UTR ENST00000542361.1 alternative 5' UTR ENST00000537364.1 alternative 5' UTR ENST00000539128.1 alternative 5' UTR ENST00000545361.1 alternative 5' UTR ENST00000537680.1 alternative 5' UTR ENST00000448745.1 alternative 5' UTR ENST00000539952.1 alternative 5' UTR ENST00000413232.1 alternative 5' UTR ENST00000450000.1 alternative 5' UTR ENST00000449811.1 alternative 5' UTR ENST00000540717.1 not organism-supported ENST00000535723.1 alternative 5' UTR ENST00000531956.1 alternative 5' UTR ENST00000534223.1 alternative 5' UTR ENST00000529548.1 alternative 5' UTR ENST00000533896.1 alternative 5' UTR ENST00000415229.2 alternative 5' UTR ENST00000257247.7 NP_076965 ENST00000533365.1 alternative 5' UTR ENST00000530285.1 alternative 5' UTR ENST00000528508.1 alternative 5' UTR ENST00000531324.1 alternative 5' UTR ENST00000496634.2 subject to nonsense-mediated decay ENST00000527204.1 alternative 5' UTR ENST00000394773.2 NAGNAG splice site ENST00000278845.4 NAGNAG splice site ENST00000466886.1 alternative 5' UTR ENST00000466671.1 alternative 5' UTR ENST00000525801.1 alternative 5' UTR ENST00000525947.1 alternative 5' UTR ENST00000532208.1 alternative 5' UTR ENST00000528115.1 alternative 5' UTR ENST00000528862.1 alternative 5' UTR ENST00000526490.1 alternative 5' UTR ENST00000531323.1 upstream ATG ENST00000534176.1 alternative 5' UTR ENST00000403734.2 subject to nonsense-mediated decay ENST00000360796.5 NP_001116427 ENST00000407022.3 alternative 5' UTR ENST00000421906.1 alternative 5' UTR ENST00000448568.2 alternative 5' UTR ENST00000524862.1 alternative 5' UTR ENST00000533982.1 alternative 5' UTR ENST00000532818.1 alternative 5' UTR ENST00000464544.1 alternative 5' UTR ENST00000530009.1 alternative 5' UTR ENST00000528874.1 alternative 5' UTR ENST00000530625.1 alternative 5' UTR ENST00000532583.1 alternative 5' UTR ENST00000532276.1 alternative 3' UTR ENST00000530112.1 alternative 3' UTR ENST00000527435.1 not organism-supported ENST00000526261.1 alternative 5' UTR ENST00000529509.1 alternative 5' UTR ENST00000531709.1 NP_001074960.1 ENST00000531709.1 NMD exception ENST00000536401.1 alternative 3' UTR ENST00000529106.1 alternative 5' UTR ENST00000538098.1 alternative 5' UTR ENST00000377891.2 NP_001012680.1 ENST00000544377.1 alternative 5' UTR ENST00000543973.1 alternative 5' UTR ENST00000536524.1 alternative 5' UTR ENST00000540654.1 not organism-supported ENST00000430500.2 alternative 5' UTR ENST00000417740.1 non-canonical splice site between exon 1 and exon 2 ENST00000531535.1 non-canonical splice site between exon 1 and exon 2 ENST00000531535.1 not organism-supported ENST00000326192.5 non-canonical splice site between exon 1 and exon 2 ENST00000332793.6 NP_001034841.3 ENST00000340246.5 NAGNAG splice site ENST00000542238.1 262085 262212 ENST00000508192.1 NP_004945.4 ENST00000508192.1 NAGNAG splice site ENST00000361128.5 NAGNAG splice site ENST00000350490.7 NP_001156769 ENST00000502399.2 NP_059672 ENST00000543220.1 alternative 5' UTR ENST00000540169.1 alternative 5' UTR ENST00000509502.2 NP_059672 ENST00000428192.2 alternative 5' UTR ENST00000546089.1 alternative 5' UTR ENST00000539325.1 alternative 5' UTR ENST00000441250.2 upstream ATG ENST00000441250.2 NP_001122085 ENST00000279206.3 upstream ATG ENST00000309366.4 alternative 5' UTR ENST00000449942.2 alternative 5' UTR ENST00000535135.1 alternative 5' UTR ENST00000540288.1 alternative 3' UTR ENST00000394532.3 alternative 5' UTR ENST00000493798.1 alternative 5' UTR ENST00000538244.1 alternative 5' UTR ENST00000539833.1 alternative 5' UTR ENST00000535675.1 alternative 5' UTR ENST00000543383.1 alternative 5' UTR ENST00000538032.1 alternative 5' UTR ENST00000540370.1 alternative 5' UTR ENST00000394525.2 alternative 5' UTR ENST00000539216.1 alternative 5' UTR ENST00000539086.1 subject to nonsense-mediated decay ENST00000406310.1 NAGNAG splice site ENST00000000442.6 NAGNAG splice site ENST00000405666.1 NAGNAG splice site ENST00000405666.1 alternative 5' UTR ENST00000468670.1 alternative 5' UTR ENST00000463837.1 novel transcript ENST00000494080.1 novel transcript ENST00000494566.1 FLJ37970 ENST00000494566.1 novel transcript ENST00000492980.1 novel transcript ENST00000491320.1 contains a non-canonical splice site ENST00000491320.1 novel transcript ENST00000479965.1 novel transcript ENST00000473405.1 novel transcript ENST00000472524.1 putaitve novel transcript ENST00000316124.2 FLJ37045 ENST00000301891.4 FLJ90743 ENST00000377585.3 FLJ26420 ENST00000460745.1 FLJ90646 ENST00000473690.1 FLJ31175 ENST00000464307.1 FLJ40892 ENST00000377559.3 KIAA0921 ENST00000464324.1 FLJ35533 ENST00000377494.1 FLJ35563 ENST00000377494.1 alternative 5' UTR ENST00000421556.1 FLJ16161 ENST00000377497.3 alternative 5' UTR ENST00000354024.3 alternative 5' UTR ENST00000431822.1 alternative 5' UTR ENST00000394430.1 FLJ42029 ENST00000483742.1 FLJ32985 ENST00000377432.3 FLJ32045 ENST00000377326.3 alternative 5' UTR ENST00000315422.4 alternative 5' UTR ENST00000440873.1 alternative 5' UTR ENST00000450708.1 alternative 5' UTR ENST00000413626.1 alternative 5' UTR ENST00000429702.1 alternative 5' UTR ENST00000424912.1 alternative 5' UTR ENST00000484846.1 FLJ44618 ENST00000359393.2 FLJ40523 ENST00000359393.2 alternative 5' UTR ENST00000433803.1 alternative 5' UTR ENST00000413053.1 FLJ35483 ENST00000377264.3 KIAA0404 ENST00000472525.1 novel transcript ENST00000461701.1 novel transcript FLJ44193 ENST00000526559.1 alternative 5' UTR ENST00000525464.1 not organism-supported ENST00000531401.1 not organism-supported ENST00000531761.1 not organism-supported ENST00000453524.2 not organism-supported ENST00000526289.1 alternative 5' UTR ENST00000526334.1 alternative 5' UTR ENST00000530719.1 not organism-supported ENST00000525544.1 not organism-supported ENST00000524603.1 not organism-supported ENST00000528588.1 alternative 5' UTR ENST00000530673.1 not organism-supported ENST00000526809.1 not organism-supported ENST00000529292.1 not organism-supported ENST00000530750.1 not organism-supported ENST00000531029.1 not organism-supported ENST00000525297.1 not organism-supported ENST00000527548.1 alternative 5' UTR ENST00000527548.1 not organism-supported ENST00000526555.1 not organism-supported ENST00000526555.1 alternative 5' UTR ENST00000530451.1 not organism-supported ENST00000526060.1 not organism-supported ENST00000526060.1 alternative 5' UTR ENST00000528396.1 alternative 5' UTR ENST00000529133.1 alternative 5' UTR ENST00000530571.1 alternative 5' UTR ENST00000527739.1 alternative 5' UTR ENST00000526966.1 alternative 5' UTR ENST00000533129.1 alternative 5' UTR ENST00000533129.1 not organism-supported ENST00000524773.1 alternative 5' UTR ENST00000279247.6 alternative 5' UTR ENST00000528739.1 not organism-supported ENST00000532285.1 alternative 5' UTR ENST00000527189.1 alternative 5' UTR ENST00000531068.1 alternative 5' UTR ENST00000527699.1 alternative 5' UTR ENST00000533909.1 alternative 5' UTR ENST00000527323.1 alternative 5' UTR ENST00000529062.1 not organism-supported ENST00000533419.1 alternative 5' UTR ENST00000530993.1 not organism-supported ENST00000532264.1 not organism-supported ENST00000526898.1 alternative 5' UTR ENST00000533629.1 alternative 5' UTR ENST00000530936.1 alternative 5' UTR ENST00000529962.1 alternative 5' UTR ENST00000524438.1 alternative 5' UTR ENST00000525156.1 alternative 5' UTR ENST00000420247.2 Isoform B ENST00000527630.1 non-canonical splice donor site between exons 14 and 15 ENST00000449319.2 NP_001092254.1 ENST00000530349.1 NP_001092255.1 ENST00000533237.1 (Mus musculus) ENST00000533237.1 not organism-supported ENST00000342202.4 NP_258416.1 ENST00000394217.2 NP_203134.1 ENST00000340313.4 NP_203133.1 ENST00000533361.1 alternative 5' UTR ENST00000526137.1 alternative 5' UTR ENST00000527525.1 alternative 5' UTR ENST00000394224.3 alternative 5' UTR ENST00000525710.1 (Macaca mulatta) ENST00000525710.1 not organism-supported ENST00000531407.1 alternative 5' UTR ENST00000524553.1 alternative 5' UTR ENST00000532134.1 alternative 5' UTR ENST00000530413.1 alternative 5' UTR ENST00000534784.1 alternative 5' UTR ENST00000526975.1 alternative 5' UTR ENST00000533035.1 not organism-supported ENST00000526624.1 alternative 5' UTR ENST00000527378.1 alternative 5' UTR ENST00000455710.2 non-canonical splice donor site between exons 3 and 4 ENST00000438576.2 NP_001129107.1 ENST00000449692.3 NP_113638.2 ENST00000376991.2 not organism-supported ENST00000532620.1 suspected genomic sequence error affecting CDS in exon 1 ENST00000526451.1 alternative 5' UTR ENST00000529964.1 alternative 5' UTR ENST00000533544.1 alternative 5' UTR ENST00000527249.1 alternative 5' UTR ENST00000530462.1 alternative 5' UTR ENST00000532707.1 alternative 5' UTR ENST00000527051.1 alternative 5' UTR ENST00000445560.2 alternative 5' UTR ENST00000530204.1 alternative 5' UTR ENST00000533166.1 alternative 5' UTR ENST00000527348.1 alternative 5' UTR ENST00000527878.1 alternative 5' UTR ENST00000528302.1 (Mus musculus x6 mRNAs) ENST00000528302.1 not organism-supported ENST00000531240.1 alternative 5' UTR ENST00000526758.1 alternative 5' UTR ENST00000440228.2 alternative 5' UTR ENST00000394067.2 alternative 5' UTR ENST00000461611.1 alternative 5' UTR ENST00000475757.2 alternative 5' UTR ENST00000394066.2 NP_001128246.1 ENST00000376904.5 non-canonical splice acceptor site between exons 3 and 4 ENST00000425825.2 NP_001020128.1 ENST00000530756.1 alternative 5' UTR ENST00000357440.2 alternative 5' UTR ENST00000544554.1 alternative 5' UTR ENST00000430466.2 NP_733934.1 ENST00000534488.1 NAGNAG splice site ENST00000329819.4 NP_733935.1 ENST00000527230.1 alternative 5' UTR ENST00000531863.1 NAGNAG splice site ENST00000526515.1 NAGNAG splice site ENST00000531314.1 alternative 5' UTR ENST00000531354.2 alternative 5' UTR ENST00000526035.1 NAGNAG splice site ENST00000524994.1 NAGNAG splice site ENST00000524994.1 not organism-supported ENST00000310190.4 not organism-supported ENST00000408993.2 alternative 5' UTR ENST00000530235.1 alternative 5' UTR ENST00000532968.1 alternative 5' UTR ENST00000409406.1 alternative 5' UTR ENST00000525754.1 alternative 5' UTR ENST00000524637.1 not organism-supported ENST00000550837.1 Long isoform ENST00000548810.1 Short isoform ENST00000527010.1 alternative 5' UTR ENST00000524506.1 not organism-supported ENST00000525356.1 not organism-supported ENST00000525457.1 alternative 5' UTR ENST00000527043.1 alternative 5' UTR ENST00000447274.2 NP_997237.2 ENST00000308440.6 alternative 5' UTR ENST00000514166.1 alternative 5' UTR ENST00000556575.1 NAGNAG splice site ENST00000534749.1 alternative 5' UTR ENST00000353903.4 not organism-supported ENST00000446232.1 alternative 5' UTR ENST00000532303.1 alternative 5' UTR ENST00000532343.1 alternative 5' UTR ENST00000528314.1 alternative 5' UTR ENST00000533311.1 not organism-supported ENST00000525827.1 alternative 5' UTR ENST00000528756.1 alternative 5' UTR ENST00000533966.1 Known genomic sequence error (GRC ID HG-391) affecting CDS in exon 3. Missing C between -62347 & -62346 causing a frameshift ENST00000530331.1 Known genomic sequence error (GRC ID HG-391) affecting CDS in exon 7. Missing C between -62347 & -62346 causing a frameshift ENST00000453471.2 alternative 5' UTR ENST00000526339.1 alternative 5' UTR ENST00000525628.1 alternative 5' UTR ENST00000529657.1 alternative 5' UTR ENST00000401547.2 alternative 5' UTR ENST00000453170.1 alternative 5' UTR ENST00000434573.1 alternative 5' UTR ENST00000527280.1 alternative 5' UTR ENST00000528635.1 alternative 5' UTR ENST00000533127.1 alternative 5' UTR ENST00000529344.1 alternative 5' UTR ENST00000265637.4 not organism-supported ENST00000527403.1 not organism-supported ENST00000531244.1 alternative 5' UTR ENST00000450904.2 NP_852616.1 ENST00000308946.3 alternative 5' UTR ENST00000530746.1 alternative 5' UTR ENST00000532024.1 alternative 5' UTR ENST00000346329.3 NP_612632.1 ENST00000527962.1 alternative 5' UTR ENST00000433693.1 non-organism_supported ENST00000470759.1 not organism-supported ENST00000460048.1 not organism-supported ENST00000407721.2 alternative 5' UTR ENST00000526780.1 alternative 5' UTR ENST00000525346.1 alternative 5' UTR ENST00000531364.1 alternative 5' UTR ENST00000527452.1 alternative 5' UTR ENST00000529840.1 alternative 5' UTR ENST00000426628.2 NP_001093123.1 ENST00000533047.1 alternative 5' UTR ENST00000534704.1 alternative 5' UTR ENST00000528184.1 alternative 5' UTR ENST00000393705.4 alternative 5' UTR ENST00000337131.5 alternative 5' UTR ENST00000542977.1 alternative 5' UTR ENST00000537217.1 alternative 5' UTR ENST00000544238.1 alternative 5' UTR ENST00000543937.1 alternative 5' UTR ENST00000543009.1 alternative 5' UTR ENST00000537930.1 alternative 5' UTR ENST00000544129.1 alternative 5' UTR ENST00000535947.1 alternative 5' UTR ENST00000535087.1 alternative 5' UTR ENST00000368959.5 alternative 5' UTR ENST00000541719.1 alternative 5' UTR ENST00000366394.3 alternative 5' UTR ENST00000541641.1 alternative 5' UTR ENST00000535111.1 alternative 5' UTR ENST00000535838.1 alternative 5' UTR ENST00000546131.1 alternative 5' UTR ENST00000538413.1 alternative 5' UTR ENST00000539271.1 alternative 5' UTR ENST00000538478.1 alternative 5' UTR ENST00000542846.1 alternative 5' UTR ENST00000538117.1 NAGNAG splice site ENST00000543587.1 NAGNAG splice site ENST00000545680.1 alternative 5' UTR ENST00000542531.1 NAGNAG splice site ENST00000542531.1 alternative 5' UTR ENST00000535234.1 alternative 5' UTR ENST00000545944.1 alternative 5' UTR ENST00000538393.1 NAGNAG splice site ENST00000538393.1 alternative 5' UTR ENST00000535503.1 NAGNAG splice site ENST00000535503.1 alternative 5' UTR ENST00000538919.1 alternative 5' UTR ENST00000537644.1 NAGNAG splice site ENST00000545333.1 alternative 5' UTR ENST00000539395.1 NAGNAG splice site ENST00000539395.1 alternative 5' UTR ENST00000445078.2 upstream ATG ENST00000393681.2 alternative 5' UTR ENST00000393679.1 alternative 5' UTR ENST00000393676.3 alternative 5' UTR ENST00000539412.1 NAGNAG splice site ENST00000535625.1 alternative 5' UTR ENST00000321324.7 alternative 5' UTR ENST00000540973.1 alternative 5' UTR ENST00000545256.1 alternative 5' UTR ENST00000543234.1 alternative 5' UTR ENST00000537656.1 alternative 5' UTR ENST00000544570.1 NP_001137311 ENST00000538749.1 alternative 5' UTR ENST00000429686.1 NP_001128662 ENST00000427971.2 alternative 5' UTR ENST00000334805.6 alternative 5' UTR ENST00000537947.1 alternative 5' UTR ENST00000542989.1 alternative 5' UTR ENST00000546314.1 alternative 5' UTR ENST00000536290.1 alternative 5' UTR ENST00000540587.1 alternative 5' UTR ENST00000432043.2 NAGNAG splice site ENST00000393597.2 alternative 5' UTR ENST00000393596.2 alternative 5' UTR ENST00000542092.1 alternative 5' UTR ENST00000349767.2 alternative 5' UTR ENST00000393592.2 alternative 5' UTR ENST00000544437.1 alternative 5' UTR ENST00000393591.1 alternative 5' UTR ENST00000540124.1 alternative 5' UTR ENST00000393590.2 alternative 5' UTR ENST00000535931.1 alternative 5' UTR ENST00000538328.1 alternative 5' UTR ENST00000545687.1 alternative 5' UTR ENST00000393580.2 alternative 5' UTR ENST00000545798.1 alternative 5' UTR ENST00000535582.1 alternative 5' UTR ENST00000539549.1 non canonical U12 ENST00000543524.1 alternative 5' UTR ENST00000541597.1 alternative 5' UTR ENST00000535129.1 alternative 5' UTR ENST00000542389.1 alternative 5' UTR ENST00000393571.4 alternative 5' UTR ENST00000539750.1 alternative 5' UTR ENST00000535748.1 alternative 5' UTR ENST00000542366.1 alternative 5' UTR ENST00000497094.2 alternative 5' UTR ENST00000535277.1 alternative 5' UTR ENST00000398483.3 alternative 5' UTR ENST00000537007.1 alternative 5' UTR ENST00000314282.7 alternative 5' UTR ENST00000545127.1 alternative 5' UTR ENST00000537289.1 alternative 5' UTR ENST00000541951.1 alternative 5' UTR ENST00000504441.2 alternative 5' UTR ENST00000543814.1 alternative 5' UTR ENST00000542293.1 NAGNAG splice site ENST00000542293.1 alternative 5' UTR ENST00000544552.1 NAGNAG splice site ENST00000544552.1 alternative 5' UTR ENST00000537753.1 alternative 5' UTR ENST00000539764.1 alternative 5' UTR ENST00000544614.1 alternative 5' UTR ENST00000328257.8 non canonical U12 ENST00000542710.1 non canonical U12 ENST00000398427.4 non canonical U12 ENST00000544401.1 non canonical U12 ENST00000525550.1 alternative 5' UTR ENST00000532569.1 alternative 5' UTR ENST00000531854.1 alternative 5' UTR ENST00000529425.1 alternative 5' UTR ENST00000526855.1 alternative 5' UTR ENST00000528481.1 alternative 5' UTR ENST00000530511.1 alternative 5' UTR ENST00000531615.1 alternative 5' UTR ENST00000527301.1 alternative 3' UTR ENST00000525407.1 alternative 5' UTR ENST00000528219.1 alternative 5' UTR ENST00000531852.1 alternative 5' UTR ENST00000263672.6 non-canonical splice sites between exons 3 and 4 ENST00000294064.4 NP_006647 ENST00000531509.1 alternative 5' UTR ENST00000529024.1 alternative 3' UTR ENST00000413438.1 unitary_pseudogene ENST00000531713.1 alternative 5' UTR ENST00000525650.1 NP_001138684 ENST00000530556.1 alternative 5' UTR ENST00000534004.1 alternative 5' UTR ENST00000527180.1 alternative 5' UTR ENST00000525845.1 alternative 5' UTR ENST00000534186.1 alternative 5' UTR ENST00000428359.2 NP_001138683 ENST00000527446.1 alternative 3' UTR ENST00000528847.1 alternative 5' UTR ENST00000529721.1 alternative 5' UTR ENST00000532435.1 alternative 5' UTR ENST00000358171.3 alternative 5' UTR ENST00000526397.1 alternative 5' UTR ENST00000529643.1 alternative 5' UTR ENST00000532356.1 alternative 5' UTR ENST00000524558.1 alternative 5' UTR ENST00000528990.1 alternative 5' UTR ENST00000533449.1 alternative 5' UTR ENST00000525611.1 alternative 5' UTR ENST00000528760.1 alternative 5' UTR ENST00000533517.1 alternative 5' UTR ENST00000526306.1 alternative 5' UTR ENST00000528264.1 alternative 5' UTR ENST00000533454.1 alternative 5' UTR ENST00000532130.1 alternative 5' UTR ENST00000529461.1 alternative 5' UTR ENST00000404995.1 alternative 3' UTR ENST00000421973.1 alternative 5' UTR ENST00000533752.1 alternative 5' UTR ENST00000525167.1 alternative 5' UTR ENST00000527881.1 alternative 5' UTR ENST00000530243.1 alternative 5' UTR ENST00000533140.1 suspected genomic sequence error affecting CDS in exon 2 ENST00000533140.1 NP_619651.3 ENST00000528622.1 alternative 5' UTR ENST00000527066.1 alternative 5' UTR ENST00000529629.1 alternative 5' UTR ENST00000409709.3 non-canonical splice donor site between exon 38 and 39 ENST00000458637.2 non-canonical splice donor site between exon 38 and 39 ENST00000458637.2 NP_001120652 ENST00000481328.2 non-canonical splice acceptor site between exon 1 and 2 ENST00000458169.2 non-canonical splice donor site between exon 18 and 19 ENST00000485276.1 non-canonical splice donor site between exon 1 and 2 ENST00000529248.1 alternative 5' UTR ENST00000524847.1 alternative 5' UTR ENST00000528592.1 alternative 5' UTR ENST00000528633.1 alternative 5' UTR ENST00000526968.1 alternative 5' UTR ENST00000528364.1 alternative 3' UTR ENST00000308488.6 CCDS8253.1 ENST00000467567.1 FLJ40811 ENST00000526415.1 alternative 5' UTR ENST00000376156.3 NP_001007028 ENST00000525870.1 alternative 5' UTR ENST00000526208.1 alternative 5' UTR ENST00000525447.1 alternative 5' UTR ENST00000529350.1 alternative 5' UTR ENST00000530018.1 alternative 5' UTR ENST00000528776.1 alternative 5' UTR ENST00000529308.1 NP_065849 ENST00000528886.1 alternative 5' UTR ENST00000530915.1 alternative 5' UTR ENST00000529571.1 alternative 5' UTR ENST00000527736.1 alternative 5' UTR ENST00000393399.2 NP_955450 ENST00000531801.1 alternative 5' UTR ENST00000534631.1 alternative 5' UTR ENST00000531128.1 alternative 5' UTR ENST00000534396.1 alternative 5' UTR ENST00000528082.1 alternative 5' UTR ENST00000533126.1 alternative 5' UTR ENST00000534264.1 alternative 5' UTR ENST00000532277.1 alternative 5' UTR ENST00000524921.1 alternative 5' UTR ENST00000532589.1 alternative 5' UTR ENST00000528262.1 alternative 5' UTR ENST00000260056.2 alternative 5' UTR ENST00000527633.1 alternative 5' UTR ENST00000531021.1 alternative 5' UTR ENST00000534301.1 alternative 5' UTR ENST00000526205.1 alternative 5' UTR ENST00000534103.1 alternative 5' UTR ENST00000533276.1 alternative 5' UTR ENST00000528379.1 alternative 5' UTR ENST00000525503.1 alternative 5' UTR ENST00000426717.2 NP_001136174 ENST00000529399.1 alternative 5' UTR ENST00000526822.1 not organism-supported ENST00000525702.1 alternative 5' UTR ENST00000524452.1 confirm experimentally ENST00000527794.1 alternative 5' UTR ENST00000529534.1 alternative 5' UTR ENST00000530894.1 not organism-supported ENST00000534414.1 non-canonical splice donor site between exons 1 and 2 ENST00000526999.1 alternative 5' UTR ENST00000526999.1 not organism-supported ENST00000532221.1 alternative 5' UTR ENST00000524911.1 not organism-supported ENST00000524911.1 alternative 5' UTR ENST00000533577.1 alternative 5' UTR ENST00000525471.1 non-canonical splice acceptor site between exons 1 and 2 ENST00000529676.1 not organism-supported ENST00000524826.1 alternative 5' UTR ENST00000530335.1 alternative 5' UTR ENST00000532471.1 alternative 5' UTR ENST00000526834.1 alternative 5' UTR ENST00000526944.1 alternative 5' UTR ENST00000527521.1 alternative 5' UTR ENST00000531380.1 upstream ATG ENST00000529023.1 not organism-supported ENST00000393297.1 Non-canonical donor splice site at exon eight and non-canonical acceptor splice site at exon nine ENST00000526379.1 alternative 5' UTR ENST00000525540.1 alternative 5' UTR ENST00000525497.1 alternative 5' UTR ENST00000525166.1 not organism-supported ENST00000534747.1 not organism-supported ENST00000530053.1 ORF was found but polya features were not found ENST00000531448.1 not organism-supported ENST00000532819.1 alternative 5' UTR ENST00000525141.1 alternative 5' UTR ENST00000527149.1 alternative 5' UTR ENST00000529714.1 alternative 5' UTR ENST00000526869.1 alternative 5' UTR ENST00000527690.1 alternative 5' UTR ENST00000533585.1 alternative 5' UTR ENST00000528099.1 alternative 5' UTR ENST00000530620.1 alternative 5' UTR ENST00000527003.1 alternative 5' UTR ENST00000530279.1 alternative 5' UTR ENST00000527363.1 alternative 5' UTR ENST00000526335.1 alternative 5' UTR ENST00000533133.1 not organism-supported ENST00000409977.1 not organism-supported ENST00000227638.3 suspected genomic sequence error affecting exon 1 ENST00000440961.2 not organism-supported ENST00000539203.1 (mouse) ENST00000539203.1 not organism-supported ENST00000323929.3 alternative 5' UTR ENST00000323977.3 alternative 5' UTR ENST00000393241.4 NAGNAG splice site ENST00000393241.4 not organism-supported ENST00000393241.4 alternative 5' UTR ENST00000536754.1 NAGNAG splice site ENST00000536754.1 alternative 5' UTR ENST00000538923.1 (in exon 2) ENST00000538923.1 NAGNAG splice site ENST00000538923.1 alternative 5' UTR ENST00000302755.4 alternative 5' UTR ENST00000545018.1 suspected genomic sequencing error affecting CDS in exon 6 ENST00000540722.1 suspected genomic sequencing error affecting CDS in exon 2 ENST00000536839.1 not organism-supported ENST00000542135.1 alternative 5' UTR ENST00000537749.1 alternative 5' UTR ENST00000541365.1 alternative 5' UTR ENST00000536587.1 not organism-supported ENST00000444541.1 alternative 5' UTR ENST00000440572.2 alternative 5' UTR ENST00000423339.2 alternative 5' UTR ENST00000538597.1 alternative 5' UTR ENST00000530203.1 alternative 5' UTR ENST00000528682.1 alternative 5' UTR ENST00000532133.1 not organism-supported ENST00000263464.3 alternative 5' UTR ENST00000532609.1 not organism-supported ENST00000532672.1 not organism-supported ENST00000527465.1 alternative 5' UTR ENST00000528969.1 alternative 5' UTR ENST00000531103.1 alternative 5' UTR ENST00000315274.6 Interstitial collagenase precursor (EC 3.4.24.7) (M atrix metalloproteinase-1) (MMP-1) (Fibroblast collagenase) ENST00000527260.1 not organism-supported ENST00000531543.1 not organism-supported ENST00000527576.1 not organism-supported ENST00000417440.2 alternative 5' UTR ENST00000438448.2 alternative 3' UTR ENST00000532439.1 not organism-supported ENST00000533400.1 alternative 3' UTR ENST00000527177.1 alternative 5' UTR ENST00000531986.1 alternative 5' UTR ENST00000428631.2 alternative 5' UTR ENST00000531011.1 not organism-supported ENST00000530788.1 alternative 5' UTR ENST00000534458.1 alternative 5' UTR ENST00000530108.1 alternative 5' UTR ENST00000531837.1 alternative 5' UTR ENST00000532662.1 alternative 5' UTR ENST00000533423.1 alternative 5' UTR ENST00000282251.5 NM_152434.2 ENST00000389568.3 alternative 5' UTR ENST00000389568.3 not organism-supported ENST00000525934.1 alternative 5' UTR ENST00000532513.1 not organism-supported ENST00000532064.1 not organism-supported ENST00000527805.1 alternative 5' UTR ENST00000532931.1 alternative 5' UTR ENST00000532637.1 not organism-supported ENST00000533470.1 not organism-supported ENST00000531386.1 alternative 5' UTR ENST00000528829.1 alternative 5' UTR ENST00000355430.4 alternative 5' UTR ENST00000526150.1 alternative 5' UTR ENST00000528846.1 alternative 5' UTR ENST00000526216.1 alternative 5' UTR ENST00000456861.2 alternative 5' UTR ENST00000533999.1 alternative 5' UTR ENST00000526272.1 not organism-supported ENST00000530851.1 not organism-supported ENST00000524386.1 not organism-supported ENST00000524880.1 subject to nonsense-mediated decay ENST00000526587.2 not organism-supported ENST00000533475.1 alternative 5' UTR ENST00000527950.1 alternative 5' UTR ENST00000227251.3 not organism-supported ENST00000227251.3 alternative 5' UTR ENST00000531198.1 alternative 5' UTR ENST00000531198.1 not organism-supported ENST00000527899.1 alternative 5' UTR ENST00000529647.1 alternative 5' UTR ENST00000529647.1 not organism-supported ENST00000533879.1 alternative 5' UTR ENST00000527616.1 subject to nonsense-mediated decay ENST00000534100.1 subject to nonsense-mediated decay ENST00000529342.1 not organism-supported ENST00000529342.1 alternative 5' UTR ENST00000420986.2 alternative 5' UTR ENST00000526879.1 alternative 5' UTR ENST00000525785.1 alternative 5' UTR ENST00000531378.1 not organism-supported ENST00000504148.2 upstream_atg_15aa ENST00000531744.1 subject to nonsense-mediated decay ENST00000532699.1 subject to nonsense-mediated decay ENST00000528832.1 alternative 5' UTR ENST00000530752.1 alternative 5' UTR ENST00000531169.1 alternative 3' UTR ENST00000530677.1 not organism-supported ENST00000533819.1 not organism-supported ENST00000531838.1 not organism-supported ENST00000524580.1 not organism-supported ENST00000542968.1 alternative 5' UTR ENST00000542616.1 alternative 5' UTR ENST00000539732.1 alternative 5' UTR ENST00000538770.1 alternative 5' UTR ENST00000453129.2 NP_001094859 ENST00000453129.2 not organism-supported ENST00000540438.1 NAGNAG splice site ENST00000545608.1 NAGNAG splice site ENST00000544750.1 alternative 5' UTR ENST00000504030.2 upstream ATG ENST00000544220.1 alternative 5' UTR ENST00000535700.1 alternative 5' UTR ENST00000392996.2 alternative 5' UTR ENST00000299964.3 alternative 5' UTR ENST00000541754.1 alternative 5' UTR ENST00000545255.1 alternative 5' UTR ENST00000540163.1 NAGNAG splice site ENST00000541475.1 NAGNAG splice site ENST00000542140.1 NAGNAG splice site ENST00000544582.1 NAGNAG splice site ENST00000539878.1 alternative 5' UTR ENST00000534921.1 alternative 5' UTR ENST00000389586.4 NP_872301 ENST00000375475.4 non canonical U12 ENST00000541074.1 non canonical U12 ENST00000331581.6 not organism-supported ENST00000431973.1 GENCODE experimental pipeline ENST00000375320.1 alternative 5' UTR ENST00000359492.2 alternative 5' UTR ENST00000375323.1 alternative 5' UTR ENST00000375300.1 KIAA0999 ENST00000532960.1 alternative 5' UTR ENST00000525347.1 alternative 5' UTR ENST00000525531.1 alternative 5' UTR ENST00000278968.6 alternative 5' UTR ENST00000529792.1 alternative 5' UTR ENST00000533863.1 alternative 5' UTR ENST00000530649.1 alternative 5' UTR ENST00000532870.1 alternative 5' UTR ENST00000524507.1 alternative 5' UTR ENST00000532301.1 alternative 5' UTR ENST00000530269.1 alternative 5' UTR ENST00000534428.1 alternative 5' UTR ENST00000530849.1 not organism-supported ENST00000528053.1 not organism-supported ENST00000525734.1 alternative 5' UTR ENST00000527609.1 alternative 5' UTR ENST00000533570.1 alternative 5' UTR ENST00000528014.1 alternative 5' UTR ENST00000260282.4 alternative 5' UTR ENST00000526014.1 alternative 5' UTR ENST00000525565.1 alternative 5' UTR ENST00000524725.1 not organism-supported ENST00000524725.1 alternative 5' UTR ENST00000532749.1 alternative 5' UTR ENST00000528594.1 alternative 5' UTR ENST00000527898.1 not organism-supported ENST00000526070.1 alternative 5' UTR ENST00000526143.1 not organism-supported ENST00000532899.1 alternative 5' UTR ENST00000525859.1 alternative 5' UTR ENST00000527798.1 alternative 5' UTR ENST00000442944.2 alternative 5' UTR ENST00000539986.1 alternative 5' UTR ENST00000535253.1 alternative 5' UTR ENST00000409993.2 alternative 5' UTR ENST00000524604.1 alternative 5' UTR ENST00000449422.2 alternative 5' UTR ENST00000454811.1 alternative 5' UTR ENST00000449394.1 alternative 5' UTR ENST00000422249.1 alternative 5' UTR ENST00000409991.1 alternative 5' UTR ENST00000409109.1 alternative 5' UTR ENST00000530681.1 subject to nonsense-mediated decay ENST00000528522.1 alternative 5' UTR ENST00000524659.1 alternative 5' UTR ENST00000529011.1 alternative 5' UTR ENST00000529495.1 alternative 5' UTR ENST00000532833.1 alternative 5' UTR ENST00000529040.1 alternative 5' UTR ENST00000438375.2 alternative 5' UTR ENST00000533291.1 has ORF but no polyA features ENST00000533291.1 alternative 5' UTR ENST00000529397.1 alternative 5' UTR ENST00000528512.1 alternative 5' UTR ENST00000524726.1 alternative 5' UTR ENST00000392789.2 alternative 5' UTR ENST00000343035.2 not organism-supported ENST00000532636.1 alternative 5' UTR ENST00000227378.3 chimeric clone used as the evidence ENST00000227378.3 alternative 5' UTR ENST00000533238.1 has ORF ENST00000527983.1 has ORF ENST00000532780.1 has ORF ENST00000532167.1 has ORF ENST00000525624.1 alternative 5' UTR ENST00000527387.1 alternative 5' UTR ENST00000524590.1 alternative 5' UTR ENST00000531063.1 has ORF ENST00000527836.1 alternative 5' UTR ENST00000530393.1 alternative 5' UTR ENST00000529691.1 alternative 5' UTR ENST00000528306.1 alternative 5' UTR ENST00000526252.1 alternative 5' UTR ENST00000309154.2 "CCDS31696.1" 76129 77070 (941) ENST00000530025.1 alternative 5' UTR ENST00000419756.2 unitary_pseudogene ENST00000441174.3 NP_116200.2 ENST00000227135.2 alternative 5' UTR ENST00000538940.1 non-submitted evidence ENST00000532407.1 alternative 5' UTR ENST00000279968.4 alternative 5' UTR ENST00000526175.1 alternative 5' UTR ENST00000527271.1 alternative 5' UTR ENST00000531116.1 alternative 5' UTR ENST00000527238.1 alternative 5' UTR ENST00000531212.1 alternative 5' UTR ENST00000558729.1 alternative 5' UTR ENST00000558705.1 alternative 5' UTR ENST00000366139.3 alternative 5' UTR ENST00000527534.1 alternative 5' UTR ENST00000530985.1 Genomic sequence error affecting CDS in second last coding exon. Frame-shift results in a truncation of Sw:O14681.4. No evidence for reference sequence in locus specific transcriptional evidence (mRNAs are Genoscope and are therefore changed) ENST00000529812.1 alternative 5' UTR ENST00000524723.1 alternative 5' UTR ENST00000534430.1 No evidence for reference sequence in locus specific transcriptional evidence (mRNAs are Genoscope and are therefore changed) ENST00000527628.1 No evidence for reference sequence in locus specific transcriptional evidence (mRNAs are Genoscope and are therefore changed) ENST00000527628.1 alternative 5' UTR ENST00000527842.2 alternative 5' UTR ENST00000535422.1 No evidence for reference sequence in locus specific transcriptional evidence (mRNAs are Genoscope and are therefore changed) ENST00000527520.2 alternative 5' UTR ENST00000527131.1 alternative 5' UTR ENST00000527235.2 Will be NMD regarless of genomic sequence error ENST00000527606.1 alternative 5' UTR ENST00000529196.1 alternative 5' UTR ENST00000525652.1 alternative 5' UTR ENST00000525396.1 alternative 5' UTR ENST00000428830.2 alternative 5' UTR ENST00000534685.1 alternative 5' UTR ENST00000533778.1 alternative 5' UTR ENST00000425380.2 alternative 5' UTR ENST00000526028.1 alternative 5' UTR ENST00000534158.1 alternative 5' UTR ENST00000529801.1 alternative 5' UTR ENST00000531586.1 alternative 5' UTR ENST00000527967.1 alternative 5' UTR ENST00000534818.1 alternative 5' UTR ENST00000528985.1 upstream_ATG-4 ENST00000530043.1 alternative 5' UTR ENST00000392680.2 alternative 5' UTR ENST00000526311.1 alternative 5' UTR ENST00000528858.1 alternative 5' UTR ENST00000534452.1 alternative 5' UTR ENST00000392669.2 alternative 5' UTR ENST00000526727.1 alternative 5' UTR ENST00000392665.2 alternative 5' UTR ENST00000324003.3 alternative 5' UTR ENST00000533356.1 alternative 5' UTR ENST00000338350.4 alternative 5' UTR ENST00000533599.1 alternative 5' UTR ENST00000524878.1 alternative 5' UTR ENST00000524567.1 alternative 5' UTR ENST00000524746.1 alternative 5' UTR ENST00000531755.1 alternative 5' UTR ENST00000532225.1 alternative 5' UTR ENST00000526884.1 alternative 5' UTR ENST00000531318.1 alternative 5' UTR ENST00000530356.1 alternative 5' UTR ENST00000532889.1 alternative 3' UTR ENST00000527648.1 not organism-supported ENST00000525485.1 alternative 5' UTR ENST00000534227.1 alternative 5' UTR ENST00000392595.2 alternative 5' UTR ENST00000392594.3 alternative 5' UTR ENST00000524765.1 alternative 3' UTR ENST00000524765.1 alternative 5' UTR ENST00000359674.4 corf ENST00000424061.2 alternative 5' UTR ENST00000536824.1 alternative 5' UTR ENST00000537793.1 alternative 5' UTR ENST00000540180.1 alternative 5' UTR ENST00000535052.1 alternative 5' UTR ENST00000543504.1 alternative 5' UTR ENST00000412006.2 NP_001123618 ENST00000305108.4 corf ENST00000315939.6 corf ENST00000358495.3 corf ENST00000430095.2 alternative 5' UTR ENST00000347735.6 NMD exception ENST00000542302.1 NMD exception ENST00000545948.1 NMD exception ENST00000440394.2 NMD exception ENST00000537031.1 alternative 5' UTR ENST00000310594.3 alternative 5' UTR ENST00000397196.2 corf ENST00000537784.1 alternative 5' UTR ENST00000280663.7 NMD exception ENST00000538027.1 alternative 5' UTR ENST00000335762.5 non canonical conserved ENST00000399655.1 non canonical conserved ENST00000480911.1 non canonical conserved ENST00000399595.1 non canonical conserved ENST00000399644.1 non canonical conserved ENST00000399638.1 non canonical conserved ENST00000399597.1 non canonical conserved ENST00000399621.1 non canonical conserved ENST00000399637.1 non canonical conserved ENST00000399591.1 non canonical conserved ENST00000399641.1 non canonical conserved ENST00000347598.4 non canonical conserved ENST00000399606.1 non canonical conserved ENST00000399601.1 non canonical conserved ENST00000344100.3 non canonical conserved ENST00000399629.1 non canonical conserved ENST00000327702.7 non canonical conserved ENST00000399649.1 non canonical conserved ENST00000402845.3 non canonical conserved ENST00000399603.1 non canonical conserved ENST00000399634.1 non canonical conserved ENST00000399617.1 non canonical conserved ENST00000406454.3 non canonical conserved ENST00000001008.4 corf ENST00000543769.1 non canonical TEC ENST00000540260.1 non canonical TEC ENST00000228799.2 corf ENST00000535350.1 NAGNAG splice site ENST00000538636.1 alternative 5' UTR ENST00000366285.2 alternative 5' UTR ENST00000538700.1 alternative 5' UTR ENST00000358409.2 non-ATG start codon ENST00000540314.1 non-ATG start codon ENST00000540314.1 alternative 5' UTR ENST00000536826.1 non-ATG start codon ENST00000536826.1 alternative 5' UTR ENST00000359864.2 non-ATG start codon ENST00000543035.1 non-ATG start codon ENST00000543035.1 alternative 5' UTR ENST00000443986.2 non-ATG start codon ENST00000333750.5 NAGNAG splice site ENST00000427057.2 alternative 5' UTR ENST00000228820.4 NP_065100.2 ENST00000450737.2 alternative 5' UTR ENST00000545746.1 alternative 5' UTR ENST00000545571.1 NAGNAG splice site ENST00000540967.1 alternative 5' UTR ENST00000536414.1 alternative 5' UTR ENST00000544741.1 subject to nonsense-mediated decay ENST00000382518.1 CD9 antigen (27 kDa diphtheria toxin receptor-associated protein) (DRAP27) ENST00000382515.2 CD9 antigen (27 kDa diphtheria toxin receptor-associated protein) (DRAP27) ENST00000460556.1 Non-canonical donor splice site at exon four and non-canonical acceptor splice site at exon five ENST00000356896.4 NP_001032759 ENST00000537442.1 alternative 5' UTR ENST00000399466.2 alternative 5' UTR ENST00000444704.2 NP_001121057.1 ENST00000467678.1 ORF 24 aa, not NMD ENST00000361959.3 not organism-supported ENST00000540656.1 alternative 5' UTR ENST00000442593.2 alternative 5' UTR ENST00000229251.3 alternative 5' UTR ENST00000539735.1 alternative 5' UTR ENST00000534947.1 alternative 5' UTR ENST00000534877.1 alternative 5' UTR ENST00000543537.1 downstream ATG ENST00000542154.1 alternative 5' UTR ENST00000539187.1 alternative 5' UTR ENST00000523102.1 alternative 5' UTR ENST00000432205.1 alternative 5' UTR ENST00000443597.2 alternative 5' UTR ENST00000415834.1 alternative 5' UTR ENST00000541477.1 alternative 5' UTR ENST00000545045.1 not organism-supported ENST00000396684.2 alternative 5' UTR ENST00000544325.1 alternative 5' UTR ENST00000328916.3 alternative 5' UTR ENST00000360817.5 alternative 5' UTR ENST00000423384.1 alternative 5' UTR ENST00000413211.1 alternative 5' UTR ENST00000403949.1 alternative 5' UTR ENST00000540394.1 gene fragments AC154092.1-001, up to AC154092.1-014 are part of the same gene; an assembly gap between them contains one or more exons ENST00000542220.1 gene fragments AC154092.1-001, up to AC154092.1-014 are part of the same gene; an assembly gap between them contains one or more exons ENST00000458061.2 gene fragments AC154092.1-001, up to AC154092.1-014 are part of the same gene; an assembly gap between them contains one or more exons ENST00000536053.1 gene fragments AC154092.1-001, up to AC154092.1-014 are part of the same gene; an assembly gap between them contains one or more exons ENST00000535233.1 gene fragments AC154092.1-001, up to AC154092.1-014 are part of the same gene; an assembly gap between them contains one or more exons ENST00000543362.1 gene fragments AC154092.1-001, up to AC154092.1-014 are part of the same gene; an assembly gap between them contains one or more exons ENST00000543835.1 gene fragments AC154092.1-001, up to AC154092.1-014 are part of the same gene; an assembly gap between them contains one or more exons ENST00000541042.1 gene fragments AC154092.1-001, up to AC154092.1-014 are part of the same gene; an assembly gap between them contains one or more exons ENST00000541042.1 alternative 5' UTR ENST00000543851.1 gene fragments AC154092.1-001, up to AC154092.1-014 are part of the same gene; an assembly gap between them contains one or more exons ENST00000540242.1 gene fragments AC154092.1-001, up to AC154092.1-014 are part of the same gene; an assembly gap between them contains one or more exons ENST00000538050.1 gene fragments AC154092.1-001, up to AC154092.1-014 are part of the same gene; an assembly gap between them contains one or more exons ENST00000538050.1 alternative 5' UTR ENST00000545466.1 gene fragments AC154092.1-001, up to AC154092.1-014 are part of the same gene; an assembly gap between them contains one or more exons ENST00000536092.1 gene fragments AC154092.1-001, up to AC154092.1-014 are part of the same gene; an assembly gap between them contains one or more exons ENST00000545280.1 gene fragments AC154092.1-001, up to AC154092.1-014 are part of the same gene; an assembly gap between them contains one or more exons ENST00000541953.1 alternative 5' UTR ENST00000535452.1 alternative 5' UTR ENST00000534830.1 alternative 5' UTR ENST00000542539.1 alternative 5' UTR ENST00000540398.1 alternative 5' UTR ENST00000543974.1 alternative 5' UTR ENST00000434354.2 NP_001124495 ENST00000544456.1 alternative 5' UTR ENST00000420616.2 alternative 5' UTR ENST00000396637.3 alternative 5' UTR ENST00000536841.1 alternative 5' UTR ENST00000545845.1 alternative 5' UTR ENST00000399422.4 not organism-supported ENST00000539726.1 alternative 3' UTR ENST00000360345.3 alternative 5' UTR ENST00000340749.5 alternative 5' UTR ENST00000396589.2 alternative 5' UTR ENST00000546234.1 alternative 5' UTR ENST00000542782.1 alternative 5' UTR ENST00000535344.1 alternative 5' UTR ENST00000537557.1 alternative 5' UTR ENST00000535266.1 alternative 5' UTR ENST00000542916.1 alternative 5' UTR ENST00000535383.1 alternative 5' UTR ENST00000535587.1 alternative 5' UTR ENST00000533269.1 alternative 5' UTR ENST00000546241.1 alternative 5' UTR ENST00000360500.3 non-submitted evidence ENST00000402465.3 alternative 5' UTR ENST00000396570.3 alternative 5' UTR ENST00000538603.1 alternative 5' UTR ENST00000442295.2 alternative 5' UTR ENST00000382064.2 alternative 5' UTR ENST00000544889.1 alternative 5' UTR ENST00000541044.1 alternative 5' UTR ENST00000539923.1 alternative 5' UTR ENST00000541459.1 alternative 3' UTR ENST00000540049.1 upstream uORF ENST00000538657.1 alternative 5' UTR ENST00000544916.1 alternative 5' UTR ENST00000541507.1 not organism-supported ENST00000543845.1 alternative 5' UTR ENST00000543159.1 alternative 5' UTR ENST00000404455.2 alternative 5' UTR ENST00000540995.1 NAGNAG splice site ENST00000396507.3 alternative 5' UTR ENST00000414501.2 alternative 5' UTR ENST00000310002.4 NP_922945 ENST00000543484.1 alternative 5' UTR ENST00000545859.1 alternative 5' UTR ENST00000545887.1 alternative 5' UTR ENST00000539170.1 alternative 5' UTR ENST00000544747.1 alternative 5' UTR ENST00000543572.1 subject to nonsense-mediated decay ENST00000539300.1 subject to nonsense-mediated decay ENST00000543812.1 subject to nonsense-mediated decay ENST00000540818.1 alternative 5' UTR ENST00000347831.5 alternative 5' UTR ENST00000542562.1 alternative 5' UTR ENST00000538867.1 alternative 5' UTR ENST00000535345.1 alternative 5' UTR ENST00000541561.1 alternative 5' UTR ENST00000537503.1 upstream ATG ENST00000535904.1 NP_002714.2 ENST00000545626.1 NP_955386.1 ENST00000500254.2 NP_955385.1 ENST00000389362.4 NP_006239.3 ENST00000464885.1 alternative 5' UTR ENST00000266434.4 NMD exception ENST00000540527.1 not organism-supported ENST00000540415.1 not organism-supported ENST00000545735.1 alternative 5' UTR ENST00000543314.1 alternative 5' UTR ENST00000539940.1 alternative 5' UTR ENST00000541207.1 alternative 5' UTR ENST00000540796.1 alternative 5' UTR ENST00000540583.1 subject to nonsense-mediated decay ENST00000534843.1 subject to nonsense-mediated decay ENST00000534831.1 alternative 5' UTR ENST00000542474.1 alternative 5' UTR ENST00000536444.1 NAGNAG splice site ENST00000542967.1 alternative 5' UTR ENST00000534828.1 alternative 5' UTR ENST00000535132.1 alternative 5' UTR ENST00000542991.1 alternative 5' UTR ENST00000541056.1 alternative 5' UTR ENST00000539057.1 alternative 5' UTR ENST00000545769.1 alternative 5' UTR ENST00000428217.2 alternative 5' UTR ENST00000396279.2 alternative 5' UTR ENST00000542514.1 alternative 5' UTR ENST00000536279.1 alternative 5' UTR ENST00000542508.1 alternative 5' UTR ENST00000537574.1 non canonical TEC ENST00000535638.1 not organism-supported ENST00000535328.1 alternative 5' UTR ENST00000541644.1 alternative 5' UTR ENST00000541546.1 alternative 5' UTR ENST00000545895.1 alternative 5' UTR ENST00000542276.1 alternative 5' UTR ENST00000538313.1 alternative 5' UTR ENST00000536465.1 alternative 5' UTR ENST00000393736.3 alternative 5' UTR ENST00000445537.2 alternative 3' UTR ENST00000544244.1 alternative 3' UTR ENST00000543523.1 not organism-supported ENST00000543523.1 alternative 5' UTR ENST00000543612.1 alternative 5' UTR ENST00000546311.1 alternative 5' UTR ENST00000535752.1 alternative 5' UTR ENST00000543363.1 alternative 5' UTR ENST00000536793.1 alternative 5' UTR ENST00000544064.1 alternative 5' UTR ENST00000524480.1 alternative 5' UTR ENST00000533447.1 alternative 5' UTR ENST00000536371.1 alternative 5' UTR ENST00000540126.1 alternative 5' UTR ENST00000538885.1 alternative 5' UTR ENST00000396207.1 alternative 5' UTR ENST00000395815.3 confirm experimentally ENST00000441439.2 alternative 5' UTR ENST00000447609.1 alternative 5' UTR ENST00000320122.6 alternative 5' UTR ENST00000396205.2 not organism-supported ENST00000453727.2 not organism-supported ENST00000540848.1 not organism-supported ENST00000535535.1 alternative 5' UTR ENST00000537304.1 alternative 5' UTR ENST00000534946.1 alternative 5' UTR ENST00000541846.1 alternative 5' UTR ENST00000544754.1 not organism-supported ENST00000539534.1 alternative 5' UTR ENST00000546281.1 alternative 5' UTR ENST00000537757.1 alternative 5' UTR ENST00000546279.1 alternative 5' UTR ENST00000538051.1 alternative 5' UTR ENST00000545436.1 alternative 5' UTR ENST00000540590.1 alternative 5' UTR ENST00000538020.1 alternative 5' UTR ENST00000266497.5 NAGNAG splice site ENST00000318197.6 NAGNAG splice site ENST00000538714.1 NP_001137293.2 ENST00000538305.1 alternative 5' UTR ENST00000501211.2 non canonical TEC ENST00000381545.3 upstream ATG ENST00000543498.1 subject to nonsense-mediated decay ENST00000413682.1 alternative 5' UTR ENST00000422327.1 alternative 5' UTR ENST00000453443.1 alternative 5' UTR ENST00000473830.1 Exon structure found using dotter ENST00000421294.1 alternative 5' UTR ENST00000450590.1 alternative 5' UTR ENST00000435179.1 alternative 5' UTR ENST00000445053.1 using parent gene object as TSS, protein is 34 aa long. Re-initiation occurs ENST00000421287.1 alternative 5' UTR ENST00000416627.1 alternative 5' UTR ENST00000430803.1 alternative 5' UTR ENST00000539393.1 alternative 5' UTR ENST00000240652.3 CCDS8688 ENST00000537593.1 alternative 5' UTR ENST00000421138.2 alternative 5' UTR ENST00000396093.3 alternative 5' UTR ENST00000314748.6 alternative 5' UTR ENST00000542432.1 alternative 5' UTR ENST00000536240.1 alternative 5' UTR ENST00000536964.1 alternative 5' UTR ENST00000539672.1 alternative 5' UTR ENST00000396076.1 alternative 5' UTR ENST00000396075.1 alternative 5' UTR ENST00000450584.1 alternative 5' UTR ENST00000539782.1 alternative 5' UTR ENST00000537950.1 alternative 5' UTR ENST00000544039.1 not organism-supported ENST00000261201.4 NP_005682.2 ENST00000261201.4 pubmed=15034580 ENST00000446597.1 alternative 5' UTR ENST00000539615.1 not organism-supported ENST00000542683.1 not organism-supported ENST00000544281.1 non canonical TEC ENST00000544281.1 not organism-supported ENST00000540703.1 not organism-supported ENST00000543604.1 non canonical TEC ENST00000335148.3 NP_001034570 ENST00000261192.7 upstream uORF ENST00000557489.1 alternative 5' UTR ENST00000354454.3 alternative 5' UTR ENST00000556887.1 alternative 5' UTR ENST00000554942.1 alternative 5' UTR ENST00000547044.1 alternative 5' UTR ENST00000556006.1 not organism-supported ENST00000395987.3 FLJ35783 ENST00000554347.1 alternative 5' UTR ENST00000556885.1 alternative 5' UTR ENST00000556351.1 alternative 5' UTR ENST00000556927.1 alternative 5' UTR ENST00000556402.1 alternative 5' UTR ENST00000556198.1 alternative 5' UTR ENST00000557334.1 not organism-supported ENST00000256078.4 not organism-supported ENST00000543629.1 alternative 3' UTR ENST00000539523.1 alternative 3' UTR ENST00000535907.1 alternative 5' UTR ENST00000542865.1 alternative 5' UTR ENST00000542004.1 alternative 5' UTR ENST00000542315.1 alternative 5' UTR ENST00000537946.1 alternative 5' UTR ENST00000541218.1 alternative 5' UTR ENST00000282884.9 alternative 5' UTR ENST00000545413.1 alternative 5' UTR ENST00000538142.1 alternative 5' UTR ENST00000540266.1 alternative 5' UTR ENST00000422622.2 NP_001129295 ENST00000544548.1 alternative 5' UTR ENST00000537336.1 alternative 5' UTR ENST00000544111.1 alternative 5' UTR ENST00000545600.1 alternative 5' UTR ENST00000429849.2 NP_001073875 ENST00000541191.1 alternative 5' UTR ENST00000540996.1 alternative 5' UTR ENST00000543246.1 alternative 5' UTR ENST00000544969.1 alternative 5' UTR ENST00000457040.2 non canonical TEC ENST00000298876.4 not organism-supported ENST00000535986.1 NP_001138482.1 ENST00000538433.1 alternative 5' UTR ENST00000535575.1 alternative 5' UTR ENST00000536317.1 non canonical U12 ENST00000542660.1 non canonical U12 ENST00000381273.3 not organism-supported ENST00000539239.1 alternative 5' UTR ENST00000539239.1 not organism-supported ENST00000542963.1 not organism-supported ENST00000542963.1 alternative 5' UTR ENST00000534890.1 not organism-supported ENST00000538586.1 alternative 5' UTR ENST00000536442.1 not organism-supported ENST00000543534.1 alternative 5' UTR ENST00000182377.4 alternative 5' UTR ENST00000547759.1 not organism-supported ENST00000549182.1 not organism-supported ENST00000546839.1 alternative 5' UTR ENST00000546839.1 not organism-supported ENST00000550353.1 not organism-supported ENST00000552132.1 alternative 5' UTR ENST00000548441.1 alternative 5' UTR ENST00000318184.5 non canonical TEC ENST00000551659.1 not organism-supported ENST00000552618.1 not organism-supported ENST00000549070.1 non canonical TEC ENST00000540979.1 not organism-supported ENST00000548676.1 NAGNAG splice site ENST00000537108.1 non canonical conserved ENST00000537108.1 not organism-supported ENST00000261177.9 alternative 5' UTR ENST00000415475.2 alternative 5' UTR ENST00000535317.1 downstream ATG ENST00000454658.2 alternative 5' UTR ENST00000539004.1 alternative 5' UTR ENST00000543615.1 alternative 5' UTR ENST00000412352.2 alternative 5' UTR ENST00000538463.1 alternative 5' UTR ENST00000357721.3 alternative 5' UTR ENST00000539633.1 alternative 5' UTR ENST00000537562.1 upstream uORF ENST00000537562.1 alternative 5' UTR ENST00000536761.1 upstream uORF ENST00000542781.1 upstream uORF ENST00000535408.1 alternative 5' UTR ENST00000537960.1 not organism-supported ENST00000537960.1 alternative 5' UTR ENST00000540924.1 alternative 5' UTR ENST00000381054.3 not organism-supported ENST00000381054.3 alternative 5' UTR ENST00000534526.2 not organism-supported ENST00000472289.1 alternative 5' UTR ENST00000551984.1 not organism-supported ENST00000546442.1 not organism-supported ENST00000452533.2 upstream ATG ENST00000358214.5 not organism-supported ENST00000546757.1 not organism-supported ENST00000548490.1 not organism-supported ENST00000340811.4 CCDS31771.1 ENST00000228567.3 not organism-supported ENST00000548633.1 not organism-supported ENST00000547745.1 non canonical conserved ENST00000547108.1 not organism-supported ENST00000405531.3 There is upstream N-terminal sequence additional to that in Tr:Q8IXY6 , but start not found ENST00000324616.5 There is upstream N-terminal sequence additional to that in Tr:Q86WS4 , but start not found ENST00000468200.1 No translation as would be subject to NMD ENST00000465517.1 FLJ20175 ENST00000343742.2 FLJ45829 ENST00000479187.1 FLJ16068 ENST00000479187.1 FLJ16769 ENST00000479187.1 DKFZp686E15222 ENST00000551424.1 alternative 5' UTR ENST00000548005.1 alternative 5' UTR ENST00000552248.1 alternative 5' UTR ENST00000547849.1 alternative 5' UTR ENST00000552913.1 alternative 5' UTR ENST00000445766.2 not organism-supported ENST00000445766.2 alternative 5' UTR ENST00000548696.1 NAGNAG splice site ENST00000548696.1 alternative 5' UTR ENST00000552240.1 alternative 5' UTR ENST00000552108.1 alternative 5' UTR ENST00000551050.1 alternative 5' UTR ENST00000547113.1 alternative 5' UTR ENST00000416848.2 alternative 5' UTR ENST00000551923.1 alternative 5' UTR ENST00000550784.1 alternative 5' UTR ENST00000547156.1 alternative 5' UTR ENST00000549868.1 alternative 5' UTR ENST00000550616.1 alternative 5' UTR ENST00000551736.1 alternative 5' UTR ENST00000395510.2 upstream ATG ENST00000548403.1 not organism-supported ENST00000452445.2 alternative 5' UTR ENST00000333837.4 downstream ATG ENST00000552993.1 alternative 5' UTR ENST00000552993.1 not organism-supported ENST00000548531.1 alternative 5' UTR ENST00000551949.1 alternative 5' UTR ENST00000479608.1 DKFZp686M229 ENST00000480128.1 FLJ30619 ENST00000549049.1 alternative 5' UTR ENST00000439706.1 alternative 5' UTR ENST00000546893.1 alternative 5' UTR ENST00000266579.4 alternative 5' UTR ENST00000547477.1 alternative 5' UTR ENST00000546940.1 alternative 5' UTR ENST00000266581.4 alternative 5' UTR ENST00000550413.1 alternative 5' UTR ENST00000549500.1 alternative 5' UTR ENST00000549630.1 alternative 5' UTR ENST00000551777.1 alternative 5' UTR ENST00000449771.2 AT-AC splicing between exons 13 and 14 ENST00000549151.1 upstream ATG ENST00000482843.1 AT-AC splicing between exons 12 and 13 ENST00000479866.1 AT-AC splicing between exons 11 and 12 ENST00000389212.3 non canonical TEC ENST00000389212.3 alternative 5' UTR ENST00000548919.1 upstream ATG ENST00000548919.1 AT-AC splicing between exons 13 and 14 ENST00000395358.3 AT-AC splicing between exons 13 and 14 ENST00000466322.1 alternative 5' UTR ENST00000495953.2 alternative 5' UTR ENST00000548498.1 alternative 5' UTR ENST00000547002.1 alternative 5' UTR ENST00000549243.1 alternative 5' UTR ENST00000551301.1 non canonical TEC ENST00000548080.1 not organism-supported ENST00000380610.4 non canonical TEC ENST00000427332.2 confirm experimentally ENST00000422254.1 alternative 5' UTR ENST00000447463.1 alternative 5' UTR ENST00000421231.1 alternative 5' UTR ENST00000450805.1 alternative 5' UTR ENST00000417902.1 alternative 5' UTR ENST00000433685.1 alternative 5' UTR ENST00000417107.1 alternative 5' UTR ENST00000445237.2 alternative 5' UTR ENST00000395324.2 alternative 5' UTR ENST00000395324.2 not organism-supported ENST00000546653.1 alternative 5' UTR ENST00000550314.1 alternative 5' UTR ENST00000548664.1 alternative 5' UTR ENST00000552561.1 alternative 5' UTR ENST00000552546.1 non canonical TEC ENST00000449758.2 alternative 5' UTR ENST00000548640.1 non canonical TEC ENST00000546738.1 non canonical TEC ENST00000549518.1 alternative 5' UTR ENST00000550345.1 alternative 5' UTR ENST00000549003.1 alternative 5' UTR ENST00000550924.1 alternative 5' UTR ENST00000549941.1 downstream ATG ENST00000550257.1 downstream ATG ENST00000340802.6 downstream ATG ENST00000546755.1 downstream ATG ENST00000546755.1 alternative 5' UTR ENST00000549366.1 downstream ATG ENST00000552792.1 downstream ATG ENST00000552792.1 alternative 5' UTR ENST00000548288.1 downstream ATG ENST00000548288.1 alternative 5' UTR ENST00000551339.1 alternative 5' UTR ENST00000549022.1 alternative 5' UTR ENST00000547587.1 alternative 5' UTR ENST00000536549.1 alternative 5' UTR ENST00000537754.1 not organism-supported ENST00000536953.1 alternative 5' UTR ENST00000539503.1 alternative 5' UTR ENST00000539503.1 not organism-supported ENST00000545791.1 alternative 5' UTR ENST00000540212.1 alternative 5' UTR ENST00000540782.1 alternative 5' UTR ENST00000548228.1 alternative 5' UTR ENST00000448928.3 NP_001166153 ENST00000547026.1 NP_001166152 ENST00000549125.1 not organism-supported ENST00000548932.1 alternative 5' UTR ENST00000550181.1 alternative 5' UTR ENST00000550342.1 alternative 5' UTR ENST00000548364.1 non canonical polymorphism ENST00000380491.3 non canonical polymorphism ENST00000549398.1 non canonical polymorphism ENST00000551266.1 non canonical polymorphism ENST00000310194.1 NP_001005203 ENST00000549817.1 not organism-supported ENST00000415975.1 unitary_pseudogene ENST00000550347.1 downstream ATG ENST00000553086.1 not organism-supported ENST00000547582.1 not organism-supported ENST00000550870.1 alternative 5' UTR ENST00000548304.1 alternative 5' UTR ENST00000548279.1 NAGNAG splice site ENST00000552812.1 non-splicing mRNA ENST00000547392.1 not organism-supported ENST00000550064.1 not organism-supported ENST00000550834.1 not organism-supported ENST00000552512.1 alternative 5' UTR ENST00000551468.1 alternative 5' UTR ENST00000550607.1 non canonical TEC ENST00000550607.1 alternative 3' UTR ENST00000550607.1 not organism-supported ENST00000541959.1 alternative 5' UTR ENST00000541236.1 alternative 5' UTR ENST00000539611.1 alternative 5' UTR ENST00000545855.1 alternative 5' UTR ENST00000552942.1 not organism-supported ENST00000537495.1 not organism-supported ENST00000420388.1 alternative 5' UTR ENST00000421952.2 NP_055901.2 ENST00000548362.1 non canonical TEC ENST00000547306.1 not organism-supported ENST00000551696.1 not organism-supported ENST00000548950.1 not organism-supported ENST00000551121.1 non-submitted evidence ENST00000547610.1 not organism-supported ENST00000547610.1 alternative 5' UTR ENST00000550675.1 not organism-supported ENST00000417750.1 FLJ10494 ENST00000552577.1 non canonical U12 ENST00000547670.1 non canonical U12 ENST00000551782.1 alternative 5' UTR ENST00000532332.2 NAGNAG splice site ENST00000380327.5 NP_001094090 ENST00000551567.1 alternative 5' UTR ENST00000549441.1 alternative 5' UTR ENST00000550997.1 alternative 5' UTR ENST00000549538.1 alternative 5' UTR ENST00000548654.1 alternative 5' UTR ENST00000550643.1 alternative 5' UTR ENST00000548710.1 alternative 5' UTR ENST00000549179.1 alternative 5' UTR ENST00000548377.1 alternative 5' UTR ENST00000549298.1 alternative 5' UTR ENST00000553127.1 alternative 5' UTR ENST00000551540.1 alternative 5' UTR ENST00000552918.1 alternative 5' UTR ENST00000548777.1 alternative 5' UTR ENST00000552171.1 alternative 5' UTR ENST00000550165.1 alternative 5' UTR ENST00000548334.1 alternative 5' UTR ENST00000548596.1 alternative 5' UTR ENST00000549528.1 alternative 5' UTR ENST00000551063.1 alternative 5' UTR ENST00000548825.1 downstream ATG ENST00000551047.1 not organism-supported ENST00000532262.1 alternative 3' UTR ENST00000548809.1 alternative 5' UTR ENST00000551154.1 alternative 5' UTR ENST00000546796.1 alternative 5' UTR ENST00000549966.1 alternative 5' UTR ENST00000547832.1 alternative 5' UTR ENST00000547187.1 alternative 5' UTR ENST00000548894.1 alternative 5' UTR ENST00000546914.1 alternative 5' UTR ENST00000552699.1 NP_001092046 ENST00000549445.1 alternative 5' UTR ENST00000550951.1 alternative 5' UTR ENST00000549385.1 alternative 5' UTR ENST00000548713.1 alternative 5' UTR ENST00000548201.1 alternative 5' UTR ENST00000550445.1 alternative 5' UTR ENST00000549130.1 alternative 5' UTR ENST00000552370.1 alternative 5' UTR ENST00000395006.4 alternative 5' UTR ENST00000550635.1 alternative 5' UTR ENST00000551733.1 upstream ATG ENST00000427314.2 alternative 5' UTR ENST00000454520.2 alternative 5' UTR ENST00000551016.1 alternative 5' UTR ENST00000547905.1 alternative 5' UTR ENST00000552310.1 alternative 5' UTR ENST00000548824.1 alternative 5' UTR ENST00000548644.1 downstream ATG ENST00000546723.1 alternative 5' UTR ENST00000552921.1 alternative 5' UTR ENST00000546764.1 alternative 5' UTR ENST00000551876.1 alternative 5' UTR ENST00000549777.1 alternative 5' UTR ENST00000550651.1 alternative 5' UTR ENST00000552004.1 alternative 5' UTR ENST00000552438.1 not organism-supported ENST00000548573.1 not organism-supported ENST00000317943.2 alternative 5' UTR ENST00000550654.1 alternative 5' UTR ENST00000548985.1 alternative 5' UTR ENST00000551697.1 not organism-supported ENST00000552491.1 NAGNAG splice site ENST00000547825.1 NAGNAG splice site ENST00000552823.1 NAGNAG splice site ENST00000394943.3 NAGNAG splice site ENST00000341247.4 NAGNAG splice site ENST00000552783.1 NP_001107019 ENST00000552783.1 NAGNAG splice site ENST00000552909.1 NAGNAG splice site ENST00000552720.1 NAGNAG splice site ENST00000552338.1 NAGNAG splice site ENST00000551691.1 alternative 5' UTR ENST00000550592.1 alternative 5' UTR ENST00000550522.1 alternative 5' UTR ENST00000548697.1 alternative 5' UTR ENST00000548993.1 alternative 5' UTR ENST00000518444.1 NAGNAG splice site ENST00000551886.1 NAGNAG splice site ENST00000523389.1 alternative 5' UTR ENST00000520064.1 confirm experimentally ENST00000520064.1 The non-canonical splcie site is conserved in primates and rodents ENST00000347328.5 NP_954660.1 ENST00000550260.1 NAGNAG splice site ENST00000517559.1 alternative 5' UTR ENST00000552445.1 alternative 5' UTR ENST00000552510.1 alternative 5' UTR ENST00000552487.1 alternative 5' UTR ENST00000550502.1 alternative 5' UTR ENST00000546513.1 non canonical TEC ENST00000541174.2 alternative 5' UTR ENST00000547555.1 not organism-supported ENST00000547877.1 . macaque) ENST00000547877.1 not organism-supported ENST00000548981.1 alternative 5' UTR ENST00000552899.1 non canonical conserved ENST00000552899.1 alternative 5' UTR ENST00000546935.1 alternative 5' UTR ENST00000548115.1 NAGNAG splice site ENST00000333640.10 alternative 5' UTR ENST00000550824.1 alternative 5' UTR ENST00000547855.1 alternative 5' UTR ENST00000549732.2 NP_001136267.1 ENST00000449723.2 NP_001129736.1 ENST00000541224.1 NP_064733.3 ENST00000536420.1 alternative 5' UTR ENST00000542485.1 NP_064732.3 ENST00000550984.1 alternative 5' UTR ENST00000252242.4 overlapping uORF ENST00000546577.1 alternative 5' UTR ENST00000549343.1 not organism-supported ENST00000551956.1 upstream ATG ENST00000552551.1 overlapping uORF ENST00000552551.1 alternative 5' UTR ENST00000546897.1 alternative 5' UTR ENST00000546826.1 overlapping uORF ENST00000546826.1 alternative 5' UTR ENST00000547413.1 upstream uORF ENST00000547413.1 alternative 5' UTR ENST00000546542.1 upstream uORF ENST00000550600.1 overlapping uORF ENST00000379902.3 upstream ATG ENST00000546602.1 confirm experimentally ENST00000552570.1 confirm experimentally ENST00000548547.1 not organism-supported ENST00000475890.1 Cysteine sulfinic acid decarboxylase-related protein ENST00000267085.3 NP_057073.4 ENST00000542497.1 NMD exception ENST00000425354.2 Retinoic acid receptor, gamma ENST00000549488.1 not organism-supported ENST00000536324.2 Sw:Q8TDD2.1 ENST00000303846.3 alternative 5' UTR ENST00000547368.1 downstream ATG ENST00000549135.1 alternative 5' UTR ENST00000547717.1 subject to nonsense-mediated decay ENST00000439930.2 confirm experimentally ENST00000549863.1 non canonical conserved ENST00000359462.5 non canonical conserved ENST00000550927.1 non canonical conserved ENST00000546463.1 NP_114366.1 ENST00000552819.1 non canonical conserved ENST00000379777.5 non canonical conserved ENST00000550585.1 non canonical conserved ENST00000548446.1 NMD exception ENST00000243103.2 not organism-supported ENST00000504315.1 alternative 5' UTR ENST00000509328.1 alternative 5' UTR ENST00000508190.1 alternative 5' UTR ENST00000303406.4 alternative 5' UTR ENST00000506595.1 alternative 5' UTR ENST00000514685.1 alternative 5' UTR ENST00000337581.3 alternative 5' UTR ENST00000243112.5 alternative 5' UTR ENST00000401977.2 alternative 5' UTR ENST00000504338.1 alternative 5' UTR ENST00000507904.1 alternative 5' UTR ENST00000504797.1 alternative 5' UTR ENST00000506169.1 alternative 5' UTR ENST00000503306.1 alternative 5' UTR ENST00000550489.1 NAGNAG splice site ENST00000550411.1 alternative 5' UTR ENST00000552562.1 alternative 5' UTR ENST00000550482.1 alternative 3' UTR ENST00000312156.4 alternative 5' UTR ENST00000540264.2 alternative 5' UTR ENST00000553070.1 alternative 5' UTR ENST00000553198.1 not organism-supported ENST00000552848.1 alternative 5' UTR ENST00000551779.1 not organism-supported ENST00000551809.1 alternative 5' UTR ENST00000551109.1 not organism-supported ENST00000552397.1 alternative 5' UTR ENST00000547826.1 not organism-supported ENST00000532804.1 alternative 5' UTR ENST00000532804.1 not organism-supported ENST00000316577.8 alternative 5' UTR ENST00000531122.1 alternative 5' UTR ENST00000526532.1 alternative 5' UTR ENST00000533446.1 alternative 5' UTR ENST00000524668.1 alternative 5' UTR ENST00000533607.1 alternative 5' UTR ENST00000326513.4 unitary_pseudogene ENST00000412200.1 unitary_pseudogene ENST00000414690.2 unitary_pseudogene ENST00000394268.2 unitary_pseudogene ENST00000451403.1 unitary_pseudogene ENST00000452388.1 unitary_pseudogene ENST00000432580.1 unitary_pseudogene ENST00000414917.1 unitary_pseudogene ENST00000419708.1 unitary_pseudogene ENST00000557555.1 not organism-supported ENST00000548925.1 downstream ATG ENST00000548556.1 alternative 5' UTR ENST00000552930.1 alternative 5' UTR ENST00000548082.1 alternative 5' UTR ENST00000420846.2 NP_001035123.1 ENST00000548160.1 alternative 5' UTR ENST00000552692.1 alternative 5' UTR ENST00000257857.4 alternative 5' UTR ENST00000550776.1 alternative 5' UTR ENST00000552164.1 alternative 5' UTR ENST00000551173.1 alternative 5' UTR ENST00000546457.1 alternative 5' UTR ENST00000546799.1 alternative 3' UTR ENST00000548974.1 alternative 5' UTR ENST00000357606.3 alternative 5' UTR ENST00000547445.1 alternative 5' UTR ENST00000546957.1 alternative 5' UTR ENST00000546878.1 alternative 5' UTR ENST00000547015.1 alternative 5' UTR ENST00000555090.1 alternative 5' UTR ENST00000549368.1 alternative 5' UTR ENST00000555025.1 alternative 5' UTR ENST00000551156.1 alternative 5' UTR ENST00000553783.1 alternative 5' UTR ENST00000557080.1 alternative 5' UTR ENST00000432422.3 alternative 5' UTR ENST00000556001.1 alternative 5' UTR ENST00000551707.1 alternative 5' UTR ENST00000549079.1 not organism-supported ENST00000548047.1 not organism-supported ENST00000552882.1 alternative 5' UTR ENST00000548493.1 alternative 5' UTR ENST00000549418.1 alternative 5' UTR ENST00000555408.1 not organism-supported ENST00000553376.1 not organism-supported ENST00000555357.1 not organism-supported ENST00000354056.4 NP_439892 ENST00000554619.1 not organism-supported ENST00000554545.1 not organism-supported ENST00000553116.1 alternative 5' UTR ENST00000548068.1 alternative 5' UTR ENST00000551459.1 alternative 5' UTR ENST00000356124.4 alternative 5' UTR ENST00000266971.3 alternative 5' UTR ENST00000394115.2 alternative 5' UTR ENST00000547586.1 alternative 5' UTR ENST00000548274.1 not organism-supported ENST00000548274.1 alternative 5' UTR ENST00000546833.1 alternative 5' UTR ENST00000550065.1 not organism-supported ENST00000552689.1 alternative 5' UTR ENST00000547167.1 not organism-supported ENST00000547167.1 alternative 5' UTR ENST00000552361.1 alternative 5' UTR ENST00000549282.1 alternative 5' UTR ENST00000552766.1 not organism-supported ENST00000546591.1 alternative 5' UTR ENST00000501597.3 NP_066927.1 ENST00000552345.1 alternative 5' UTR ENST00000551880.1 alternative 5' UTR ENST00000546903.1 alternative 5' UTR ENST00000553066.1 alternative 5' UTR ENST00000551834.1 alternative 5' UTR ENST00000550697.1 NAGNAG splice site ENST00000548580.1 NAGNAG splice site ENST00000293422.5 NAGNAG splice site ENST00000348108.4 NAGNAG splice site ENST00000547649.1 NAGNAG splice site ENST00000547408.1 NAGNAG splice site ENST00000551589.1 NAGNAG splice site ENST00000553056.1 NAGNAG splice site ENST00000549392.1 NAGNAG splice site ENST00000548400.1 NAGNAG splice site ENST00000548293.1 alternative 3' UTR ENST00000548293.1 NAGNAG splice site ENST00000394023.3 NP_001123892 ENST00000394013.2 NP_919339 ENST00000552656.1 alternative 5' UTR ENST00000551711.1 alternative 5' UTR ENST00000552244.1 alternative 5' UTR ENST00000549038.1 alternative 5' UTR ENST00000447747.1 alternative 5' UTR ENST00000399713.2 alternative 5' UTR ENST00000380198.2 alternative 5' UTR ENST00000341463.5 alternative 5' UTR ENST00000424625.1 alternative 5' UTR ENST00000419753.1 alternative 5' UTR ENST00000454355.2 NP_001128667 ENST00000266980.4 alternative 5' UTR ENST00000437277.1 alternative 5' UTR ENST00000433805.2 NP_001092807 ENST00000551814.1 alternative 3' UTR ENST00000550734.1 alternative 5' UTR ENST00000551253.1 alternative 5' UTR ENST00000550655.1 alternative 5' UTR ENST00000551475.1 alternative 5' UTR ENST00000418572.2 NMD likely if extended ENST00000557417.1 non canonical other ENST00000554616.1 non canonical TEC ENST00000552247.1 non canonical other ENST00000552247.1 not organism-supported ENST00000546695.1 alternative 5' UTR ENST00000549506.1 alternative 5' UTR ENST00000552919.1 non canonical other ENST00000552104.1 non canonical TEC ENST00000547808.1 non canonical other ENST00000547250.1 non canonical other ENST00000548647.1 non canonical other ENST00000456859.2 non canonical other ENST00000552540.1 alternative 5' UTR ENST00000393891.4 alternative 5' UTR ENST00000546392.1 alternative 5' UTR ENST00000547914.1 non canonical other ENST00000549259.1 alternative 5' UTR ENST00000546862.1 alternative 5' UTR ENST00000546917.1 alternative 5' UTR ENST00000555159.1 alternative 5' UTR ENST00000555805.1 alternative 5' UTR ENST00000554643.1 alternative 5' UTR ENST00000556650.1 alternative 5' UTR ENST00000554150.1 alternative 5' UTR ENST00000554155.1 alternative 5' UTR ENST00000322165.1 alternative 5' UTR ENST00000415231.1 alternative 5' UTR ENST00000442789.2 alternative 5' UTR ENST00000433964.1 alternative 5' UTR ENST00000342556.6 not organism-supported ENST00000554718.1 NAGNAG splice site ENST00000554718.1 not organism-supported ENST00000543873.2 alternative 5' UTR ENST00000556155.1 alternative 5' UTR ENST00000454075.3 alternative 5' UTR ENST00000555318.1 NAGNAG splice site ENST00000555849.1 alternative 5' UTR ENST00000553499.1 alternative 5' UTR ENST00000553397.1 alternative 5' UTR ENST00000554663.1 alternative 5' UTR ENST00000554825.1 alternative 5' UTR ENST00000557635.1 alternative 5' UTR ENST00000553275.1 alternative 5' UTR ENST00000553489.1 alternative 5' UTR ENST00000429355.2 not organism-supported ENST00000403821.2 not organism-supported ENST00000547262.1 not organism-supported ENST00000448732.1 alternative 5' UTR ENST00000550133.1 non canonical TEC ENST00000532291.1 NP_001153517.1 ENST00000528432.1 alternative 5' UTR ENST00000528467.1 NP_001161081.1 ENST00000550130.1 not organism-supported ENST00000548887.1 alternative 5' UTR ENST00000546805.1 alternative 5' UTR ENST00000546632.1 alternative 5' UTR ENST00000552255.1 alternative 5' UTR ENST00000548550.1 NAGNAG splice site ENST00000552163.1 NAGNAG splice site ENST00000550954.1 not organism-supported ENST00000547989.1 alternative 3' UTR ENST00000551835.1 alternative 5' UTR ENST00000337737.3 alternative 5' UTR ENST00000548198.1 alternative 5' UTR ENST00000333972.7 NP_001104740 ENST00000552798.1 not organism-supported ENST00000548888.1 alternative 5' UTR ENST00000551220.1 alternative 5' UTR ENST00000551035.1 NAGNAG splice site ENST00000257966.8 NAGNAG splice site ENST00000328568.4 not organism-supported ENST00000552254.1 alternative 5' UTR ENST00000552388.1 alternative 5' UTR ENST00000552862.1 alternative 5' UTR ENST00000547853.1 alternative 5' UTR ENST00000324871.7 upstream ATG ENST00000549994.1 alternative 5' UTR ENST00000549257.1 not organism-supported ENST00000552432.1 alternative 5' UTR ENST00000547379.1 alternative 5' UTR ENST00000552024.1 alternative 5' UTR ENST00000552024.1 not organism-supported ENST00000548610.1 alternative 5' UTR ENST00000548610.1 not organism-supported ENST00000551619.1 alternative 5' UTR ENST00000549379.1 alternative 5' UTR ENST00000393632.2 NP_055841.2 ENST00000542209.1 alternative 5' UTR ENST00000540203.1 alternative 5' UTR ENST00000400935.2 alternative 5' UTR ENST00000538890.1 alternative 5' UTR ENST00000540417.1 alternative 5' UTR ENST00000539120.1 alternative 5' UTR ENST00000535664.1 alternative 5' UTR ENST00000538045.1 alternative 5' UTR ENST00000535239.1 alternative 5' UTR ENST00000354636.3 NP_003475 ENST00000446587.2 alternative 5' UTR ENST00000539652.1 subject to nonsense-mediated decay ENST00000457197.2 NP_001135995 ENST00000398016.3 NP_066973 ENST00000543172.1 NAGNAG splice site ENST00000542309.1 alternative 5' UTR ENST00000539540.1 alternative 5' UTR ENST00000541947.1 downstream ATG ENST00000538373.1 alternative 5' UTR ENST00000543747.1 alternative 5' UTR ENST00000319833.6 alternative 5' UTR ENST00000393436.5 alternative 5' UTR ENST00000489473.2 alternative 5' UTR ENST00000422358.2 NAGNAG splice site ENST00000422358.2 alternative 5' UTR ENST00000541167.1 alternative 5' UTR ENST00000538283.1 alternative 5' UTR ENST00000341355.5 NAGNAG splice site ENST00000341355.5 alternative 5' UTR ENST00000537460.1 alternative 5' UTR ENST00000463493.1 Non-canonical donor splice site at exon 1-jel ENST00000545270.1 alternative 5' UTR ENST00000542018.1 alternative 5' UTR ENST00000534899.1 NAGNAG splice site ENST00000534899.1 alternative 5' UTR ENST00000453560.2 NAGNAG splice site ENST00000453560.2 alternative 5' UTR ENST00000540781.1 alternative 5' UTR ENST00000535492.1 NAGNAG splice site ENST00000535492.1 alternative 5' UTR ENST00000485252.2 alternative 5' UTR ENST00000541386.1 alternative 5' UTR ENST00000538877.1 alternative 5' UTR ENST00000545720.1 alternative 5' UTR ENST00000311420.8 exon acceptor site between exon 3 and 4 is one base short of canonical site, according to cDNA AF092845.1 alignment ENST00000544561.1 non canonical U12 ENST00000545204.1 non canonical U12 ENST00000546373.1 alternative 5' UTR ENST00000548954.1 alternative 5' UTR ENST00000547924.1 NAGNAG splice site ENST00000548262.1 alternative 5' UTR ENST00000549781.1 NAGNAG splice site ENST00000547219.1 alternative 5' UTR ENST00000549921.1 alternative 5' UTR ENST00000550316.1 alternative 5' UTR ENST00000548154.1 alternative 5' UTR ENST00000550937.1 alternative 5' UTR ENST00000549092.1 alternative 5' UTR ENST00000550169.1 alternative 5' UTR ENST00000551325.1 alternative 5' UTR ENST00000393372.2 NAGNAG splice site ENST00000547208.1 NAGNAG splice site ENST00000488961.1 NP_689652.2 ENST00000551160.1 alternative 5' UTR ENST00000549760.1 alternative 5' UTR ENST00000553099.1 alternative 5' UTR ENST00000550437.1 subject to nonsense-mediated decay ENST00000552032.1 not organism-supported ENST00000547771.1 not organism-supported ENST00000552231.1 alternative 5' UTR ENST00000547780.1 alternative 5' UTR ENST00000550641.1 alternative 5' UTR ENST00000549750.1 alternative 5' UTR ENST00000551043.1 alternative 5' UTR ENST00000547867.1 alternative 5' UTR ENST00000334414.6 NP_001103224 ENST00000551525.1 NAGNAG splice site ENST00000440835.2 alternative 5' UTR ENST00000549308.1 upstream ATG ENST00000550661.1 alternative 5' UTR ENST00000247829.3 alternative 5' UTR ENST00000546561.1 alternative 5' UTR ENST00000551238.1 alternative 5' UTR ENST00000548802.1 subject to nonsense-mediated decay ENST00000550524.1 alternative 5' UTR ENST00000550787.1 alternative 3' UTR ENST00000482439.2 alternative 5' UTR ENST00000435350.1 FLJ37837 ENST00000549058.1 non canonical conserved ENST00000548427.1 TEC ENST00000552056.1 alternative 3' UTR ENST00000393263.3 alternative 3' UTR ENST00000552147.1 NAGNAG splice site ENST00000542344.1 NAGNAG splice site ENST00000551992.1 alternative 5' UTR ENST00000548273.1 alternative 5' UTR ENST00000551524.1 alternative 5' UTR ENST00000393249.2 NP_001003712 ENST00000393250.4 NAGNAG splice site ENST00000393250.4 alternative 5' UTR ENST00000547540.1 Putative until annotated as biotype NSD (Non-stop decay) ENST00000553139.1 alternative 5' UTR ENST00000549570.1 alternative 5' UTR ENST00000551927.1 alternative 5' UTR ENST00000547544.1 NAGNAG splice site ENST00000547544.1 alternative 5' UTR ENST00000546966.1 alternative 5' UTR ENST00000550669.1 temporarily annotated as putative cds until annotated as NSD (non-stop decay) ENST00000547316.1 alternative 5' UTR ENST00000549464.1 temporarily this is putative cds until annotated as NSD (non-stop decay)-gdr ENST00000393240.3 alternative 5' UTR ENST00000457153.2 NAGNAG splice site ENST00000552074.1 alternative 5' UTR ENST00000547046.1 alternative 5' UTR ENST00000549671.1 alternative 5' UTR ENST00000551304.1 alternative 5' UTR ENST00000552744.1 alternative 5' UTR ENST00000552624.1 NAGNAG splice site ENST00000552624.1 alternative 5' UTR ENST00000446242.2 alternative 5' UTR ENST00000548426.1 alternative 5' UTR ENST00000552637.1 alternative 5' UTR ENST00000546369.1 NP_001137358 ENST00000547103.1 not organism-supported ENST00000298820.3 not organism-supported ENST00000551042.1 reevaluated feb092011: RP11-272K23.1 and RP11-272K23.2 and all their variants are part of the same gene; found no assembly gap, but the missing 3 exons (in between RP11-272K23.1 and RP11-272K23.2) were assembled in the reversed orientation; this might be an assembly error. the 3 exons on the reversed strand is in gene fragment RP11-288D9.1-001 (gdr) ENST00000532722.2 reevaluated feb092011: RP11-272K23.1 and RP11-272K23.2 and all their variants are part of the same gene; found no assembly gap, but the missing 3 exons (in between RP11-272K23.1 and RP11-272K23.2) were assembled in the reversed orientation; this might be an assembly error. the 3 exons on the reversed strand is in gene fragment RP11-288D9.1-001 (gdr) ENST00000532722.2 not organism-supported ENST00000551672.1 reevaluated feb092011: RP11-272K23.1 and RP11-272K23.2 and all their variants are part of the same gene; found no assembly gap, but the missing 3 exons (in between RP11-272K23.1 and RP11-272K23.2) were assembled in the reversed orientation; this might be an assembly error. the 3 exons on the reversed strand is in gene fragment RP11-288D9.1-001 (gdr) ENST00000551672.1 not organism-supported ENST00000548670.1 alternative 5' UTR ENST00000547623.1 alternative 5' UTR ENST00000548200.1 temporarily putative cds, until annotated as NSD (non-stop decay)-gdr ENST00000548575.1 TEC ENST00000549540.1 alternative 5' UTR ENST00000547836.1 alternative 5' UTR ENST00000393212.3 alternative 5' UTR ENST00000332156.1 alternative 5' UTR ENST00000549405.1 alternative 5' UTR ENST00000550460.1 alternative 5' UTR ENST00000552808.1 alternative 5' UTR ENST00000547225.1 alternative 5' UTR ENST00000550553.1 not organism-supported ENST00000551163.1 alternative 5' UTR ENST00000549011.1 alternative 5' UTR ENST00000548755.1 alternative 5' UTR ENST00000428670.3 not organism-supported ENST00000551310.1 alternative 5' UTR ENST00000551767.1 alternative 5' UTR ENST00000552962.1 alternative 5' UTR ENST00000420120.2 NP_598011.1 ENST00000547568.2 NP_598012.1 ENST00000546391.1 alternative 5' UTR ENST00000456569.2 NP_598014.1 ENST00000547937.1 alternative 5' UTR ENST00000552145.1 alternative 5' UTR ENST00000550563.1 alternative 5' UTR ENST00000549513.1 alternative 5' UTR ENST00000418984.3 not organism-supported ENST00000549206.1 alternative 5' UTR ENST00000536696.2 alternative 5' UTR ENST00000548091.1 alternative 5' UTR ENST00000549122.1 alternative 5' UTR ENST00000549887.1 alternative 5' UTR ENST00000551556.1 alternative 5' UTR ENST00000542893.2 alternative 5' UTR ENST00000397809.4 alternative 5' UTR ENST00000547232.1 alternative 5' UTR ENST00000547575.1 alternative 5' UTR ENST00000546527.1 alternative 5' UTR ENST00000546788.1 not organism-supported ENST00000547469.1 alternative 5' UTR ENST00000551840.1 NAGNAG splice site ENST00000393091.2 alternative 5' UTR ENST00000552440.1 not organism-supported ENST00000537435.2 alternative 5' UTR ENST00000551837.1 alternative 5' UTR ENST00000549639.1 alternative 5' UTR ENST00000344911.4 alternative 5' UTR ENST00000552603.1 not organism-supported ENST00000547980.1 alternative 5' UTR ENST00000547249.1 alternative 5' UTR ENST00000552142.1 not organism-supported ENST00000547860.1 alternative 5' UTR ENST00000551816.1 alternative 5' UTR ENST00000552496.1 alternative 5' UTR ENST00000552262.1 alternative 5' UTR ENST00000429527.2 alternative 5' UTR ENST00000554226.1 alternative 5' UTR ENST00000557478.1 alternative 5' UTR ENST00000457368.2 alternative 5' UTR ENST00000556678.1 not organism-supported ENST00000188376.5 alternative 5' UTR ENST00000552981.1 alternative 5' UTR ENST00000549338.1 alternative 5' UTR ENST00000549687.1 alternative 5' UTR ENST00000266754.5 alternative 5' UTR ENST00000550295.1 alternative 5' UTR ENST00000549155.1 upstream ATG ENST00000546991.1 alternative 5' UTR ENST00000552332.1 AA912113 ENST00000551828.1 upstream uORF ENST00000551828.1 alternative 5' UTR ENST00000551092.1 not organism-supported ENST00000548070.1 alternative 5' UTR ENST00000550514.1 alternative 5' UTR ENST00000547509.1 not organism-supported ENST00000550501.1 non canonical TEC ENST00000549145.1 not organism-supported ENST00000551300.1 upstream uORF ENST00000551300.1 non canonical polymorphism ENST00000266743.2 upstream ATG ENST00000266743.2 alternative 5' UTR ENST00000392927.3 upstream ATG ENST00000392927.3 alternative 5' UTR ENST00000392924.1 upstream ATG ENST00000549365.1 non canonical TEC ENST00000551744.1 not organism-supported ENST00000550459.1 alternative 5' UTR ENST00000358383.5 NP_060385.3 ENST00000307000.2 not organism-supported ENST00000551337.1 alternative 5' UTR ENST00000546844.1 alternative 5' UTR ENST00000548048.1 not organism-supported ENST00000552578.1 alternative 5' UTR ENST00000549478.1 upstream uORF ENST00000549478.1 alternative 5' UTR ENST00000553183.1 alternative 5' UTR ENST00000547945.1 alternative 5' UTR ENST00000552940.1 alternative 5' UTR ENST00000546436.1 alternative 5' UTR ENST00000546436.1 not organism-supported ENST00000548660.1 upstream uORF ENST00000548660.1 alternative 5' UTR ENST00000550444.1 upstream uORF ENST00000551727.1 upstream uORF ENST00000551727.1 alternative 5' UTR ENST00000526266.1 alternative 5' UTR ENST00000531691.1 alternative 5' UTR ENST00000531689.1 alternative 5' UTR ENST00000528079.1 alternative 5' UTR ENST00000526580.1 alternative 5' UTR ENST00000529784.1 alternative 5' UTR ENST00000549260.1 NP_001167453.1 ENST00000415674.1 alternative 5' UTR ENST00000411411.1 alternative 5' UTR ENST00000449866.2 alternative 5' UTR ENST00000433540.1 alternative 5' UTR ENST00000424946.1 alternative 5' UTR ENST00000417469.2 alternative 5' UTR ENST00000432951.1 alternative 5' UTR ENST00000552270.1 NAGNAG splice site ENST00000311317.4 confirm experimentally ENST00000550053.1 not organism-supported ENST00000547809.1 confirm experimentally ENST00000553143.1 alternative 5' UTR ENST00000551802.1 alternative 5' UTR ENST00000548428.1 alternative 5' UTR ENST00000551228.1 alternative 5' UTR ENST00000539967.2 not organism-supported ENST00000548914.1 not organism-supported ENST00000280756.4 alternative 5' UTR ENST00000550344.1 alternative 5' UTR ENST00000547081.1 alternative 5' UTR ENST00000551813.1 alternative 5' UTR ENST00000392830.2 alternative 5' UTR ENST00000552029.1 alternative 5' UTR ENST00000548101.1 alternative 5' UTR ENST00000550736.1 alternative 5' UTR ENST00000550496.1 alternative 5' UTR ENST00000549356.1 alternative 3' UTR ENST00000547188.1 alternative 5' UTR ENST00000332082.4 alternative 5' UTR ENST00000550402.1 alternative 5' UTR ENST00000550573.1 alternative 5' UTR ENST00000549466.1 alternative 5' UTR ENST00000549031.1 alternative 5' UTR ENST00000549447.1 alternative 5' UTR ENST00000547567.1 alternative 5' UTR ENST00000541050.1 alternative 5' UTR ENST00000550542.1 not organism-supported ENST00000550032.1 alternative 5' UTR ENST00000551550.1 alternative 5' UTR ENST00000551044.1 alternative 5' UTR ENST00000549215.1 not organism-supported ENST00000547166.1 alternative 5' UTR ENST00000435370.2 alternative 5' UTR ENST00000540305.1 alternative 5' UTR ENST00000536242.1 alternative 5' UTR ENST00000536358.1 alternative 5' UTR ENST00000539864.1 alternative 5' UTR ENST00000434735.2 alternative 5' UTR ENST00000539599.1 alternative 5' UTR ENST00000340074.5 alternative 5' UTR ENST00000539335.1 alternative 5' UTR ENST00000546277.1 alternative 5' UTR ENST00000358906.3 alternative 5' UTR ENST00000418703.2 alternative 5' UTR ENST00000312777.5 alternative 5' UTR ENST00000536408.2 alternative 5' UTR ENST00000551209.1 not organism-supported ENST00000242591.5 alternative 5' UTR ENST00000377685.4 not organism-supported ENST00000409425.1 alternative 5' UTR ENST00000480648.1 non canonical TEC ENST00000397659.4 non canonical TEC ENST00000465802.1 non canonical TEC ENST00000397656.4 non canonical TEC ENST00000495659.2 non canonical TEC ENST00000495659.2 SMINT2004583 ENST00000397655.3 non canonical TEC ENST00000551590.1 non canonical TEC ENST00000242607.8 alternative 5' UTR ENST00000546713.1 alternative 5' UTR ENST00000340766.5 not organism-supported ENST00000547838.1 alternative 5' UTR ENST00000548163.1 alternative 5' UTR ENST00000547710.1 alternative 5' UTR ENST00000551863.1 alternative 5' UTR ENST00000549321.1 alternative 5' UTR ENST00000514615.1 alternative 5' UTR ENST00000549590.1 not organism-supported ENST00000455480.2 NP_001130010.1 ENST00000550037.1 alternative 5' UTR ENST00000549425.1 alternative 5' UTR ENST00000546962.1 alternative 5' UTR ENST00000550233.1 alternative 5' UTR ENST00000549358.1 alternative 5' UTR ENST00000552896.1 alternative 5' UTR ENST00000424576.2 alternative 5' UTR ENST00000549847.1 alternative 5' UTR ENST00000553213.1 alternative 5' UTR ENST00000551291.1 alternative 5' UTR ENST00000548343.1 alternative 5' UTR ENST00000549006.1 alternative 5' UTR ENST00000549736.1 alternative 5' UTR ENST00000548197.1 alternative 5' UTR ENST00000547686.1 alternative 5' UTR ENST00000543106.2 alternative 5' UTR ENST00000551593.1 alternative 5' UTR ENST00000546426.1 alternative 5' UTR ENST00000551748.1 alternative 5' UTR ENST00000546703.1 alternative 5' UTR ENST00000547840.1 alternative 5' UTR ENST00000547728.1 alternative 5' UTR ENST00000549769.1 alternative 5' UTR ENST00000552667.1 alternative 5' UTR ENST00000551198.1 alternative 5' UTR ENST00000415485.3 alternative 5' UTR ENST00000553114.1 alternative 5' UTR ENST00000449768.2 NP_001027903.1 ENST00000546530.1 NAGNAG splice site ENST00000546530.1 alternative 5' UTR ENST00000446861.3 alternative 5' UTR ENST00000548055.1 NAGNAG splice site ENST00000551051.1 NAGNAG splice site ENST00000546727.1 NAGNAG splice site ENST00000335621.6 NP_001138344.1 ENST00000306014.5 NP_076977.3 ENST00000306014.5 NAGNAG splice site ENST00000549271.1 NAGNAG splice site ENST00000549621.1 alternative 5' UTR ENST00000416617.2 not organism-supported ENST00000550873.1 alternative 5' UTR ENST00000551099.1 alternative 5' UTR ENST00000550785.1 NP_001137291.1 ENST00000548465.1 alternative 5' UTR ENST00000552014.1 non canonical conserved ENST00000549181.1 alternative 5' UTR ENST00000549605.1 alternative 5' UTR ENST00000548186.1 alternative 5' UTR ENST00000549372.1 alternative 5' UTR ENST00000403593.4 alternative 5' UTR ENST00000547802.1 alternative 5' UTR ENST00000545145.2 alternative 3' UTR ENST00000392561.3 alternative 3' UTR ENST00000349716.5 NP_542448.1 ENST00000405440.2 alternative 5' UTR ENST00000526441.1 NP_542449.1 ENST00000257575.4 NP_001103373 ENST00000407967.3 NP_116203 ENST00000319176.7 non canonical TEC ENST00000257572.4 NMD exception ENST00000339824.4 non canonical conserved ENST00000545002.1 non canonical conserved ENST00000420967.1 alternative 5' UTR ENST00000392542.2 NP_853556.2 ENST00000535092.1 alternative 5' UTR ENST00000535496.1 not organism-supported ENST00000537945.1 alternative 5' UTR ENST00000419821.2 alternative 5' UTR ENST00000538601.1 not organism-supported ENST00000535570.1 alternative 5' UTR ENST00000541186.1 alternative 5' UTR ENST00000541878.1 alternative 5' UTR ENST00000542902.1 alternative 5' UTR ENST00000542532.1 alternative 5' UTR ENST00000541786.1 alternative 5' UTR ENST00000539872.1 alternative 5' UTR ENST00000543473.1 non canonical conserved ENST00000327554.2 NP_848594.2 ENST00000426426.1 NP_001130006.1 ENST00000541640.1 alternative 5' UTR ENST00000392520.2 not organism-supported ENST00000537607.1 not organism-supported ENST00000397558.2 not organism-supported ENST00000551150.1 alternative 5' UTR ENST00000546564.1 alternative 5' UTR ENST00000552902.1 alternative 5' UTR ENST00000550423.1 alternative 5' UTR ENST00000551783.1 alternative 5' UTR ENST00000551336.1 alternative 5' UTR ENST00000458477.2 NP_079433.3 ENST00000392509.2 alternative 5' UTR ENST00000549649.1 alternative 5' UTR ENST00000548342.1 alternative 5' UTR ENST00000548214.1 alternative 5' UTR ENST00000392508.2 alternative 5' UTR ENST00000550178.1 alternative 5' UTR ENST00000550845.1 alternative 5' UTR ENST00000549989.1 alternative 5' UTR ENST00000539486.1 alternative 5' UTR ENST00000341039.2 NP_937845.1 ENST00000288616.3 NP_112482.1 ENST00000453000.1 upstream uORF ENST00000353487.2 NP_620584.2 ENST00000412367.2 alternative 5' UTR ENST00000404169.3 alternative 5' UTR ENST00000402834.3 not organism-supported ENST00000543477.1 alternative 5' UTR ENST00000544485.1 alternative 5' UTR ENST00000536837.1 alternative 5' UTR ENST00000392465.3 NP_097402.2 ENST00000554868.1 alternative 5' UTR ENST00000557402.1 alternative 5' UTR ENST00000446152.2 not organism-supported ENST00000535560.1 alternative 5' UTR ENST00000542440.1 non canonical U12 ENST00000535274.1 alternative 5' UTR ENST00000535844.1 subject to nonsense-mediated decay ENST00000361654.3 not organism-supported ENST00000540304.1 not organism-supported ENST00000535290.1 alternative 5' UTR ENST00000539080.1 alternative 5' UTR ENST00000536306.1 alternative 5' UTR ENST00000540586.1 alternative 5' UTR ENST00000392441.4 NP_115962.2 ENST00000280560.8 alternative 5' UTR ENST00000392439.3 alternative 5' UTR ENST00000542210.1 alternative 5' UTR ENST00000541244.1 alternative 5' UTR ENST00000545406.1 alternative 5' UTR ENST00000536130.1 alternative 5' UTR ENST00000546132.1 alternative 5' UTR ENST00000543139.1 alternative 5' UTR ENST00000429587.2 alternative 5' UTR ENST00000538446.1 not organism-supported ENST00000535796.1 alternative 5' UTR ENST00000350887.5 alternative 5' UTR ENST00000538744.1 not organism-supported ENST00000539951.1 not organism-supported ENST00000539761.1 alternative 5' UTR ENST00000539551.1 alternative 5' UTR ENST00000545037.1 alternative 5' UTR ENST00000537532.1 alternative 5' UTR ENST00000539644.1 alternative 5' UTR ENST00000392404.3 alternative 5' UTR ENST00000541448.1 alternative 5' UTR ENST00000543017.1 alternative 5' UTR ENST00000337815.4 alternative 5' UTR ENST00000546098.1 alternative 5' UTR ENST00000539501.1 alternative 5' UTR ENST00000546355.1 alternative 5' UTR ENST00000338359.4 alternative 5' UTR ENST00000461081.1 FLJ45889 ENST00000545493.1 alternative 5' UTR ENST00000536769.1 alternative 5' UTR ENST00000541272.1 alternative 5' UTR ENST00000540351.1 alternative 5' UTR ENST00000541645.1 alternative 5' UTR ENST00000535131.1 alternative 5' UTR ENST00000540700.1 alternative 5' UTR ENST00000535859.1 alternative 5' UTR ENST00000542416.1 alternative 5' UTR ENST00000413816.2 not organism-supported ENST00000546060.1 alternative 5' UTR ENST00000539400.1 alternative 5' UTR ENST00000539995.1 alternative 5' UTR ENST00000535956.1 alternative 5' UTR ENST00000542723.1 alternative 5' UTR ENST00000392369.2 alternative 5' UTR ENST00000538548.1 not organism-supported ENST00000545790.1 alternative 5' UTR ENST00000322060.5 not organism-supported ENST00000322060.5 alternative 5' UTR ENST00000538037.1 alternative 5' UTR ENST00000535067.1 upstream_ATG-40 ENST00000537902.1 alternative 5' UTR ENST00000446190.1 FLJ44224 ENST00000454179.2 alternative 5' UTR ENST00000392352.1 FLJ33291 ENST00000392352.1 alternative 5' UTR ENST00000407361.3 alternative 5' UTR ENST00000539205.1 alternative 5' UTR ENST00000332441.3 FLJ33915 ENST00000475841.1 FLJ46340 ENST00000541995.1 alternative 5' UTR ENST00000538356.1 alternative 5' UTR ENST00000542942.1 alternative 5' UTR ENST00000542301.1 not organism-supported ENST00000536121.1 not organism-supported ENST00000539605.1 alternative 5' UTR ENST00000540963.1 alternative 5' UTR ENST00000543758.1 alternative 5' UTR ENST00000539354.1 alternative 5' UTR ENST00000542874.1 alternative 5' UTR ENST00000438628.2 alternative 5' UTR ENST00000543310.1 alternative 5' UTR ENST00000545299.1 alternative 5' UTR ENST00000356456.5 alternative 5' UTR ENST00000538918.1 alternative 5' UTR ENST00000540609.1 alternative 5' UTR ENST00000536877.1 alternative 5' UTR ENST00000426665.2 alternative 5' UTR ENST00000540096.1 subject to nonsense-mediated decay ENST00000228289.5 alternative 5' UTR ENST00000443465.1 novel zinc finger protein pseudogene ENST00000448748.1 putative novel transcript ENST00000456756.1 putative novel transcript ENST00000439212.1 novel pseudogene ENST00000412714.1 putative novel transcript ENST00000443167.1 feminization 1 homolog a (FEM1A) (KIAA1785) pseudogene ENST00000422609.1 putative novel transcript ENST00000477545.1 telomeric repeat binding factor (NIMA-interacting) 1 (TERF1) (TRF, PIN2, TRF1, TRBF1, hTRF1-AS) pseudogene ENST00000447172.1 chromosome 21 open reading frame 70 (C21orf70) pseudogene ENST00000444605.1 putative novel transcript ENST00000446657.1 novel pseudogene ENST00000330492.4 calponin 3, acidic (CNN3) pseudogene ENST00000432501.1 zinc finger protein 267 (ZNF267) pseudogene ENST00000453176.1 novel transcript similar to chromosome 21 open reading frame 15 (C21orf15) ENST00000436585.1 melanoma antigen pseudogene ENST00000457997.1 novel pseudogene ENST00000418741.1 putative novel transcript ENST00000452841.1 KIAA0254 gene product pseudogene ENST00000447784.1 novel transcript ENST00000422082.1 putative novel transcript ENST00000444553.1 PHD finger protein 2 (PHF2) (GRC5) pseudogene ENST00000444553.1 FSH primary response (LRPR1 homolog,rat) 1 (FSHPRH1) pseudogene ENST00000428086.1 novel transcript ENST00000450212.1 putative novel transcript ENST00000425713.1 FSH primary response (LRPR1 homolog,rat) 1 (FSHPRH1) pseudogene ENST00000433721.1 novel pseudogene similar to FLJ33047 ENST00000464959.1 tubulin, alpha 2 ENST00000430383.2 tubulin, alpha 2 ENST00000461875.1 tubulin, alpha 2 ENST00000478439.1 tubulin, alpha 2 ENST00000382988.1 novel protein similar to DMPK-like CDC42-binding protein kinase beta (CDC42BPB) ENST00000442352.1 paraspeckle protein 1 alpha pseudogene ENST00000428785.1 novel transcript ENST00000437057.1 novel transcript ENST00000454044.1 KIAA1074 protein pseudogene ENST00000400109.2 mitochondrial ribosomal protein L3 (MRPL3) (MRL3, RPML3) pseudogene ENST00000413833.1 putative novel transcript ENST00000446672.1 ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1 (ADPRTL1) (PH5P, p193, PARPL, VPARP, VAULT3, KIAA0177) pseudogene ENST00000442144.1 putative novel transcript ENST00000443554.1 putative novel transcript ENST00000382978.1 TPTE and PTEN homologous inositol lipid phosphatase (TPIP) ENST00000440548.1 cytochrome c (HCS) pseudogene ENST00000423023.1 putative novel transcript ENST00000497722.1 putative novel transcript ENST00000471658.1 paraspeckle protein 1 (PSP1) (FLJ10955) ENST00000492741.1 paraspeckle protein 1 (PSP1) (FLJ10955) ENST00000338910.4 paraspeckle protein 1 (PSP1) (FLJ10955) ENST00000427943.1 paraspeckle protein 1 (PSP1) (FLJ10955) ENST00000426340.1 putative novel transcript ENST00000435385.1 sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetygalactosaminide alpha-2,6-sialyltransferase) (SIAT7D) pseudogene ENST00000382909.1 translation different to that published in Em:AF161535 ENST00000535942.1 not organism-supported ENST00000502168.2 not organism-supported ENST00000422148.1 putative novel transcript ENST00000382871.1 alternatively spliced 5' UTR, shares CDS with bA264J4.1.1 ENST00000382871.1 alternatively spliced 5' UTR, shares CDS with bA110K18.1.1 ENST00000382871.1 alternative 5' UTR ENST00000419430.1 HIV-1 rev binding protein 2 (HRB2) (RIP-1)pseudogene ENST00000421863.1 putative novel transcript ENST00000455848.1 putative novel transcript ENST00000241125.3 NP_068773.2 ENST00000458378.1 peptidylpropyl isomerase D (cylophilin D) (PPID) pseudogene ENST00000382812.1 protein translation is different to that published in Sw:Q9Y2S2 due to frame shift, with a resulting loss of 12 residues ENST00000389373.3 alternatively spliced 5' UTR, shares CDS with bA476H16.2.1 ENST00000389373.3 alternative 5' UTR ENST00000461115.1 non-canonical splice site at 2nd exon (gg) ENST00000461115.1 novel transcript ENST00000419313.1 novel pseudogene (FLJ124251 and FLJ14793) ENST00000498088.1 interleukin 17D ENST00000304920.3 interleukin 17D ENST00000468605.1 interleukin 17D ENST00000382758.1 alternative 5' UTR ENST00000444720.1 RAN, member RAS oncogene family (RAN) pseudogene ENST00000255305.6 likely ortholog of mouse exportin 4 (XPO4) ENST00000255305.6 non-canonical splice site at exon (base 3046 in sequence Em:AB051508) ENST00000490513.1 likely ortholog of mouse exportin 4 (XPO4) ENST00000465018.1 likely ortholog of mouse exportin 4 (XPO4) ENST00000417432.1 CCR4-NOT transcription complex, subunit 4 (CNOT4)(NOT4, NOT4H, CLONE243) pseudogene ENST00000424329.1 novel transcript ENST00000440699.1 heterogeneous nuclear ribonucleoprotein A1 (HNRPA1)(HNRNPA1) pseudogene ENST00000454001.1 Laminin receptor 1 (67kD, ribosomal protein SA)(LAMR1)(LRP, p40, RPSA, 37LRP, LAMBR) pseudogene ENST00000472754.1 LATS, large tumor suppressor, homolog 2 (LATS (large tumor suppressor, Drosophila) homolog 2) (LATS2) ENST00000496544.1 LATS, large tumor suppressor, homolog 2 (LATS (large tumor suppressor, Drosophila) homolog 2) (LATS2) ENST00000422510.1 putative novel transcript ENST00000419579.1 ribosomal protein S12 (RPS12) pseudogene ENST00000422501.1 chromosome 9 open reading frame 12 (C9orf12) (INSP5K2, FLJ1316) pseudogene ENST00000471009.1 sin3-associated polypeptide, 18kD (SAP18)(SAP18p) ENST00000443719.1 putative novel transcript ENST00000418437.1 estrogen-related receptor alpha (ESRRA) pseudogene (ERR1, ERRa, ESRL1, NR3B1,ERRalpha) ENST00000424756.1 novel transcript ENST00000434601.1 novel transcript ENST00000411525.1 novel transcript ENST00000423575.1 novel transcript ENST00000400595.3 G protein-coupled receptor kinase 6 (GPRK6)(GRK6) pseudogene ENST00000449535.2 glyceraldehyde-3-phosphate dehydrogenase (GAPD)(GAPDH) pseudogene ENST00000429933.1 putative novel transcript ENST00000400590.3 novel protein ENST00000464055.1 novel protein ENST00000477811.1 novel protein ENST00000494731.1 novel protein ENST00000484277.1 novel protein ENST00000419683.1 H2B histone family, member H (H2BFH)(H2B.h, H2B/h, dJ221C16.8) pseudogene ENST00000430308.1 farnesyltransferase, CAAX box, alpha (FNTA)(FPTA, PGGT1A) pseudogene ENST00000464254.1 ribosomal protein S7 (40S ribosomal protein S7) (RPS7) pseudogene ENST00000461657.1 fibroblast growth factor 9 (glia-activating factor) (FGF9)(GAF, HBFG-9) ENST00000478546.1 fibroblast growth factor 9 (glia-activating factor) (FGF9)(GAF, HBFG-9) ENST00000413124.1 novel transcript ENST00000420914.1 non-metastatic cells 1, protein (NM23A) expressed in (NME1)(NM23, NM23-H1) pseudogene ENST00000450676.1 ferritin, heavy polypeptide 1 (FTH1) pseudogene ENST00000445147.1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 39 (DDX39) (DDXL, MGC8471, MGC8203) pseudogene ENST00000413490.1 ribosomal protein L7a (RPL7A) pseudogene. ENST00000422350.1 novel pseudogene ENST00000445646.1 putative novel transcript ENST00000430708.1 brain abundant, membrane attached signal protein 1 (BASP1) pseudogene ENST00000417358.1 Novel pseudogene ENST00000418454.1 High-mobility group (nonhistone chromosomal) protein pseudogene ENST00000414345.1 putative novel transcript ENST00000452855.1 novel pseudogene ENST00000418445.1 novel FLJ10498 pseudogene ENST00000382292.3 NM_014363.4 ENST00000476776.1 novel protein ENST00000434567.1 ribosomal protein, large, P1 (RPLP1) pseudogene ENST00000443092.1 novel transcript (FLJ32834) ENST00000443778.1 putative novel transcript ENST00000425800.1 putative novel transcript ENST00000382133.4 novel transcript ENST00000417034.1 novel transcript ENST00000439928.1 novel transcript ENST00000430733.1 putative novel transcript ENST00000382071.2 alternative 5' UTR ENST00000382066.1 non canonical splice acceptor site between exon 1 and exon 2 ENST00000449656.1 novel transcript ENST00000423502.1 novel pseudogene ENST00000445572.1 TPTE and PTEN homologous inositol lipid phosphatase (TPIP) pseudogene ENST00000416351.1 putative novel transcript ENST00000455130.1 Paraspeckle protein 1 alpha isoform pseudogene ENST00000453498.1 possibly expressed pseudogene ENST00000453498.1 novel transcript (DKFZp434M082),similar to TPTE and PTEN homologous inositol lipid phosphatase (TPIP) ENST00000440905.1 possibly expresed pseudogene ENST00000440905.1 novel transcript similar to TPTE and PTEN homologous inositol lipid phosphatase (TPIP) ENST00000450973.1 novel transcript similar to TPTE and PTEN homologous inositol lipid phosphatase (TPIP) ENST00000450973.1 possibly a pseudogene ENST00000381946.3 ATPase, H+/K+ transporting, nongastric, alpha polypeptide ENST00000431005.1 ribosomal protein L26 (RPL26) pseudogene ENST00000438849.2 irquois homeobox protein pseudogene ENST00000457591.1 novel pseudogene ENST00000418120.1 novel protein ENST00000471870.1 centromere protein J (LAP, CPAP, LIP1, BM032) ENST00000493190.1 centromere protein J (LAP, CPAP, LIP1, BM032) ENST00000418179.1 centromere protein J (LAP, CPAP, LIP1, BM032) ENST00000420140.1 putative novel transcript ENST00000505530.1 pseudogene similar to part of solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 (SLC25A15) ENST00000428810.1 60S ribisomal protein L34 (RPL34) pseudogene ENST00000413501.1 novel transcript ENST00000457628.1 novel transcript ENST00000435725.1 putative novel transcript ENST00000431134.1 60S ribosomal protein L23a (RPL23A) pseudogene ENST00000482345.1 myotubularin related protein 6 ENST00000381718.3 NP_001008564.1 ENST00000477876.1 novel transcript ENST00000447693.1 transcription elongation factor B (SIII), polypeptide 2 (18kD, elongin B) (TCEB2) (LOC246717) pseudogene ENST00000381648.3 ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2 (ML-1 protein)(IB, ATP, ML-1, ATPIB, DKFZP434B1913) ENST00000466079.1 ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2 (ML-1 protein) (ATP8A2)(IB, ATP, ML-1, ATPIB, DKFZP434B1913) ENST00000447435.1 novel pseudogene ENST00000319420.2 novel protein (LOC222477)(similar to hypothetical protein BC024118) ENST00000439079.1 putative novel transcript ENST00000425846.1 TcD37 homolog (HTCD37) pseudogene ENST00000346166.3 ring finger protein (C3H2C3 type) 6 (RNF6) ENST00000381570.3 ring finger protein (C3H2C3 type) 6 (RNF6) ENST00000498039.1 ring finger protein (C3H2C3 type) 6 (RNF6) ENST00000476347.1 ring finger protein (C3H2C3 type) 6 (RNF6) ENST00000474280.1 ring finger protein (C3H2C3 type) 6 (RNF6) ENST00000431978.1 protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)(PRKRIR) pseudogene ENST00000381527.3 cyclin-dependent kinase 8 (CDK8) ENST00000477277.1 cyclin-dependent kinase 8 (CDK8) ENST00000480323.1 cyclin-dependent kinase 8 (CDK8) ENST00000496788.1 WAS protein family, member 3 (WASP family Verprolin-homologous protein 3) (WASF3)(SCAR3, Scar3, WAVE3, KIAA0900) ENST00000425466.1 ribosomal protein S3A (RPS3A)(FTE1) pseudogene ENST00000413063.1 putative novel transcript ENST00000395943.3 novel pseudogene similar to HSPC123 ENST00000413365.1 ribosomal protein S21 (RPS21) pseudogene ENST00000456044.1 ribosomal protein S20 (RPS20) pseudogene ENST00000440657.1 putative novel transcript ENST00000452222.1 putative novel transcript ENST00000444744.1 putative novel transcript ENST00000473558.1 ribosomal protein L21 (60S ribosomal protein L21) (RPL21)(L21) ENST00000272274.4 ribosomal protein L21 (60S ribosomal protein L21) (RPL21)(L21) ENST00000319826.4 ribosomal protein L21 (60S ribosomal protein L21) (RPL21)(L21) ENST00000326092.4 ribosomal protein L21 (60S ribosomal protein L21) (RPL21)(L21) ENST00000493317.1 ribosomal protein L21 (60S ribosomal protein L21) (RPL21)(L21) ENST00000466550.1 ribosomal protein L21 (60S ribosomal protein L21) (RPL21)(L21) ENST00000483765.1 ribosomal protein L21 (60S ribosomal protein L21) (RPL21)(L21) ENST00000485756.1 ribosomal protein L21 (60S ribosomal protein L21) (RPL21)(L21) ENST00000431171.1 putative novel transcript ENST00000381140.4 NP_002088 ENST00000414095.1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1) pseudogene ENST00000381026.3 similar to ATP synthase (H+ transporting, mitochondrial F1 complex, epsilon subunit) ENST00000241453.7 fms-related tyrosine kinase 3 ENST00000429873.1 novel pseudogene ENST00000380958.3 NP_787050.6 ENST00000421800.1 Eukaryotic initiation factor 4A (eIF4A) pseudogene ENST00000460403.1 novel transcript ENST00000475385.1 novel transcript ENST00000419457.1 cytochrome P450, 51 (lanosterol 14-alpha-demethylase) (CYP51) pseudogene ENST00000422362.1 novel pseudogene ENST00000431530.3 novel protein (KIAA0774) ENST00000380808.2 novel protein (KIAA0774) ENST00000452602.1 novel transcript ENST00000417624.1 novel transcript ENST00000434779.1 novel transcript ENST00000323380.3 novel transcript ENST00000450494.1 alternatively spliced 5' UTR, shares CDS with bA274A8.3.1 ENST00000450494.1 alternative 5' UTR ENST00000452384.1 translocase of inner mitochondrial membrane 8 homolog B (yeast) (TIMM8B) pseudogene ENST00000400540.1 novel protein ENST00000432770.1 putative novel transcript ENST00000435044.1 putative novel transcript ENST00000380615.3 alternative 5' UTR; shares CDS with RP11-374F3.1-002 and RP11-374F3.1-003 ENST00000380615.3 alternative 5' UTR ENST00000380617.3 alternative 5' UTR; shares CDS with RP11-374F3.1-001 and RP11-374F3.1-003 ENST00000380617.3 alternative 5' UTR ENST00000441394.1 alternative 5' UTR; shares CDS with RP11-374F3.1-001 and RP11-374F3.1-002 ENST00000441394.1 alternative 5' UTR ENST00000426225.1 high mobility group box 1 (HMG1, HMG3) ENST00000326004.4 high mobility group box 1 (HMG1, HMG3) ENST00000490788.1 high mobility group box 1 (HMG1, HMG3) ENST00000490788.1 this variant and variants 2 and 4 could be part of the same variant ENST00000398908.2 high mobility group box 1 (HMG1, HMG3) ENST00000398908.2 this variant and variant 5 could be part of the same variant ENST00000468384.1 high mobility group box 1 (HMG1, HMG3) ENST00000468384.1 this variant and variant 5 could be part of the same variant ENST00000393978.2 novel pseudogene ENST00000442257.1 microfibrillar-associated protein 1 (MFAP1) pseudogene ENST00000433704.1 protein tyrosine phosphatase, non-receptor type 2 (PTPN2) pseudogene ENST00000479597.1 arachidonate 5-lipoxygenase-activating protein (FLAP) ENST00000414407.1 putative novel transcript ENST00000440633.1 putative novel transcript ENST00000380482.4 FLJ31073 ENST00000451495.1 putative novel transcript ENST00000411835.1 putative novel transcript ENST00000429200.1 putative novel transcript ENST00000433788.1 novel transcript ENST00000415283.1 putative novel transcript ENST00000425638.1 novel pseudogene ENST00000380406.4 novel protein ENST00000428783.1 novel protein similar to FLJ20897 (LOC196549) ENST00000428419.1 novel transcript ENST00000380250.3 hypothetical protein CG003 (13CDNA73) ENST00000463566.1 novel transcript ENST00000436046.1 hypothetical protein CG003 (13CDNA73) ENST00000477712.1 hypothetical protein CG003 (13CDNA73) ENST00000380217.1 hypothetical protein CG003 (13CDNA73) ENST00000418076.1 putative novel transcript ENST00000533490.1 alternative 5' UTR ENST00000400497.2 interferon-induced protein with tetratricopeptide repeats 1 (IFIT1) pseudogene ENST00000461502.1 novel transcript ENST00000380121.2 novel protein (LOC88532) ENST00000437678.1 ATPase pseudogene ENST00000450112.1 novel transcript ENST00000421002.1 novel transcript ENST00000399365.3 NP_443083.1 ENST00000430637.1 putative novel transcript ENST00000456087.1 putative novel transcript ENST00000344312.4 putative novel transcript ENST00000424853.1 novel transcript ENST00000443576.1 putative novel transcript ENST00000439831.1 putative novel transcript ENST00000454681.1 novel transcript ENST00000445227.1 novel transcript ENST00000437698.1 novel transcript ENST00000442716.1 putative novel transcript ENST00000452207.1 novel transcript ENST00000451853.1 voltage dependent anion channel protein pseudogene ENST00000440160.1 novel transcript ENST00000428706.1 novel transcript ENST00000430917.1 guanidinoacetate N-methyltransferase (GAMT) pseudogene ENST00000379939.1 neurobeachin (BCL8B, FLJ10197, KIAA1544) ENST00000497540.1 neurobeachin (BCL8B, FLJ10197, KIAA1544) ENST00000379922.3 neurobeachin (BCL8B, FLJ10197, KIAA1544) ENST00000461581.1 neurobeachin (BCL8B, FLJ10197, KIAA1544) ENST00000430191.1 putative novel transcript ENST00000453244.1 prohibitin (PHB) pseudogene ENST00000422430.1 putative novel transcript ENST00000456848.1 putative novel transcript ENST00000360631.3 doublecortin and CaM kinase-like 1 (DCLK, KIAA0369) ENST00000379893.1 doublecortin and CaM kinase-like 1 (DCLK, KIAA0369) ENST00000477664.1 doublecortin and CaM kinase-like 1 (DCLK, KIAA0369) ENST00000486239.1 doublecortin and CaM kinase-like 1 (DCLK, KIAA0369) ENST00000460982.1 doublecortin and CaM kinase-like 1 (DCLK, KIAA0369) ENST00000379892.4 doublecortin and CaM kinase-like 1 (DCLK, KIAA0369) ENST00000379881.3 FLJ20449 ENST00000379864.2 novel protein ENST00000510088.1 novel protein ENST00000471781.1 novel transcript ENST00000486683.1 novel protein ENST00000477250.1 novel protein ENST00000485600.1 novel transcript ENST00000494062.1 novel transcript ENST00000491805.1 novel transcript ENST00000460126.1 novel transcript ENST00000475603.1 novel transcript ENST00000482146.1 novel transcript ENST00000480300.1 novel transcript ENST00000495510.1 KIAA0610 protein ENST00000495783.1 novel transcript ENST00000494703.1 novel transcript ENST00000476377.1 novel transcript ENST00000463403.1 cyclin A1 ENST00000491116.1 cyclin A1 ENST00000448609.1 histone pseudogene ENST00000432112.2 glyceraldehyde-3-phosphate dehydrogenase (GAPDH) pseudogene ENST00000453620.1 novel pseudogene ENST00000421226.1 similar to binder of Arl Two (Bart1) ENST00000472888.1 regulatory factor X-associated protein ENST00000437983.1 putative novel transcript ENST00000428620.1 MAP2K1IP1(mitogen-activated protein kinase kinase 1 interacting protein 1) pseudogene ENST00000428062.1 Eukaryotic initiation factor pseudogene ENST00000486410.1 novel transcript ENST00000460230.1 novel transcript ENST00000496689.1 novel transcript ENST00000470423.1 Opa-interacting protein 2 (OIP2) ENST00000356185.3 alternative 5' UTR ENST00000464744.1 alternative 5' UTR ENST00000412619.1 ribosomal protein S12 (RPS12) pseudogene ENST00000414480.1 novel transcript ENST00000497145.1 novel transcript ENST00000379679.1 transient receptor potential cation channel, subfamily C, member 4 ENST00000488717.1 transient receptor potential cation channel, subfamily C, member 4 ENST00000355779.2 transient receptor potential cation channel, subfamily C, member 4 ENST00000358477.2 transient receptor potential cation channel, subfamily C, member 4 ENST00000379673.2 transient receptor potential cation channel, subfamily C, member 4 ENST00000494529.1 transient receptor potential cation channel, subfamily C, member 4 ENST00000420325.1 heat shock 60kD protein 1 (chaperonin) (HSPD1) pseudogene ENST00000434565.1 novel transcript ENST00000451826.1 novel transcript ENST00000454060.1 novel transcript ENST00000239878.4 FLJ38171 ENST00000414161.1 putative novel transcript ENST00000441430.1 novel transcript ENST00000447765.1 peroxiredoxin 3 (PRDX3) pseudogene ENST00000448887.1 putative novel transcript ENST00000424744.1 phospholipase A2, group XII (PLA2G12) pseudogene ENST00000445530.1 novel KIAA0565, KIAA1074 and breast cancer antigen NY-BR-1 containing pseudogene ENST00000492646.1 this variant and variants 3, 4 and 6 could be part of the same variant ENST00000492646.1 putative novel transcript ENST00000379599.2 NP_001017370.1 ENST00000458481.1 NTF2-like export factor 1 (NXT1) pseudogene ENST00000495922.1 lipoma HMGIC fusion partner ENST00000465775.1 component of oligomeric golgi complex 6 (KIAA1134, COD2) ENST00000460701.1 component of oligomeric golgi complex 6 (KIAA1134, COD2) ENST00000418361.1 novel protein similar to RIKEN cDNA A430101B06 gene (MGC1307) pseudogene ENST00000455241.1 novel transcript ENST00000400432.3 putative novel transcript ENST00000400430.2 novel transcript ENST00000400431.2 novel transcript ENST00000473775.1 forkhead box O1A (rhabdomyosarcoma) ENST00000339626.5 ring finger protein 12 (RNF12) pseudogene ENST00000498078.1 mitochondrial ribosomal protein S31 ENST00000461675.1 mitochondrial ribosomal protein S31 ENST00000435009.2 mitochondrial ribosomal protein S31 ENST00000478827.1 solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 (ORNT1) ENST00000458118.1 TPTE and PTEN homologous inositol lipid phosphatase (TPIP) pseudogene ENST00000432905.1 novel transcript similar to TPTE and PTEN homologous inositol lipid phosphatase (TPIP) ENST00000379515.3 novel transcript similar to TPTE and PTEN homologous inositol lipid phosphatase (TPIP) ENST00000467676.1 suppressor of G2 allele of SKP1, S. cerevisiae, homolog of (SGT1) ENST00000494063.1 suppressor of G2 allele of SKP1, S. cerevisiae, homolog of (SGT1) ENST00000304932.3 suppressor of G2 allele of SKP1, S. cerevisiae, homolog of (SGT1) ENST00000498824.1 novel transcript ENST00000405737.2 E74-like factor 1 (ets domain transcription factor) ENST00000379487.3 FLJ10695 ENST00000379485.1 FLJ30271 ENST00000400429.2 calmodulin pseudogene ENST00000379483.3 FLJ34025 ENST00000450245.1 MORF-related gene 15 (MRG15) pseudogene ENST00000473492.1 mitochondrial translational release factor 1 (RF1, MTTRF1) ENST00000379477.1 alternative 5' UTR ENST00000486236.1 novel transcript ENST00000480434.1 mitochondrial translational release factor 1 (RF1, MTTRF1) ENST00000497679.1 novel transcript ENST00000492827.1 mitochondrial translational release factor 1 (RF1, MTTRF1) ENST00000498245.1 mitochondrial translational release factor 1 (RF1, MTTRF1) ENST00000416129.1 ras homolog gene family, member G (rho G) (ARHG) pseudogene ENST00000454403.1 Tubulin beta-chain pseudogene ENST00000419933.1 unitary_pseudogene ENST00000419933.1 seven transmembrane helix receptor pseudogene ENST00000412208.1 seven transmembrane helix receptor pseudogene ENST00000421076.1 olfactory receptor pseudogene ENST00000379359.3 novel protein (RGC32) ENST00000379359.3 translation different to that published in Em:AF036549 ENST00000487837.1 novel protein (RGC32) ENST00000379302.2 novel transcript ENST00000451871.1 lysyl-tRNA synthetase (KARS) pseudogene ENST00000435020.1 ribosomal protein S28 (RPS28) pseudogene ENST00000489851.1 diacylglycerol kinase, eta ENST00000413246.1 putative novel transcript ENST00000403865.2 mitogen-activated protein kinase 6 (MAPK6) pseudogene ENST00000442741.1 fumarate hydratase (FH) pseudogene ENST00000432967.1 putative novel transcript ENST00000453169.1 fatty acid binding protein 3, pseudogene 2 (FABP3P, FABP3-PS) ENST00000313851.1 FLJ40919 ENST00000419514.1 similar to MEST (mesoderm specific transcript (mouse) homolog) ENST00000415620.1 putative novel transcript ENST00000396712.2 novel pseudogene ENST00000425609.1 putative novel transcript ENST00000482207.1 novel transcript ENST00000430744.1 ribosomal protein L36 (RPL36) pseudogene ENST00000434273.1 putative novel transcript ENST00000444442.1 putative novel transcript ENST00000470137.1 novel transcript ENST00000476570.1 Non-canonical splicing between last two exons ENST00000482922.1 novel transcript ENST00000425906.1 alternative 5' UTR ENST00000325686.5 FLJ38725 ENST00000378718.2 diacylglycerol kinase pseudogene ENST00000439707.1 novel transcript ENST00000423211.1 novel transcript ENST00000432331.1 novel transcript ENST00000444663.1 novel transcript ENST00000437867.1 novel transcript ENST00000400419.1 novel protein ENST00000415082.1 novel transcript ENST00000421190.1 putative novel transcript ENST00000474333.1 similar to ribosome associated membrane protein 4 (LOC253406) ENST00000379179.3 similar to ribosome associated membrane protein 4 (LOC253406) ENST00000493476.1 similar to ribosome associated membrane protein 4 (LOC253406) ENST00000432701.1 putative novel transcript ENST00000472477.1 alternative 5' UTR ENST00000493016.1 alternative 5' UTR ENST00000422303.1 downregulated in ovarian cancer 1 (DOC-1) pseudogene ENST00000426509.1 novel transcript ENST00000414562.1 novel transcript ENST00000479068.1 lipopolysaccharide specific response-7 protein (LSR7) ENST00000473119.1 lipopolysaccharide specific response-7 protein (LSR7) ENST00000475139.1 lipopolysaccharide specific response-7 protein (LSR7) ENST00000437748.1 putative novel transcript ENST00000530705.1 FLJ27337 ENST00000379055.1 alternatively spliced 5' UTR, shares CDS with bA290D2.2.2 ENST00000379055.1 alternative 5' UTR ENST00000309246.5 1 ENST00000398357.2 calumenin (CALU) pseudogene ENST00000420177.1 cyclophilin pseudogene ENST00000476702.1 component of oligomeric golgi complex 3 ENST00000465942.1 component of oligomeric golgi complex 3 ENST00000486940.1 component of oligomeric golgi complex 3 ENST00000428659.1 translocase of inner mitochondrial membrane 9 homolog (yeast) (TIMM9) pseudogene ENST00000447446.1 cytochrome c oxidase subunit IV pseudogene ENST00000435067.1 putative novel transcript ENST00000426552.1 aldo-keto reductase family 1, member B10 (aldose reductase) (AKR1B10) pseudogene ENST00000310521.1 FLJ35810 ENST00000428921.1 alternative 5' UTR ENST00000415033.1 novel transcript ENST00000469227.1 lymphocyte cytosolic protein 1 (L-plastin) ENST00000494531.1 lymphocyte cytosolic protein 1 (L-plastin) ENST00000416500.1 alternative 5' UTR ENST00000442275.1 alternative 5' UTR ENST00000460190.1 lymphocyte cytosolic protein 1 (L-plastin) ENST00000510179.1 novel pseudogene ENST00000378787.3 FLJ21562 ENST00000389908.3 NP_079389 ENST00000439642.1 alternative 5' UTR ENST00000416521.1 novel transcript ENST00000458282.1 putative novel transcript ENST00000400428.2 olfactory receptor pseudogene ENST00000478412.1 alternative 5' UTR ENST00000412582.1 this variant and variant 2 could be part of the same variant ENST00000471867.1 this variant and variant 2 could be part of the same variant ENST00000471867.1 esterase D/formylglutathione hydrolase ENST00000495654.1 this variant and variants 4 and 5 could be part of the same variant ENST00000495654.1 esterase D/formylglutathione hydrolase ENST00000430913.1 novel transcript ENST00000452352.1 putative novel transcript ENST00000455126.1 putative novel transcript ENST00000420444.1 guanine nucleotide binding protein (G protein), gamma 5 (GNG5) pseudogene ENST00000432820.1 nucleosome assembly protein 1-like 1 (NAP1L1) pseudogene ENST00000424277.1 ribosomal protein L27a (RPL27A) pseudogene ENST00000417987.1 novel transcript ENST00000435617.1 novel transcript ENST00000493152.1 succinate-CoA ligase, ADP-forming, beta subunit (A-BETA) ENST00000484941.1 succinate-CoA ligase, ADP-forming, beta subunit (A-BETA) ENST00000481279.1 succinate-CoA ligase, ADP-forming, beta subunit (A-BETA) ENST00000467222.1 succinate-CoA ligase, ADP-forming, beta subunit (A-BETA) ENST00000434484.1 succinate-CoA ligase, ADP-forming, beta subunit (A-BETA) ENST00000497202.1 succinate-CoA ligase, ADP-forming, beta subunit (A-BETA) ENST00000423869.1 putative novel transcript ENST00000258662.1 FLJ10956 ENST00000422483.1 novel transcript ENST00000463839.1 integral membrane protein 2B (BRI, FBD, E25B, E3-16) ENST00000433480.2 novel transcript ENST00000436963.1 putative novel transcript ENST00000467505.1 retinoblastoma 1 (including osteosarcoma) ENST00000267163.4 retinoblastoma 1 (including osteosarcoma) ENST00000480491.1 retinoblastoma 1 (including osteosarcoma) ENST00000484879.1 retinoblastoma 1 (including osteosarcoma) ENST00000474415.1 KIAA0649 gene product pseudogene ENST00000452246.1 PEST-containing nuclear protein (PCNP) pseudogene ENST00000482024.1 novel transcript ENST00000452288.1 putative novel transcript ENST00000425350.1 putative novel transcript ENST00000453033.1 proteasome (prosome, macropain) activator subunit 2 (PA28 beta) (PSME2) pseudogene ENST00000492622.1 NP_001073141.1 ENST00000398316.3 NP_055738.3 ENST00000451754.1 RAD17 homolog (S. pombe) pseudogene ENST00000446556.1 cytochrome c oxidase subunit VIIc pseudogene 1 ENST00000447552.1 novel pseudogene ENST00000409308.1 alternative 5' UTR ENST00000410043.1 alternative 5' UTR ENST00000457041.1 alternative 5' UTR ENST00000413278.1 alternative 5' UTR ENST00000409082.1 alternative 5' UTR ENST00000481439.1 CLLL8 protein (CLLD8) ENST00000435400.1 small nuclear ribonucleoprotein polypeptide G (SNRPG) pseudogene ENST00000378319.3 NP_001035533.1 ENST00000467763.1 novel transcript ENST00000426879.1 novel protein (contains putative zinc finger protein NY-REN-34 antigen (LOC51131)) ENST00000485919.1 alternative 5' UTR ENST00000442195.1 alternative 5' UTR ENST00000488958.1 NP_001035534.1 ENST00000495157.1 novel transcript ENST00000460489.1 novel transcript ENST00000488605.1 novel transcript ENST00000378302.2 FLJ39335 ENST00000471984.1 novel transcript ENST00000451812.1 novel pseudogene ENST00000378270.5 emopamil binding related protein, delta8-delta7sterol isomerase related protein (EBRP) ENST00000424106.1 putative novel transcript ENST00000318353.2 meningioma expressed antigen 6 (coiled-coil proline-rich) (MGEA6) pseudogene ENST00000442421.1 alternative 5' UTR ENST00000378183.4 alternative 5' UTR ENST00000378182.3 alternative 5' UTR ENST00000356017.4 ppNP_001007279.1 ENST00000457662.2 alternative 5' UTR ENST00000433070.1 deleted in lymphocytic leukemia, 2 (LEU2, BCMSUN) ENST00000421758.1 deleted in lymphocytic leukemia, 2 (LEU2, BCMSUN) ENST00000449579.1 deleted in lymphocytic leukemia, 2 (LEU2, BCMSUN) ENST00000425586.1 deleted in lymphocytic leukemia, 2 (LEU2, BCMSUN) ENST00000443587.1 deleted in lymphocytic leukemia, 2 (LEU2, BCMSUN) ENST00000438752.1 deleted in lymphocytic leukemia, 2 (LEU2, BCMSUN) ENST00000416253.1 deleted in lymphocytic leukemia, 2 (LEU2, BCMSUN) ENST00000458725.1 deleted in lymphocytic leukemia, 2 (LEU2, BCMSUN) ENST00000435843.1 putative novel transcript ENST00000491341.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000468522.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000491615.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000490577.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000467721.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000463474.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000461527.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000476738.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000468168.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000378180.4 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000469754.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000478860.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000486895.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000486895.1 13 ENST00000484529.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000485007.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000475913.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000473075.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000483444.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000469127.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000463357.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000489542.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000479420.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000474630.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000491482.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000470726.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000480262.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000484869.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000469095.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000483169.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000460525.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000470593.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000462427.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000472136.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000498557.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000484606.1 deleted in lymphocytic leukemia, 1 (BCMS, LEU1) ENST00000425606.1 ribosomal protein L18 (RPL18) pseudogene ENST00000495613.1 suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) (ST13) (HIP, HOP) pseudogene ENST00000445636.1 ribosomal protein L34 (RPL34) pseudogene ENST00000413510.1 novel transcript ENST00000454605.1 novel transcript ENST00000485590.1 guanylate cyclase 1, soluble, beta 2 ENST00000413926.1 putative novel transcript ENST00000399168.2 RPL5 (60S ribosomal protein 5) pseudogene ENST00000322475.7 FLJ30707 ENST00000419898.2 alternative 5' UTR ENST00000521255.1 alternative 5' UTR ENST00000398119.2 NP_001035026.1 ENST00000491189.1 alternative 5' UTR ENST00000485178.1 alternative 5' UTR ENST00000483288.1 alternative 5' UTR ENST00000434512.1 putative novel transcript ENST00000427198.1 ribosomal protein S4, X-linked (RPS4X) pseudogene ENST00000411777.1 small nuclear ribonucleoprotein polypeptide G pseudogene ENST00000433775.1 ATP synthase pseudogene ENST00000413571.1 putative novel transcript ENST00000456688.1 putative novel transcript ENST00000242819.4 FLJ25853 ENST00000454280.1 meningioma-expressed antigen 6/11 (MEA6) (MEA11) pseudogene ENST00000242839.4 ATPase, Cu++ transporting, beta polypeptide (Wilson disease) ENST00000482841.1 ATPase, Cu++ transporting, beta polypeptide (Wilson disease) ENST00000466629.1 ATPase, Cu++ transporting, beta polypeptide (Wilson disease) ENST00000483772.1 ATPase, Cu++ transporting, beta polypeptide (Wilson disease) ENST00000439042.1 fatty acid binding protein pseudogene ENST00000465811.2 not organism-supported ENST00000258597.5 alternative 3' UTR ENST00000258597.5 not organism-supported ENST00000400357.2 upstream ATG ENST00000550841.1 alternative 5' UTR ENST00000451298.1 Possible expressed pseudogene ENST00000451298.1 Novel transcript ENST00000422308.1 possible expressed pseudogene ENST00000422308.1 Novel transcript homology to various transmembrane phosphatase with tensin homology (TPTE) proteins, suggest that this is a expressed unprocessed pseudogene. ENST00000422308.1 novel transcript ENST00000416599.1 Possible expressed pseudogene of MRPS31 (mitochondrial ribosomal protein S31) ENST00000416599.1 Novel transcript ENST00000416599.1 Homology to various transmembrane phosphatase with tensin homology (TPTE) proteins, suggest that this is a expressed unprocessed pseudogene. ENST00000424511.1 Novel transcript ENST00000424511.1 Possible expressed pseudogene ENST00000423686.1 mitochondrial ribosomal protein S31 (MRPS31) pseudogene ENST00000403471.2 TPIP (TPTE and PTEN homologous inositol lipid phosphatase) pseudogene ENST00000258607.5 NP_060674.3 ENST00000443679.1 putative novel transcript ENST00000418237.1 novel transcript ENST00000446689.1 novel transcript ENST00000357495.2 novel protein similar to heterogeneous nuclear ribonucleoprotein A1 (HNRPA1) ENST00000448904.2 NAGNAG splice site ENST00000338862.4 protocadherin 8 ENST00000417989.1 novel transcript ENST00000427299.1 novel transcript ENST00000451744.1 novel transcript ENST00000423442.1 novel transcript ENST00000430567.1 hepatocyte nuclear factor 4, alpha (HNF4A) pseudogene ENST00000431223.1 spermatogenesis associated 2 (SPATA2) pseudogene ENST00000442543.1 mitochondrial cytochrome c oxidase II (MTCO2) pseudogene ENST00000418448.1 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5 (SLC25A5) pseudogene ENST00000484979.1 protocadherin 17 (PCH68, PCDH68) ENST00000377918.3 protocadherin 17 (PCH68, PCDH68) ENST00000454780.1 novel transcript ENST00000435601.1 meningioma expressed antigen 6 (coiled-coil proline-rich) (MGEA6) pseudogene ENST00000425106.1 DnaJ (Hsp40) homolog, subfamily A, member 1 (DNAJA1) pseudogene ENST00000398005.2 high-mobility group pseudogene. ENST00000449146.1 polymerase (RNA) III (DNA directed) polypeptide K (POLR3K) pseudogene ENST00000400324.3 AT/AC splices sites between exons 11 and 12 and also between exons 23 and 24 ENST00000377908.2 AT/AC splices sites between exons 10 and 11 and also between exons 22 and 23 ENST00000400319.1 AT/AC splices sites between exons 9 and 10 and also between exons 21 and 22 ENST00000470420.1 diaphanous homolog 3 (Drosophila) ENST00000267215.4 AT/AC splices sites between exons 11 and 12 and also between exons 23 and 24 ENST00000498416.1 diaphanous homolog 3 (Drosophila) ENST00000435636.1 novel transcript ENST00000422052.1 novel transcript ENST00000432995.1 novel transcript ENST00000428656.1 novel transcript ENST00000423739.1 putative novel transcript ENST00000448913.1 TAR DNA binding protein (TARDBP) pseudogene ENST00000377881.1 continued from bA359P14.3.3 in Em:AL359920; continues as bA459E2.1.3 in Em:AL512666 ENST00000377881.1 novel protein (FLJ21007) ENST00000377881.1 alternatively spliced 5' UTR, shares CDS with bA307D9.1.1 ENST00000377881.1 alternative 5' UTR ENST00000377894.2 novel protein (FLJ21007) ENST00000377882.3 alternatively spliced 5' UTR, shares CDS with bA307D9.1.1 ENST00000377882.3 alternative 5' UTR ENST00000448133.1 eukaryotic translation initiation factor 4A, variant 1 (EIF4A1) pseudogene ENST00000455894.1 novel transcript ENST00000413402.1 novel transcript ENST00000414201.1 putative novel transcript ENST00000409204.3 NM_022843.2 ENST00000409186.1 alternative 5' UTR ENST00000427086.1 ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) (RAC1) pseudogene ENST00000432697.1 putative novel transcript ENST00000455977.1 novel transcript ENST00000422527.1 putative novel transcript ENST00000431656.1 putative novel transcript ENST00000443577.1 ribosomal protein L32 (RPL32) pseudogene ENST00000448411.1 novel transcript ENST00000438352.1 novel transcript ENST00000439454.1 putative novel transcript ENST00000451570.1 novel transcript ENST00000444536.1 novel transcript ENST00000418943.1 putative novel transcript ENST00000393023.2 protein phosphatase 1, regulatory (inhibitor) subunit 2 (PPP1R2) pseudogene ENST00000450029.1 putative novel transcript ENST00000400311.2 olfactory receptor pseudogene ENST00000431953.1 nuclear transcription factor Y, alpha (NFYA) pseudogene ENST00000456627.1 novel transcript (FLJ32909) ENST00000441282.1 legumain (LGMN) (PRSC1) pseudogene ENST00000397973.2 steroidogenic acute regulatory protein (STAR) pseudogene ENST00000437777.1 novel transcript ENST00000452879.1 tripartite motif-containing 39 (TRIM39, TFP) pseudogene ENST00000456367.1 protocadherin 9 ENST00000377861.3 protocadherin 9 ENST00000430861.1 putative novel transcript ENST00000419371.1 novel transcript ENST00000434073.1 novel transcript ENST00000456459.1 novel transcript ENST00000433498.1 laminin receptor 1 (ribosomal protein SA, 67kDa) (LAMR1) pseudogene ENST00000415120.1 novel transcript ENST00000427761.1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) NPM1 pseudogene ENST00000442229.1 olfactory receptor pseudogene ENST00000437705.1 olfactory receptor pseudogene ENST00000457883.1 ELL-related RNA polymerase II, elongation factor (ELL2) pseudogene ENST00000433537.1 novel HNRPA1 (heterogeneous nuclear ribonucleoprotein A1) pseudogene ENST00000435890.1 ribosomal protein L37 (RPL37) pseudogene ENST00000424532.1 60S ribosomal protein L12 (RPL12) pseudogene ENST00000411421.1 novel pseudogene ENST00000457792.1 small nuclear ribonucleoprotein polypeptide F (SNRPF)(SMF) pseudogene ENST00000433664.1 novel transcript ENST00000431686.1 putative novel transcript ENST00000424524.1 novel transcript ENST00000414504.1 novel transcript ENST00000428761.1 novel transcript ENST00000440529.1 rab9 effector p40 (RAB9P40) pseudogene ENST00000305425.4 dachshund homolog (Drosophila) (DACH1, FLJ10138) ENST00000359684.2 dachshund homolog (Drosophila) (DACH1, FLJ10138) ENST00000440551.1 H3 histone family pseudogene ENST00000422213.1 ribosomal protein L21 (RPL21) pseudogene ENST00000418340.1 ribosomal protein L35 (RPL35) pseudogene ENST00000430654.1 ribosomal protein S10 (RPS10) pseudogene ENST00000455326.1 pseudogene similar to part of ribosomal protein L18 (RPL18) ENST00000433345.1 60S ribosomal protein L21 (RPL21) pseudogene ENST00000377818.3 novel protein ENST00000377818.3 continued from bA342J4.1 in Em:AL138695 ENST00000390667.4 FLJ22624 ENST00000469339.1 mitotic control protein homolog (DIS3)(KIAA1008) ENST00000475871.1 mitotic control protein homolog (DIS3)(KIAA1008) ENST00000326291.6 progesterone-induced blocking factor 1 (PIBF1) ENST00000489797.1 progesterone-induced blocking factor 1 (PIBF1) ENST00000492803.1 progesterone-induced blocking factor 1 (PIBF1) ENST00000486330.1 progesterone-induced blocking factor 1 (PIBF1) ENST00000489922.1 progesterone-induced blocking factor 1 (PIBF1) ENST00000469712.1 progesterone-induced blocking factor 1 (PIBF1) ENST00000437000.1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 (PSMD10) pseudogene. ENST00000477333.1 Kruppel-like factor 5 (intestinal) (KLF5)(CKLF, IKLF, BTEB2) ENST00000476859.1 Kruppel-like factor 5 (intestinal) (KLF5)(CKLF, IKLF, BTEB2) ENST00000464404.1 Kruppel-like factor 5 (intestinal) (KLF5)(CKLF, IKLF, BTEB2) ENST00000423401.1 fatty acid binding protein 5 (psoriasis-associated) (FABP5)(EFABP, E-FABP, PAFABP, PA-FABP) pseudogene ENST00000443621.1 putative novel transcript ENST00000452852.1 putative novel transcript ENST00000430033.1 novel transcript ENST00000419499.1 novel transcript ENST00000423629.1 novel transcript ENST00000451336.1 novel transcript ENST00000446691.1 novel transcript ENST00000418778.1 sudD suppressor of bimD6 homolog (A.nidulans) (SUDD) pseudogene ENST00000415208.1 signal sequence receptor, alpha (translocon-associated protein alpha) (SSR1) pseudogene ENST00000451540.1 meningioma expressed antigen 6 (coiled-coil proline-rich) (MGEA6) pseudogene ENST00000434832.1 putative novel transcript ENST00000377636.3 TBC1 domain family, member 4 (KIAA0603) ENST00000478591.1 TBC1 domain family, member 4 (KIAA0603) ENST00000493487.1 TBC1 domain family, member 4 (KIAA0603) ENST00000413735.1 TBC1 domain family, member 4 (KIAA0603) ENST00000488955.1 TBC1 domain family, member 4 (KIAA0603) ENST00000440094.1 putative novel transcript ENST00000377615.3 upstream_ATG-40 ENST00000534657.1 alternative 5' UTR ENST00000321797.8 not organism-supported ENST00000321797.8 alternative 5' UTR ENST00000465261.2 alternative 5' UTR ENST00000497947.2 alternative 5' UTR ENST00000526371.1 alternative 5' UTR ENST00000526528.1 alternative 5' UTR ENST00000489941.2 alternative 5' UTR ENST00000525373.1 alternative 5' UTR ENST00000485987.1 LIM domain only 7(KIAA0858) ENST00000482116.1 LIM domain only 7 (KIAA0858) ENST00000422931.1 novel transcript ENST00000424489.1 novel pseudogene (FLJ13188, FLJ22977) ENST00000436872.1 novel transcript ENST00000448806.1 putative novel transcript ENST00000426582.1 basic transcription factor 3 (BTF3) pseudogene ENST00000377462.1 novel protein similar to mouse Irg1 (immunoresponsive gene 1) ENST00000424827.1 ribosomal protein L7 (RPL7) pseudogene ENST00000436565.1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (DDX9) pseudogene ENST00000485797.1 F-box and leucine-rich repeat protein 3A (FBXL3A)(FBL3, FBL3A) ENST00000477982.1 F-box and leucine-rich repeat protein 3A (FBXL3A)(FBL3, FBL3A) ENST00000470210.1 F-box and leucine-rich repeat protein 3A (FBXL3A)(FBL3, FBL3A) ENST00000472949.1 F-box and leucine-rich repeat protein 3A (FBXL3A)(FBL3, FBL3A) ENST00000485061.1 novel protein (KIAA0916) ENST00000482517.1 novel protein (KIAA0916) ENST00000462987.1 novel protein (KIAA0916) ENST00000466564.1 novel protein (KIAA0916) ENST00000498073.1 novel protein (KIAA0916) ENST00000486679.1 continued from bA428G23.1.3 in Em:AL159154 ENST00000486679.1 novel protein (KIAA0916) ENST00000474882.1 novel protein (KIAA0916) ENST00000491491.1 not organism-supported ENST00000422231.1 novel transcript ENST00000450627.1 novel transcript ENST00000448470.1 novel transcript ENST00000428716.1 putative novel transcript ENST00000469982.1 sciellin ENST00000456280.1 novel transcript ENST00000457528.1 novel transcript ENST00000450718.1 SPTLC1 (serine palmitoyltransferase, long chain base subunit 1) pseudogene ENST00000420956.1 putative novel transcript ENST00000422114.1 novel protein ENST00000446759.1 novel protein ENST00000496045.1 alternative 5' UTR ENST00000474663.1 alternative 5' UTR ENST00000481614.1 alternative 5' UTR ENST00000422405.1 novel transcript ENST00000475537.1 endothelin receptor type B ENST00000435281.1 putative novel transcript ENST00000452933.1 putative novel transcript ENST00000438327.1 novel transcript ENST00000414743.1 novel transcript ENST00000430549.1 putative novel transcript ENST00000435156.1 putative novel transcript ENST00000429803.1 ribosomal protein L31 (RPL31) pseudogene ENST00000452014.1 transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C) (TCEB1) pseudogene ENST00000282003.6 novel protein (contains FLJ13449, possible ortholog of mouse 2810449K13Rik protein) ENST00000418453.1 ribosomal protein L21 (RPL21) pseudogene ENST00000446391.1 novel transcript ENST00000400121.2 heat shock 60kDa protein 1 (chaperonin) (HSPD1) pseudogene ENST00000432974.1 chaperonin containing TCP1, subunit 5 (epsilon) (KIAA0098) (CCT5) pseudogene ENST00000416374.1 breast carcinoma amplified sequence 2 (DAM1, BCAS2) pseudogene ENST00000456602.1 novel transcript ENST00000457171.1 novel transcript ENST00000450187.1 putative novel transcript ENST00000457858.1 putative novel transcript ENST00000454710.1 novel pseudogene ENST00000427918.1 novel transcript ENST00000377102.1 alternatively splice 5' UTR, shares CDS with bA506P24.1.1 ENST00000377102.1 alternative 5' UTR ENST00000448627.1 heterogeneous nuclear ribonucleoprotein A1 (HNRPA1) pseudogene ENST00000429776.1 novel pseudogene (KIAA1935, FLJ31359) ENST00000439608.1 ADP-ribosylation factor pseudogene ENST00000456588.1 putative novel transcript ENST00000446367.1 novel pseudogene (HIG1) ENST00000458480.1 novel transcript ENST00000426437.1 glycogenin (GYG) pseudogene ENST00000399480.2 homeobox protein pseudogene ENST00000441973.1 ubiquitin-conjugating enzyme pseudogene ENST00000457501.1 NADH dehydrogense pseudogene ENST00000438536.1 NADH dehydrogense pseudogene ENST00000446314.1 novel transcript ENST00000433074.1 novel transcript ENST00000424926.1 novel transcript ENST00000430903.1 novel pseudogene ENST00000445967.1 novel transcript ENST00000397726.2 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 6 (RNA helicase, 54kDa) (DDX6) pseudogene ENST00000429528.1 thioredoxin-like, 32kDa (TXNL) pseudogene ENST00000457672.1 putative novel transcript ENST00000446970.1 ubiquitin pseudogene ENST00000445283.1 RNA-binding protein LIN-28 pseudogene ENST00000450888.1 putative novel transcript ENST00000436290.1 novel transcript ENST00000441617.1 novel transcript ENST00000453832.1 novel transcript ENST00000422074.1 novel transcript ENST00000426627.1 novel pseudogene (KIAA1676) ENST00000424165.1 novel transcript ENST00000448425.1 novel transcript ENST00000453145.1 GrpE-like, mitochondrial (E. coli) (Grpel) pseudogene ENST00000415193.1 novel transcript ENST00000445027.1 novel transcript ENST00000432350.1 novel RING finger protein pseudogene ENST00000446579.1 putative novel transcript ENST00000414049.1 Sp3 transcription factor (SP3) pseudogene ENST00000425048.1 putative novel transcript ENST00000434117.1 putative novel transcript ENST00000435401.1 novel transcript ENST00000448259.1 ribosomal protein L7 (RPL7) pseudogene ENST00000400284.2 peroxisomal biogenesis factor 12 (PEX12) pseudogene ENST00000427163.1 novel pseudogene ENST00000427733.1 keratin 18 (KRT18) (K18, CYK18) pseudogene ENST00000426840.1 novel transcript ENST00000419272.1 novel transcript ENST00000442875.1 novel pseudogene ENST00000442478.1 putative novel protein ENST00000438789.1 novel transcript ENST00000427717.1 novel transcript ENST00000420099.1 peptidylprolyl isomerase (cyclophilin) pseudogene ENST00000413621.1 miR-91-precursor-13 micro RNA ENST00000454574.1 miR-18-precursor-13 micro RNA ENST00000417320.1 miR-19a-precursor-13 micro RNA ENST00000431173.1 miR-19b-precursor-13 micro RNA ENST00000446268.1 miR-92-precursor-13 micro RNA ENST00000377067.3 glypican 5 ENST00000417589.1 putative novel transcript ENST00000416664.1 putative novel transcript ENST00000451897.1 novel transcript ENST00000419288.1 novel transcript ENST00000443228.1 putative novel transcript ENST00000426409.1 heterogeneous nuclear ribonucleoprotein A2/B1 (HNRPA2B1) pseudogene ENST00000445540.1 novel transcript ENST00000436329.1 novel transcript ENST00000483392.1 dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2)(TYRP2) ENST00000490854.1 dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2)(TYRP2) ENST00000433569.1 novel transcript ENST00000438290.1 novel transcript ENST00000299197.6 bromodomain containing 7 (BP75, NAG4, CELTIX1) (BRD7) pseudogene ENST00000434403.1 ribosomal protein L21 (RPL21) pseudogene ENST00000484109.1 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 ENST00000471041.1 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 ENST00000474158.1 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 ENST00000467685.1 ATP-binding cassette, sub-family C (CFTR/MRP), member 4 ENST00000429011.1 putative novel transcript ENST00000376855.1 claudin 10 (OSP-L, CPETRL3) ENST00000416909.1 novel transcript ENST00000442927.1 pseudogene similar to part of NADH dehydrogenase 5 (MTND5) ENST00000439477.1 NADH dehydrogenase 6 (MTND6) pseudogene ENST00000445588.1 novel cytochrome B pseudogene ENST00000462472.1 this variant and variants 4 and 5 could be part of the same variant ENST00000462472.1 UDP-glucose ceramide glucosyltransferase-like 2 (HUGT2, FLJ10873, FLJ11485) ENST00000476866.1 this variant and variants 3 and 5 could be part of the same variant ENST00000476866.1 UDP-glucose ceramide glucosyltransferase-like 2 (HUGT2, FLJ10873, FLJ11485) ENST00000491509.1 this variant and variants 3 and 4 could be part of the same variant ENST00000486643.1 UDP-glucose ceramide glucosyltransferase-like 2 (HUGT2, FLJ10873, FLJ11485) ENST00000412282.1 high-mobility group nucleosome binding domain 1 (HMGN1) pseudogene ENST00000449881.1 putative novel transcript ENST00000415152.1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 (AMMECR1) pseudogene ENST00000426420.1 heat shock 90kDa protein 1, beta (HSPCB) pseudogene ENST00000442322.1 putative novel transcript ENST00000453253.1 tubby like protein 3 (TULP3) pseudogene ENST00000543457.1 alternative 5' UTR ENST00000541518.1 alternative 5' UTR ENST00000541038.1 alternative 5' UTR ENST00000453862.1 putative novel transcript ENST00000245304.3 member of RAS oncogene family ENST00000437334.1 putative novel transcript ENST00000443410.1 60S ribosomal protein L7A (RPL7A) pseudogene ENST00000477600.1 alternative 5' UTR ENST00000460070.1 alternative 5' UTR ENST00000481455.1 alternative 5' UTR ENST00000463157.1 alternative 5' UTR ENST00000493281.1 alternative 5' UTR ENST00000471898.1 alternative 5' UTR ENST00000489058.1 alternative 5' UTR ENST00000480611.1 alternative 5' UTR ENST00000485433.1 alternative 5' UTR ENST00000496368.1 alternative 5' UTR ENST00000421861.2 alternative 5' UTR ENST00000475420.1 alternative 5' UTR ENST00000490680.1 alternative 5' UTR ENST00000446770.1 pseudogene similar to part of ferritin, light polypeptide (FTL) ENST00000376581.4 FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) (CDEP) ENST00000376581.4 continues from bA10G5.2.2 in Em:AL136300 ENST00000490389.1 this variant and one or more of variant fragments bA111L24.1.2, bA111L24.1.3 and bA111L24.1.4 could be part of one single variant ENST00000490389.1 FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) (CDEP) ENST00000496052.1 FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) (CDEP) ENST00000496052.1 this variant and one or more of variant fragments bA111L24.1.4 and bA261P24.1.2 could be part of one single variant ENST00000457029.1 FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) (CDEP) ENST00000457029.1 this variant and one or more of variant fragments bA111L24.1.4 and bA261P24.1.2 could be part of one single variant ENST00000423063.1 FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived) (CDEP) ENST00000423063.1 this variant and one or more of variant fragments bA261P24.1.2, bA111L24.1.2 and bA111L24.1.3 could be part of one single variant ENST00000457431.1 putative novel transcript ENST00000427404.1 putative novel transcript ENST00000432229.1 novel transcript ENST00000376554.4 serine/threonine kinase 24 (STE20 homolog, yeast) (MST3, STK3) ENST00000491878.1 serine/threonine kinase 24 (STE20 homolog, yeast) (MST3, STK3) ENST00000481288.1 serine/threonine kinase 24 (STE20 homolog, yeast) (MST3, STK3) ENST00000434547.1 putative novel transcript ENST00000434547.1 non canonical splice donor site ENST00000401550.2 novel pseudogene ENST00000451978.1 cytochrome c pseudogene ENST00000430810.1 calmodulin 2 (CALM2) (phosphorylase kinase, delta) pseudogene ENST00000376494.1 solute carrier family 15 (oligopeptide transporter) member 1 (PEPT1, HPEPT1, HPECT1) ENST00000400228.2 zizimin1 ENST00000376460.1 zizimin1 (KIAA1058) ENST00000419908.1 zizimin1 ENST00000451563.1 zizimin1 ENST00000340449.3 zizimin1 ENST00000481051.1 zizimin1 ENST00000449796.1 zizimin1 ENST00000450257.1 zizimin1 ENST00000472874.1 zizimin1 ENST00000461998.1 zizimin1 ENST00000473165.1 zizimin1 ENST00000427887.1 zizimin1 ENST00000479769.1 zizimin1 ENST00000439367.1 putative novel transcript ENST00000417594.1 ribosomal protein L7 (RPL7) pseudogene ENST00000413224.1 ribosomal protein S6 (RPS6) pseudogene ENST00000491037.1 pseudogene similar to part of glyceraldehyde-3-phosphate dehydrogenase (GAPD) ENST00000426037.1 novel transcript ENST00000445737.1 novel transcript ENST00000355700.5 novel protein ENST00000468067.1 novel transcript ENST00000473091.1 novel transcript ENST00000376440.2 FLJ30001 ENST00000474510.1 novel transcript ENST00000394213.2 H2A histone family pseudogene ENST00000340807.3 G protein-coupled receptor 18 ENST00000416594.1 G protein-coupled receptor 18 ENST00000339009.5 putative novel transcript ENST00000428776.1 high mobility group protein pseudogene ENST00000446203.1 chemokine (C-C motif) receptor pseudogene ENST00000435885.1 putative novel transcript ENST00000366259.2 putative novel transcript ENST00000466555.1 transmembrane 9 superfamily member 2 (P76) ENST00000437113.1 novel transcript ENST00000436148.1 cofilin 1 (non-muscle) (CFL1) pseudogene ENST00000376360.1 citrate lyase beta like (CLB, bA134O15.1) ENST00000376354.1 citrate lyase beta like (CLB, bA134O15.1) ENST00000339105.4 citrate lyase beta like (CLB, bA134O15.1) ENST00000416504.1 citrate lyase beta like (CLB, bA134O15.1) ENST00000443887.1 citrate lyase beta like (CLB, bA134O15.1) ENST00000419700.1 citrate lyase beta like (CLB, bA134O15.1) ENST00000425186.1 citrate lyase beta like (CLB, bA134O15.1) ENST00000430125.1 putative novel transcript ENST00000416009.1 putative novel transcript ENST00000417102.1 putative novel transcript ENST00000376335.3 as ENST00000490085.1 Zic family member 2 (odd-paired homolog, Drosophila) ENST00000490085.1 this variant and variant 3 could be part of the same variant ENST00000468291.1 Zic family member 2 (odd-paired homolog, Drosophila) ENST00000468291.1 this variant and variant 3 could be part of the same variant ENST00000477213.1 Zic family member 2 (odd-paired homolog, Drosophila) ENST00000481565.1 this variant and variants 2 and 3 could be part of the same variant ENST00000481565.1 Zic family member 2 (odd-paired homolog, Drosophila) ENST00000455914.1 13kDa differentiation-associated protein (DAP13) pseudogene ENST00000451989.1 asparagine synthetase (ASNS) pseudogene ENST00000485946.1 propionyl Coenzyme A carboxylase, alpha polypeptide ENST00000428969.1 propionyl Coenzyme A carboxylase, alpha polypeptide ENST00000432924.1 ribosomal protein L15 (RPL15) pseudogene ENST00000451662.1 novel transcript ENST00000414553.1 novel transcript ENST00000455958.1 novel transcript ENST00000376250.1 novel protein ENST00000376250.1 novel transcript ENST00000492399.1 novel transcript ENST00000467518.1 novel transcript ENST00000471912.1 novel transcript ENST00000464500.1 putative novel transcript ENST00000454752.1 novel transcript ENST00000342624.5 NP_116202.2 ENST00000462211.1 this variant and variant's 4 and 5 could be part of the same variant ENST00000478272.1 this variant and variant's 4, 5 and 8 could be part of the same variant ENST00000496511.1 this variant and variant's 4, 5 and 8 could be part of the same variant ENST00000475272.1 alternative 5' UTR ENST00000423847.1 this variant and variant's 3, 6 and 7 could be part of the same variant ENST00000454311.1 COX5B (cytochrome c oxidase subunit Vb) pseudogene ENST00000457843.1 novel transcript (FLJ22153) ENST00000397387.2 ADP-ribosylation factor pseudogene ENST00000436722.1 putative novel transcript ENST00000474233.1 integrin, beta-like 1 (with EGF-like repeat domains) ENST00000415285.1 novel transcript ENST00000468052.1 fibroblast growth factor 14 ENST00000400214.2 high-mobility group box 1 (HMGB1) pseudogene ENST00000415870.1 lipoyltransferase (LOC51601) pseudogene ENST00000447779.1 ribosomal protein L39 (RPL39) pseudogene ENST00000418923.1 novel transcript ENST00000437115.1 novel transcript ENST00000444686.1 putative novel transcript ENST00000451630.1 putative novel transcript ENST00000496126.1 tripeptidyl peptidase II ENST00000493770.1 tripeptidyl peptidase II ENST00000490420.1 tripeptidyl peptidase II ENST00000482393.1 tripeptidyl peptidase II ENST00000267273.5 novel protein ENST00000430111.1 putative novel transcript ENST00000376019.1 alternative 5' UTR ENST00000376022.1 novel protein ENST00000491929.1 basic, immunoglobulin-like variable motif containing ENST00000481069.1 basic, immunoglobulin-like variable motif containing ENST00000474443.1 basic, immunoglobulin-like variable motif containing ENST00000355739.4 excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome)) ENST00000472151.1 excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome)) ENST00000375958.3 excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome)) ENST00000375954.1 excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome)) ENST00000481099.1 excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome)) ENST00000472247.1 excision repair cross-complementing rodent repair deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome)) ENST00000416924.1 putative novel transcript ENST00000298105.6 hepatocellular carcinoma-associated antigen HCA557b (LOC151194) pseudogene ENST00000444795.1 putative novel transcript ENST00000415853.1 ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G variant 1 (ATP6V1G1) pseudogene ENST00000455851.1 ribosomal protein L7 (RPL7) pseudogene ENST00000375936.3 NMD exception ENST00000454555.1 novel transcript (FLJ25324) ENST00000415294.1 novel transcript ENST00000414368.1 novel transcript ENST00000435024.1 novel transcript ENST00000439790.1 novel transcript ENST00000444865.1 novel transcript ENST00000446059.1 ribosomal protein L35 (RPL35) pseudogene ENST00000400198.3 novel protein (FLJ10154) ENST00000472226.1 novel transcript ENST00000375926.1 novel protein ENST00000360629.3 novel protein ENST00000421601.1 novel transcript ENST00000429024.1 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c pseudogene ENST00000375915.1 novel protein ENST00000449551.1 putative novel transcript ENST00000375898.3 novel protein (FLJ14906) ENST00000486502.1 tumor necrosis factor (ligand) superfamily, member 13b ENST00000479435.1 tumor necrosis factor (ligand) superfamily, member 13b ENST00000493765.1 tumor necrosis factor (ligand) superfamily, member 13b ENST00000392864.2 pseudogene similar to part of host cell factor 2 (HCF-2) ENST00000357550.2 novel protein (KIAA0865), possible ortholog of rat myosin heavy chain Myr 8 (Loc192253) ENST00000357550.2 novel protein, possible ortholog of rat myosin heavy chain Myr 8 (Loc192253) ENST00000357550.2 novel protein (including KIAA0865), possible ortholog of rat myosin heavy chain Myr 8 (Loc192253) ENST00000251041.5 novel protein (KIAA0865), possible ortholog of rat myosin heavy chain Myr 8 (Loc192253) ENST00000251041.5 novel protein (including KIAA0865), possible ortholog of rat myosin heavy chain Myr 8 (Loc192253) ENST00000467639.1 novel transcript ENST00000375857.1 novel protein (KIAA0865), possible ortholog of rat myosin heavy chain Myr 8 (Loc192253) ENST00000375857.1 novel protein (including KIAA0865), possible ortholog of rat myosin heavy chain Myr 8 (Loc192253) ENST00000482793.1 novel transcript ENST00000412809.1 putative novel transcript ENST00000439299.1 novel transcript ENST00000455487.1 putative novel transcript ENST00000432575.1 putative novel transcript ENST00000439008.1 putative novel transcript ENST00000416090.1 novel transcript ENST00000411690.1 novel transcript ENST00000400163.2 alternative 5' UTR ENST00000360467.5 NP_001837 ENST00000463084.1 collagen type IV alpha 2 ENST00000492889.1 novel transcript (FLJ25038) ENST00000470164.1 novel transcript (FLJ14198) ENST00000309957.2 FLJ10769 ENST00000471986.1 novel transcript ENST00000490421.1 novel transcript ENST00000480437.1 novel transcript ENST00000543487.1 not organism-supported ENST00000465145.1 novel transcript similar to cysteinyl-TRNA syntetase ENST00000338450.7 Inhibitor of growth family member 1 ENST00000333219.7 Inhibitor of growth family member 1 ENST00000464141.1 Inhibitor of growth family member 1 ENST00000411449.1 ribosomal protein L21 (RPL21) pseudogene ENST00000267339.2 FLJ20093 ENST00000485844.1 novel transcript ENST00000413631.1 ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase) (ADPRT) pseudogene ENST00000440735.1 putative novel transcript ENST00000422994.1 novel transcript ENST00000425094.1 putative novel transcript ENST00000422836.1 putative novel transcript ENST00000317133.5 NP_663788.1 ENST00000449979.1 alternative 5' UTR ENST00000449979.1 alternatively spliced 5' UTR, shares CDS with bA17E4.1.1 ENST00000491775.1 alternative 5' UTR ENST00000466143.1 alternative 5' UTR ENST00000478983.1 Rho guanine nucleotide exchange factor (GEF) 7 (KIAA0142) ENST00000467053.1 alternative 5' UTR ENST00000426073.2 alternative 5' UTR ENST00000491688.1 Rho guanine nucleotide exchange factor (GEF) 7 (KIAA0142) ENST00000423329.1 putative novel transcript ENST00000435037.1 putative novel transcript ENST00000412119.1 putative novel transcript ENST00000440860.1 putative novel transcript ENST00000418660.1 putative novel transcript ENST00000421423.1 putative novel transcript ENST00000413637.1 novel transcript ENST00000469302.1 tubulin, gamma complex associated protein 3 (GCP3, SPC98P, Spc98p, spindle pole body protein) ENST00000462580.1 this variant and variant fragment bA88E10.1.4 could be part of one single variant ENST00000462580.1 tubulin, gamma complex associated protein 3 (GCP3, SPC98P, Spc98p, spindle pole body protein) ENST00000483532.1 tubulin, gamma complex associated protein 3 (GCP3, SPC98P, Spc98p, spindle pole body protein) ENST00000356049.1 FLJ26443 ENST00000375608.3 cDNAs are from orang-utan and mouse ENST00000430480.1 MCF.2 cell line derived transforming sequence-like (KIAA0362, DBS, OST, ARHGEF14) ENST00000486806.1 MCF.2 cell line derived transforming sequence-like (KIAA0362, DBS, OST, ARHGEF14) ENST00000397021.1 MCF.2 cell line derived transforming sequence-like (KIAA0362, DBS, OST, ARHGEF14) ENST00000464800.1 MCF.2 cell line derived transforming sequence-like (KIAA0362, DBS, OST, ARHGEF14) ENST00000413354.1 GENCODE experimental pipeline ENST00000441756.1 MCF.2 cell line derived transforming sequence-like (MCF2L)(DBS, OST, ARHGEF14, KIAA0362) ENST00000493630.1 protein Z, vitamin K-dependent plasma glycoprotein (PROZ)(PZ) ENST00000497607.1 protein Z, vitamin K-dependent plasma glycoprotein (PROZ)(PZ) ENST00000337344.4 alternatively spliced 3' UTR; shares CDS with bA98F14.6.4 and bA98F14.6.6 ENST00000337344.4 alternative 3' UTR ENST00000375479.2 alternatively spliced 3' UTR; shares CDS with bA98F14.6.2 and bA98F14.6.6 ENST00000375479.2 alternative 3' UTR ENST00000375477.1 alternatively spliced 3' UTR; shares CDS with bA98F14.6.2 and bA98F14.6.4 ENST00000375477.1 alternative 3' UTR ENST00000246505.5 novel protein (FLJ11305) ENST00000375459.1 alternative 3' UTR ENST00000375459.1 alternatively spliced 3' UTR; shares CDS with bA98F14.6.5 ENST00000375457.2 alternatively spliced 3' UTR; shares CDS with bA98F14.6.7 ENST00000375457.2 alternative 3' UTR ENST00000375440.4 AT/AC splice between exons three and four ENST00000488558.1 cullin 4A (CUL4A) ENST00000474116.1 cullin 4A (CUL4A) ENST00000494985.1 cullin 4A (CUL4A) ENST00000463426.1 cullin 4A (CUL4A) ENST00000498562.1 cullin 4A (CUL4A) ENST00000470067.1 cullin 4A (CUL4A) ENST00000472083.1 cullin 4A (CUL4A) ENST00000455730.2 LDHB (lactate dehydrogenase B) pseudogene ENST00000332556.4 lysosomal-associated membrane protein 1 (LAMP1) ENST00000471046.1 lysosomal-associated membrane protein 1 (LAMP1) ENST00000326039.3 FLJ22474 ENST00000423246.1 putative novel transcript ENST00000419199.1 putative novel transcript ENST00000413169.1 alternatively spliced 5' UTR; shares partial CDS with bA102K13.1.1 ENST00000413169.1 alternative 5' UTR ENST00000465938.1 alternative 5' UTR ENST00000460318.1 novel transcript ENST00000465710.1 alternative 5' UTR ENST00000422615.1 putative novel transcript ENST00000414992.1 putative novel transcript ENST00000453584.1 novel transcript ENST00000375391.1 non-canonical splice site at final exon ENST00000465556.1 = ENST00000475254.1 transcription factor Dp-1 (DP-1, DRTF1) ENST00000464794.1 transcription factor Dp-1 (DP-1, DRTF1) ENST00000408980.2 alternative 5' UTR ENST00000408980.2 alternatively spliced 5' UTR, shares CDS with bA230F18.4.1 (not complete) ENST00000453989.1 alternative 5' UTR ENST00000453989.1 alternatively spliced 5' UTR, shares CDS with bA230F18.4.1 (not complete) ENST00000494812.1 transcription factor Dp-1 (DP-1, DRTF1) ENST00000480426.1 FLJ34709 ENST00000334062.7 RAS p21 protein activator (GTPase activating protein) 3 (Ins(1,3,4,5)P4-binding protein) (GAP1IP4BP) ENST00000454005.1 putative novel transcript ENST00000356221.3 Three base difference in splice acceptor of exon three compared to RP11-569D9.4-006 ENST00000252457.5 Three base difference in splice acceptor of exon three compared to RP11-569D9.4-009 ENST00000494581.1 CDC16 cell division cycle 16 homolog (S. cerevisiae) ENST00000484246.1 novel transcript ENST00000480362.1 novel transcript ENST00000474056.1 novel transcript ENST00000481131.1 novel transcript ENST00000479712.1 novel transcript ENST00000392050.2 Charot-Leyden crystal protein (CLC) pseudogene ENST00000463003.1 novel protein (KIAA1802) ENST00000478022.1 novel protein (KIAA1802) ENST00000446989.1 novel transcript ENST00000441500.1 FLJ12852 ENST00000551932.1 confirm experimentally ENST00000551932.1 TEC ENST00000359695.3 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000556246.1 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000557414.1 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000557414.1 alternative 5' UTR ENST00000557677.1 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000557677.1 alternative 5' UTR ENST00000315947.1 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000553311.1 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000331723.1 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000556269.1 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000416478.1 unitary_pseudogene ENST00000425829.1 unitary_pseudogene ENST00000556991.1 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000554603.1 annotated using the Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000305045.2 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000315693.2 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000554958.1 annotated using the Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000554933.1 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000315543.4 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000333629.1 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000556349.1 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000556349.1 LOC100422289 ENST00000557042.1 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000357366.3 not organism-supported ENST00000554039.1 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000315519.2 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000553765.1 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000556592.1 overlapping transcript ENST00000556738.1 confirm experimentally ENST00000556738.1 overlapping transcript ENST00000423949.2 non canonical other ENST00000398160.2 alternative 5' UTR ENST00000398169.3 non canonical other ENST00000358932.4 alternative 5' UTR ENST00000398163.2 alternative 5' UTR ENST00000557665.1 alternative 5' UTR ENST00000553291.1 alternative 5' UTR ENST00000555983.1 sense_intronic ENST00000556549.1 alternative 5' UTR ENST00000554249.1 alternative 5' UTR ENST00000555785.1 alternative 5' UTR ENST00000555414.1 alternative 5' UTR ENST00000553681.1 alternative 5' UTR ENST00000557344.1 alternative 5' UTR ENST00000398030.4 alternative 5' UTR ENST00000557181.1 alternative 5' UTR ENST00000553368.1 alternative 5' UTR ENST00000556054.1 alternative 5' UTR ENST00000557150.1 alternative 5' UTR ENST00000553418.1 alternative 5' UTR ENST00000554964.1 alternative 5' UTR ENST00000555230.1 alternative 5' UTR ENST00000557068.1 alternative 5' UTR ENST00000556208.1 alternative 5' UTR ENST00000553541.1 alternative 5' UTR ENST00000429244.2 alternative 5' UTR ENST00000557209.1 alternative 5' UTR ENST00000553849.1 alternative 5' UTR ENST00000555841.1 alternative 5' UTR ENST00000398009.2 alternative 5' UTR ENST00000398008.2 alternative 5' UTR ENST00000432835.2 NAGNAG splice site ENST00000432835.2 alternative 5' UTR ENST00000443456.2 alternative 5' UTR ENST00000557503.1 alternative 5' UTR ENST00000557105.1 alternative 5' UTR ENST00000413502.1 alternative 5' UTR ENST00000554842.1 alternative 5' UTR ENST00000320704.3 not organism-supported ENST00000320704.3 annotation based on Human Olfactory Data Explorer http://genome.weizmann.ac.il/horde/ ENST00000397995.2 alternative 5' UTR ENST00000555597.1 alternative 5' UTR ENST00000397990.4 alternative 5' UTR ENST00000340900.3 alternative 5' UTR ENST00000412779.2 alternative 5' UTR ENST00000397970.4 alternative 5' UTR ENST00000554751.1 alternative 5' UTR ENST00000555670.1 alternative 5' UTR ENST00000554422.1 NAGNAG splice site ENST00000350792.3 alternative 5' UTR ENST00000555158.1 alternative 5' UTR ENST00000553503.1 alternative 5' UTR ENST00000397853.3 alternative 5' UTR ENST00000556147.1 alternative 5' UTR ENST00000554143.1 alternative 5' UTR ENST00000397851.2 alternative 5' UTR ENST00000553593.1 NMD likely if extended ENST00000556366.1 alternative 5' UTR ENST00000553867.1 alternative 5' UTR ENST00000557169.1 alternative 5' UTR ENST00000555869.1 alternative 5' UTR ENST00000555733.1 alternative 5' UTR ENST00000555384.1 alternative 5' UTR ENST00000554094.1 alternative 5' UTR ENST00000553442.1 alternative 5' UTR ENST00000556420.1 alternative 5' UTR ENST00000553784.1 alternative 5' UTR ENST00000557149.1 alternative 5' UTR ENST00000555142.1 alternative 5' UTR ENST00000557264.1 alternative 5' UTR ENST00000557676.1 alternative 5' UTR ENST00000556924.1 alternative 5' UTR ENST00000556329.1 alternative 5' UTR ENST00000554398.1 alternative 5' UTR ENST00000554472.1 alternative 5' UTR ENST00000554483.1 alternative 5' UTR ENST00000555657.1 alternative 5' UTR ENST00000557274.1 alternative 5' UTR ENST00000556457.1 alternative 5' UTR ENST00000556688.1 alternative 5' UTR ENST00000554561.1 alternative 5' UTR ENST00000554419.1 alternative 5' UTR ENST00000554489.1 alternative 5' UTR ENST00000556561.1 alternative 5' UTR ENST00000554893.1 alternative 5' UTR ENST00000554833.1 alternative 5' UTR ENST00000554415.1 alternative 5' UTR ENST00000530140.2 alternative 5' UTR ENST00000451119.2 alternative 5' UTR ENST00000421093.2 alternative 5' UTR ENST00000555270.1 alternative 5' UTR ENST00000556174.1 alternative 5' UTR ENST00000553296.1 alternative 5' UTR ENST00000555697.1 alternative 5' UTR ENST00000554969.1 not organism-supported ENST00000556142.1 not organism-supported ENST00000430246.2 alternative 5' UTR ENST00000553753.1 alternative 5' UTR ENST00000555309.1 NAGNAG splice site ENST00000555309.1 not organism-supported ENST00000556513.1 not organism-supported ENST00000557201.1 alternative 5' UTR ENST00000556897.1 alternative 5' UTR ENST00000554383.1 alternative 5' UTR ENST00000555215.1 alternative 5' UTR ENST00000555137.1 alternative 5' UTR ENST00000554891.1 alternative 5' UTR ENST00000556226.1 alternative 5' UTR ENST00000555176.1 alternative 5' UTR ENST00000557336.1 alternative 5' UTR ENST00000557768.1 alternative 5' UTR ENST00000556336.1 not organism-supported ENST00000557771.1 not organism-supported ENST00000555587.1 NAGNAG splice site ENST00000557606.1 NAGNAG splice site ENST00000553870.1 not organism-supported ENST00000556833.1 not organism-supported ENST00000544919.1 not organism-supported ENST00000544248.1 not organism-supported ENST00000440691.2 alternative 5' UTR ENST00000542354.1 F ENST00000542354.1 TRAV1-1*01 ENST00000390423.2 F ENST00000390423.2 TRAV1-2*01 ENST00000390424.2 F ENST00000390424.2 TRAV2*01 ENST00000390425.2 F ENST00000390425.2 TRAV3*01 ENST00000390426.2 F ENST00000390426.2 TRAV4*01 ENST00000390427.3 F ENST00000390427.3 TRAV5*01 ENST00000390428.3 F ENST00000390428.3 TRAV6*01 ENST00000390429.3 F ENST00000390429.3 TRAV7*01 ENST00000390430.2 F ENST00000390430.2 TRAV8-1*01 ENST00000390431.3 F ENST00000390431.3 TRAV9-1*01 ENST00000390432.2 F ENST00000390432.2 TRAV10*01 ENST00000539512.1 P ENST00000539512.1 TRAV11*01 ENST00000390433.1 F ENST00000390433.1 TRAV12-1*01 ENST00000390434.3 TRAV8-2*01 ENST00000390434.3 F ENST00000390435.1 TRAV8-3*01 ENST00000390435.1 F ENST00000390436.2 F ENST00000390436.2 TRAV13-1*01 ENST00000390437.2 F ENST00000390437.2 TRAV12-2*01 ENST00000390438.2 F ENST00000390438.2 TRAV8-4*01 ENST00000537369.1 P ENST00000390439.2 F ENST00000390439.2 TRAV13-2*01 ENST00000390440.2 TRAV14/DV4*02 ENST00000390440.2 F ENST00000390441.2 F ENST00000390441.2 TRAV9-2*01 ENST00000556680.1 P ENST00000556680.1 TRAV15*01 ENST00000390442.3 F ENST00000390442.3 TRAV12-3*01 ENST00000390443.3 F ENST00000390443.3 TRAV8-6*01 ENST00000390444.1 F ENST00000390444.1 TRAV16*01 ENST00000390445.2 F ENST00000390445.2 TRAV17*01 ENST00000390446.3 F ENST00000390446.3 TRAV18*01 ENST00000390447.3 upstream ATG ENST00000390447.3 F ENST00000390447.3 TRAV19*01 ENST00000390448.3 F ENST00000390448.3 TRAV20*01 ENST00000390449.3 F ENST00000390449.3 TRAV21*01 ENST00000390450.3 F ENST00000390450.3 upstream ATG ENST00000390450.3 TRAV22*01 ENST00000390451.2 F ENST00000390451.2 TRAV23/DV6*01 ENST00000390452.2 F ENST00000390452.2 TRDV1*01 ENST00000390453.1 F ENST00000390453.1 TRAV24*01 ENST00000390454.2 F ENST00000390454.2 upstream ATG ENST00000390454.2 TRAV25*01 ENST00000390455.3 F ENST00000390455.3 TRAV26-1*01 ENST00000390456.3 TRAV8-7 ENST00000390456.3 ORF ENST00000390457.2 F ENST00000390457.2 TRAV27*01 ENST00000557548.1 P ENST00000557548.1 TRAV28*01 ENST00000390458.3 F ENST00000390458.3 TRAV29/DV5*01 ENST00000557168.1 F ENST00000557168.1 TRAV30*01 ENST00000502780.2 P ENST00000502780.2 TRAV31*01 ENST00000553993.1 TRAV32*01 ENST00000553993.1 P ENST00000557514.1 P ENST00000557514.1 TRAV33*01 ENST00000390460.1 F ENST00000390460.1 TRAV26-2*01 ENST00000390461.2 F ENST00000390461.2 TRAV34*01 ENST00000390462.1 F ENST00000390462.1 TRAV35*01 ENST00000390463.3 F ENST00000390463.3 TRAV36/DV7*01 ENST00000553906.1 TRAV37*01 ENST00000553906.1 P ENST00000390464.2 F ENST00000390464.2 TRAV38-1*01 ENST00000390465.2 F ENST00000390465.2 TRAV38-2/DV8*01 ENST00000390466.1 F ENST00000390466.1 TRAV39*01 ENST00000390467.3 F ENST00000390467.3 TRAV40*01 ENST00000390468.1 F ENST00000390468.1 TRAV41*01 ENST00000390469.2 F ENST00000390469.2 TRDV2*03 ENST00000415118.1 F ENST00000415118.1 TRDD1*01 ENST00000434970.2 F ENST00000434970.2 TRDD2*01 ENST00000448914.1 F ENST00000448914.1 TRDD3*01 ENST00000390473.1 F ENST00000390473.1 TRDJ1*01 ENST00000390474.1 TRDJ4*01 ENST00000390474.1 F ENST00000390475.1 F ENST00000390475.1 TRDJ2*01 ENST00000390476.1 F ENST00000390476.1 TRDJ3*01 ENST00000390477.2 TRDC*01 ENST00000390477.2 F ENST00000535880.2 F ENST00000535880.2 TRDV3*01 ENST00000390479.2 TRAJ61*01 ENST00000390479.2 ORF ENST00000442641.3 TRAJ60*01 ENST00000442641.3 P ENST00000390480.2 TRAJ59*01 ENST00000390480.2 ORF ENST00000390481.1 TRAJ58*01 ENST00000390481.1 ORF ENST00000390482.1 F ENST00000390482.1 TRAJ57*01 ENST00000390483.1 F ENST00000390483.1 TRAJ56*01 ENST00000509135.1 TRAJ55*01 ENST00000509135.1 P ENST00000390484.1 F ENST00000390484.1 TRAJ54*01 ENST00000390485.1 F ENST00000390485.1 TRAJ53*01 ENST00000390486.1 F ENST00000390486.1 TRAJ52*01 ENST00000504127.1 P ENST00000504127.1 TRAJ51*01 ENST00000390487.1 F ENST00000390487.1 TRAJ50*01 ENST00000390488.1 F ENST00000390488.1 TRAJ49*01 ENST00000390489.1 F ENST00000390489.1 TRAJ48*01 ENST00000390490.1 F ENST00000390490.1 TRAJ47*01 ENST00000390491.1 F ENST00000390491.1 TRAJ46*01 ENST00000390492.1 F ENST00000390492.1 TRAJ45*01 ENST00000390493.1 F ENST00000390493.1 TRAJ44*01 ENST00000390494.1 F ENST00000390494.1 TRAJ43*01 ENST00000390495.1 F ENST00000390495.1 TRAJ42*01 ENST00000390496.1 F ENST00000390496.1 TRAJ41*01 ENST00000390497.1 F ENST00000390497.1 TRAJ40*01 ENST00000390498.1 F ENST00000390498.1 TRAJ39*01 ENST00000390499.1 F ENST00000390499.1 TRAJ38*01 ENST00000390501.1 F ENST00000390501.1 TRAJ36*01 ENST00000390502.1 TRAJ35*01 ENST00000390502.1 ORF ENST00000390503.1 F ENST00000390503.1 TRAJ34*01 ENST00000390504.1 F ENST00000390504.1 TRAJ33*01 ENST00000390505.1 F ENST00000390505.1 TRAJ32*01 ENST00000390506.1 TRAJ31*01 ENST00000390506.1 F ENST00000390507.1 F ENST00000390507.1 TRAJ30*01 ENST00000390508.1 F ENST00000390508.1 TRAJ29*01 ENST00000390509.1 F ENST00000390509.1 TRAJ28*01 ENST00000390510.1 F ENST00000390510.1 TRAJ27*01 ENST00000390511.1 F ENST00000390511.1 TRAJ26*01 ENST00000390512.2 TRAJ25*01 ENST00000390512.2 ORF ENST00000390513.1 F ENST00000390513.1 TRAJ24*02 ENST00000390514.1 F ENST00000390514.1 TRAJ23*01 ENST00000390515.1 F ENST00000390515.1 TRAJ22*01 ENST00000390516.1 F ENST00000390516.1 TRAJ21*01 ENST00000390517.1 F ENST00000390517.1 TRAJ20*01 ENST00000390518.1 TRAJ19*01 ENST00000390518.1 ORF ENST00000390519.1 F ENST00000390519.1 TRAJ18*01 ENST00000390520.1 F ENST00000390520.1 TRAJ17*01 ENST00000390521.1 F ENST00000390521.1 TRAJ16*01 ENST00000390522.1 Requested the genome sequence to be checked for sequencing error but possible new allele ENST00000390522.1 No 100% transcript evidence, functional in IMGT ENST00000390523.1 F ENST00000390523.1 TRAJ14*01 ENST00000390524.1 F ENST00000390524.1 TRAJ13*01 ENST00000390525.1 F ENST00000390525.1 TRAJ12*01 ENST00000390526.1 F ENST00000390526.1 TRAJ11*01 ENST00000390527.1 F ENST00000390527.1 TRAJ10*01 ENST00000390528.1 F ENST00000390528.1 TRAJ9*01 ENST00000390529.1 F ENST00000390529.1 TRAJ8*01 ENST00000390530.1 F ENST00000390530.1 TRAJ7*01 ENST00000390531.1 F ENST00000390531.1 TRAJ6*01 ENST00000390532.1 F ENST00000390532.1 TRAJ5*01 ENST00000390533.1 F ENST00000390533.1 TRAJ4*01 ENST00000390534.1 F ENST00000390534.1 TRAJ3*01 ENST00000390535.2 ORF ENST00000390535.2 TRAJ2*01 ENST00000390536.2 TRAJ1*01 ENST00000390536.2 ORF ENST00000216327.6 non canonical TEC ENST00000216327.6 not organism-supported ENST00000537243.1 not organism-supported ENST00000541962.1 not organism-supported ENST00000414424.1 unitary_pseudogene ENST00000285850.7 alternative 5' UTR ENST00000397532.3 alternative 5' UTR ENST00000397529.2 alternative 5' UTR ENST00000397528.4 alternative 5' UTR ENST00000554758.1 alternative 5' UTR ENST00000488800.1 alternative 5' UTR ENST00000555251.1 alternative 5' UTR ENST00000557629.1 alternative 5' UTR ENST00000555911.1 alternative 5' UTR ENST00000557129.1 alternative 5' UTR ENST00000554741.1 alternative 5' UTR ENST00000555959.1 alternative 5' UTR ENST00000553874.1 alternative 5' UTR ENST00000553351.1 alternative 5' UTR ENST00000553632.1 alternative 5' UTR ENST00000355151.5 NP_848026.1 ENST00000553482.1 NAGNAG splice site ENST00000556654.1 NMD likely if extended ENST00000397496.3 NP_851313.1 ENST00000397496.3 not organism-supported ENST00000555345.1 NP_851822.1 ENST00000432849.3 NAGNAG splice site ENST00000553711.1 NP_851821.1 ENST00000556465.1 NAGNAG splice site ENST00000397505.2 NP_851824.1 ENST00000556840.1 alternative 5' UTR ENST00000548162.1 not organism-supported ENST00000553884.1 NAGNAG splice site ENST00000556984.1 NMD likely if extended ENST00000557549.1 alternative 5' UTR ENST00000555676.1 alternative 5' UTR ENST00000557571.1 alternative 5' UTR ENST00000556862.1 alternative 5' UTR ENST00000557464.1 alternative 5' UTR ENST00000554618.1 alternative 5' UTR ENST00000553876.1 alternative 5' UTR ENST00000555691.1 alternative 5' UTR ENST00000397441.2 NP_001034708.1 ENST00000476175.2 NMD likely if extended ENST00000454731.2 NAGNAG splice site ENST00000342454.8 alternative 5' UTR ENST00000555986.1 alternative 5' UTR ENST00000555040.1 alternative 5' UTR ENST00000554349.1 NMD likely if extended ENST00000554373.1 NMD likely if extended ENST00000554651.1 NMD likely if extended ENST00000554516.1 alternative 5' UTR ENST00000557591.1 alternative 5' UTR ENST00000554406.1 alternative 5' UTR ENST00000397388.3 NP_932352.1 ENST00000553592.1 alternative 5' UTR ENST00000556731.1 alternative 5' UTR ENST00000553911.1 alternative 5' UTR ENST00000397379.3 alternative 5' UTR ENST00000397382.4 alternative 5' UTR ENST00000397380.2 alternative 5' UTR ENST00000553675.1 alternative 5' UTR ENST00000553931.1 alternative 5' UTR ENST00000555575.1 alternative 5' UTR ENST00000555098.1 alternative 5' UTR ENST00000555998.1 alternative 5' UTR ENST00000556419.1 alternative 5' UTR ENST00000553606.1 alternative 5' UTR ENST00000554179.1 alternative 5' UTR ENST00000557513.1 alternative 5' UTR ENST00000553316.1 alternative 5' UTR ENST00000556896.1 alternative 5' UTR ENST00000493471.2 NP_001138404.1 ENST00000425762.2 NP_001124197.1 ENST00000557515.1 NAGNAG splice site ENST00000557515.1 not organism-supported ENST00000357481.2 alternative 5' UTR ENST00000555053.1 NAGNAG splice site ENST00000554203.1 alternative 5' UTR ENST00000453702.1 NP_877392.1 ENST00000524758.1 alternative 5' UTR ENST00000525062.1 alternative 5' UTR ENST00000399910.1 not organism-supported ENST00000399905.1 not organism-supported ENST00000452015.3 NMD exception ENST00000558058.1 NMD exception ENST00000559314.1 NMD exception ENST00000560913.1 NMD exception ENST00000559942.1 NMD exception ENST00000561437.1 NMD exception ENST00000553824.1 alternative 5' UTR ENST00000557236.1 alternative 5' UTR ENST00000557579.1 alternative 5' UTR ENST00000554635.1 alternative 5' UTR ENST00000557008.1 not organism-supported ENST00000557008.1 alternative 5' UTR ENST00000397260.3 not organism-supported ENST00000555731.1 dotter confirmed ENST00000419474.2 not organism-supported ENST00000555334.1 not organism-supported ENST00000555334.1 alternative 5' UTR ENST00000412565.1 alternative 5' UTR ENST00000404535.3 alternative 5' UTR ENST00000557630.1 alternative 5' UTR ENST00000397120.3 alternative 5' UTR ENST00000556277.1 NMD likely if extended ENST00000556277.1 alternative 5' UTR ENST00000556943.1 alternative 5' UTR ENST00000557482.1 alternative 5' UTR ENST00000557189.1 alternative 5' UTR ENST00000556843.1 alternative 5' UTR ENST00000397118.3 alternative 5' UTR ENST00000432832.2 alternative 5' UTR ENST00000556729.1 dotter confirmed ENST00000558581.1 confirm experimentally ENST00000559411.1 confirm experimentally ENST00000342740.5 confirm experimentally ENST00000342740.5 not organism-supported ENST00000560356.1 alternative 5' UTR ENST00000558450.1 alternative 5' UTR ENST00000559778.1 alternative 5' UTR ENST00000560761.1 alternative 5' UTR ENST00000557889.1 alternative 5' UTR ENST00000558541.1 alternative 5' UTR ENST00000559197.1 alternative 5' UTR ENST00000561028.1 alternative 5' UTR ENST00000396997.1 alternative 5' UTR ENST00000558280.1 alternative 5' UTR ENST00000559017.1 alternative 5' UTR ENST00000559115.1 alternative 5' UTR ENST00000558215.1 alternative 5' UTR ENST00000557810.1 alternative 5' UTR ENST00000561375.1 alternative 5' UTR ENST00000559796.1 alternative 5' UTR ENST00000560713.1 alternative 5' UTR ENST00000559382.1 alternative 5' UTR ENST00000561001.1 alternative 5' UTR ENST00000559396.1 alternative 5' UTR ENST00000558638.1 alternative 5' UTR ENST00000561041.1 alternative 5' UTR ENST00000558408.1 alternative 5' UTR ENST00000559354.1 alternative 5' UTR ENST00000560459.1 alternative 5' UTR ENST00000559593.1 alternative 5' UTR ENST00000267426.5 LOC161247 ENST00000382708.3 NP_788955.1 ENST00000561435.1 dotter confirmed ENST00000419198.2 alternative 5' UTR ENST00000558200.1 NMD likely if extended ENST00000558200.1 alternative 5' UTR ENST00000559613.1 NMD likely if extended ENST00000561103.1 alternative 5' UTR ENST00000560875.1 alternative 5' UTR ENST00000557991.1 alternative 5' UTR ENST00000558468.1 subject to nonsense-mediated decay ENST00000557806.1 alternative 5' UTR ENST00000559919.1 alternative 5' UTR ENST00000561419.1 subject to nonsense-mediated decay ENST00000528669.1 not organism-supported ENST00000524835.1 Genbank BAG65421.1 ENST00000396854.4 NP_001014842.1 ENST00000530563.1 alternative 5' UTR ENST00000530468.1 alternative 5' UTR ENST00000525592.1 alternative 5' UTR ENST00000528010.1 alternative 5' UTR ENST00000555092.1 not organism-supported ENST00000347519.6 NP_054888 ENST00000355299.4 alternative 5' UTR ENST00000399440.2 alternative 5' UTR ENST00000420554.2 NP_057660.2 ENST00000558510.1 NMD likely if extended ENST00000558074.1 alternative 5' UTR ENST00000560443.1 alternative 5' UTR ENST00000560478.1 alternative 5' UTR ENST00000560226.1 alternative 5' UTR ENST00000561067.1 alternative 5' UTR ENST00000399409.3 NP_004572.3 ENST00000399409.3 alternative 5' UTR ENST00000216840.6 NP_878256.1 ENST00000558376.1 alternative 5' UTR ENST00000543002.1 alternative 5' UTR ENST00000396813.1 alternative 5' UTR ENST00000559483.1 NMD likely if extended ENST00000554411.1 alternative 5' UTR ENST00000336557.5 alternative 5' UTR ENST00000527924.2 alternative 5' UTR ENST00000533293.1 NP_062813.2 ENST00000530080.1 alternative 5' UTR ENST00000553481.1 alternative 5' UTR ENST00000345363.3 alternative 5' UTR ENST00000396782.2 alternative 5' UTR ENST00000554068.2 alternative 5' UTR ENST00000554781.1 alternative 5' UTR ENST00000418030.2 alternative 5' UTR ENST00000557099.2 alternative 5' UTR ENST00000559167.1 alternative 5' UTR ENST00000558563.1 alternative 5' UTR ENST00000558125.1 alternative 5' UTR ENST00000561138.1 alternative 5' UTR ENST00000554338.1 NMD likely if extended ENST00000413692.2 NP_001129494.1 ENST00000554903.1 alternative 5' UTR ENST00000250373.4 NP_004545.2 ENST00000554344.1 alternative 5' UTR ENST00000251343.5 alternative 5' UTR ENST00000556842.1 alternative 5' UTR ENST00000556510.1 alternative 5' UTR ENST00000556255.1 not organism-supported ENST00000530830.1 not organism-supported ENST00000323944.5 alternative 5' UTR ENST00000419632.2 alternative 5' UTR ENST00000546511.1 alternative 5' UTR ENST00000549503.1 downstream ATG ENST00000550944.1 alternative 5' UTR ENST00000547209.1 non canonical TEC ENST00000553504.1 not organism-supported ENST00000554714.1 alternative 5' UTR ENST00000547532.1 alternative 5' UTR ENST00000555429.1 alternative 5' UTR ENST00000554776.1 not organism-supported ENST00000216361.4 alternative 5' UTR ENST00000357479.5 not organism-supported ENST00000554991.1 not organism-supported ENST00000556577.1 not organism-supported ENST00000557346.1 alternative 5' UTR ENST00000556232.1 alternative 5' UTR ENST00000555417.1 upstream uORF ENST00000555417.1 alternative 5' UTR ENST00000554882.1 not organism-supported ENST00000556224.1 alternative 5' UTR ENST00000549184.1 alternative 5' UTR ENST00000547760.1 non canonical TEC ENST00000553596.1 C14orf128 chromosome 14 open reading frame 128 ENST00000555814.1 alternative 5' UTR ENST00000556191.1 alternative 5' UTR ENST00000554090.1 alternative 5' UTR ENST00000557102.1 alternative 5' UTR ENST00000557272.1 not organism-supported ENST00000551634.1 not organism-supported ENST00000551492.1 not organism-supported ENST00000396526.3 NP_067072.3 ENST00000362031.4 downstream ATG ENST00000341223.3 CCDS:CCDS9650.1 ENST00000298159.6 CCDS:CCDS9649.1 ENST00000382422.2 CCDS:CCDS9651.1 ENST00000554865.1 not organism-supported ENST00000556747.1 confirm experimentally ENST00000556747.1 non-submitted evidence ENST00000556994.1 CCDS9652.1 ENST00000554803.1 alternative 5' UTR ENST00000555746.1 alternative 5' UTR ENST00000555211.1 alternative 5' UTR ENST00000382406.3 CCDS41944.1 ENST00000280987.4 CCDS9653.1 ENST00000261475.5 CCDS9654.1 ENST00000554361.1 not organism-supported ENST00000555630.1 not organism-supported ENST00000557278.1 alternative 5' UTR ENST00000553282.1 not organism-supported ENST00000553978.1 alternative 5' UTR ENST00000554727.1 alternative 5' UTR ENST00000556115.1 alternative 5' UTR ENST00000534898.2 CCDS32063.1 ENST00000556121.1 alternative 5' UTR ENST00000557565.1 subject to nonsense-mediated decay ENST00000261479.4 CCDS9655.1 ENST00000554620.1 not organism-supported ENST00000556506.1 not organism-supported ENST00000216797.5 CCDS9656.1 ENST00000553342.1 not organism-supported ENST00000518149.1 not organism-supported ENST00000518149.1 alternative 5' UTR ENST00000522719.2 alternative 5' UTR ENST00000546983.1 alternative 5' UTR ENST00000554930.1 not organism-supported ENST00000556753.1 not organism-supported ENST00000556753.1 alternative 5' UTR ENST00000250448.2 CCDS:CCDS9665.1 ENST00000553443.1 confirm experimentally ENST00000555017.1 alternative 5' UTR ENST00000556092.1 alternative 5' UTR ENST00000548032.2 alternative 5' UTR ENST00000555425.1 alternative 5' UTR ENST00000557437.1 alternative 5' UTR ENST00000531684.1 not organism-supported ENST00000527381.1 not organism-supported ENST00000557148.1 alternative 5' UTR ENST00000280083.3 CCDS:CCDS9674.1 ENST00000554932.1 alternative 5' UTR ENST00000554120.1 not organism-supported ENST00000556405.1 non canonical TEC ENST00000325192.3 overlapping uORF ENST00000557112.1 not organism-supported ENST00000553841.1 not organism-supported ENST00000556500.1 alternative 5' UTR ENST00000556239.1 alternative 5' UTR ENST00000557468.1 not organism-supported ENST00000557468.1 alternative 5' UTR ENST00000506005.2 non canonical TEC ENST00000554439.1 not organism-supported ENST00000554429.1 alternative 3' UTR ENST00000554429.1 not organism-supported ENST00000554081.1 not organism-supported ENST00000557110.1 not organism-supported ENST00000451174.1 alternative 5' UTR ENST00000357362.3 NP_878250 ENST00000396020.3 NP_001025172.1 ENST00000216367.5 non canonical conserved ENST00000539565.2 non canonical conserved ENST00000491402.1 CCDS:CCDS9696.1 ENST00000421284.3 alternative 3' UTR ENST00000554990.1 non canonical conserved ENST00000013125.4 non canonical conserved ENST00000441560.2 NP_001121185.1 ENST00000555960.1 alternative 5' UTR ENST00000553509.1 alternative 5' UTR ENST00000382043.4 NP_057434.4 ENST00000496749.1 alternative 5' UTR ENST00000356218.4 alternative 5' UTR ENST00000557376.1 downstream ATG ENST00000553560.1 alternative 5' UTR ENST00000335281.4 alternative 5' UTR ENST00000555472.1 alternative 5' UTR ENST00000556766.1 alternative 5' UTR ENST00000554736.1 alternative 5' UTR ENST00000554875.1 downstream ATG ENST00000321662.6 BC160121 ENST00000445930.2 CCDS9710 ENST00000557240.1 not organism-supported ENST00000555339.1 not organism-supported ENST00000556813.1 not organism-supported ENST00000442123.2 alternative 5' UTR ENST00000554230.1 not organism-supported ENST00000557604.1 alternative 5' UTR ENST00000395631.2 alternative 5' UTR ENST00000341590.3 CCDS9713 ENST00000554152.1 not organism-supported ENST00000554712.1 alternative 5' UTR ENST00000555621.1 non canonical TEC ENST00000559087.1 alternative 5' UTR ENST00000558984.1 alternative 5' UTR ENST00000559642.1 alternative 5' UTR ENST00000554908.1 non canonical conserved ENST00000358056.3 non canonical conserved ENST00000553333.1 non canonical conserved ENST00000555846.1 alternative 5' UTR ENST00000339298.2 alternative 5' UTR ENST00000247219.5 CCDS9724 ENST00000556755.1 non canonical TEC ENST00000335142.5 alternative 5' UTR ENST00000557267.1 alternative 5' UTR ENST00000555498.1 alternative 5' UTR ENST00000459737.1 CCDS9725 ENST00000556810.1 upstream uORF ENST00000556422.1 upstream uORF ENST00000554597.1 alternative 3' UTR ENST00000408990.3 alternative 5' UTR ENST00000554845.1 alternative 5' UTR ENST00000555804.1 alternative 5' UTR ENST00000413566.2 upstream uORF ENST00000431972.2 non canonical TEC ENST00000556377.1 alternative 3' UTR ENST00000556826.1 upstream uORF ENST00000556826.1 not organism-supported ENST00000554729.1 upstream uORF ENST00000557430.1 non canonical TEC ENST00000254286.4 non canonical conserved ENST00000556694.1 non canonical conserved ENST00000424658.1 alternative 5' UTR ENST00000555593.1 alternative 5' UTR ENST00000555061.1 alternative 5' UTR ENST00000555404.1 alternative 5' UTR ENST00000555097.1 alternative 5' UTR ENST00000395153.3 CCDS41961.1 ENST00000267484.5 CCDS9740 ENST00000317623.4 NP_071940.4 ENST00000391611.2 not organism-supported ENST00000483571.1 not organism-supported ENST00000553986.1 not organism-supported ENST00000557326.1 alternative 5' UTR ENST00000325642.3 NP_808821.2 ENST00000532036.2 not organism-supported ENST00000528241.2 alternative 5' UTR ENST00000525399.2 alternative 5' UTR ENST00000531937.1 alternative 5' UTR ENST00000556799.1 alternative 5' UTR ENST00000539616.2 NP_001171434.1 ENST00000557134.1 alternative 3' UTR ENST00000557294.1 alternative 5' UTR ENST00000557447.1 not organism-supported ENST00000394942.2 alternative 5' UTR ENST00000554572.1 alternative 5' UTR ENST00000394715.1 alternative 5' UTR ENST00000394718.3 alternative 5' UTR ENST00000556818.1 NAGNAG splice site ENST00000553583.1 alternative 5' UTR ENST00000556965.1 alternative 5' UTR ENST00000358738.3 NP_055765 ENST00000555321.1 alternative 5' UTR ENST00000467261.1 not organism-supported ENST00000555982.1 alternative 5' UTR ENST00000554499.1 alternative 5' UTR ENST00000552002.1 NP_660148.3 ENST00000549115.1 NP_001190992 ENST00000549115.1 NAGNAG splice site ENST00000548752.2 NP_001190993 ENST00000267512.5 NP_941959 ENST00000533601.2 not organism-supported ENST00000341653.2 NP_932061 ENST00000284165.6 NP_660092 ENST00000555419.1 not organism-supported ENST00000557277.1 upstream uORF ENST00000557277.1 overlapping uORF ENST00000556892.1 upstream uORF ENST00000246163.2 NP_660089 ENST00000394586.2 alternative 5' UTR ENST00000556518.1 alternative 5' UTR ENST00000557164.1 NP_004471.4 ENST00000555559.1 alternative 5' UTR ENST00000553924.1 alternative 5' UTR ENST00000554610.1 alternative 5' UTR ENST00000554667.1 alternative 5' UTR ENST00000556046.1 not organism-supported ENST00000524914.1 subject to nonsense-mediated decay ENST00000557783.1 alternative 5' UTR ENST00000557237.1 alternative 5' UTR ENST00000555474.1 not organism-supported ENST00000555431.1 not organism-supported ENST00000555723.1 not organism-supported ENST00000555012.1 alternative 5' UTR ENST00000557310.1 alternative 5' UTR ENST00000466499.2 alternative 5' UTR ENST00000555876.1 not organism-supported ENST00000553387.1 not organism-supported ENST00000560722.1 NAGNAG splice site ENST00000485181.1 alternative 5' UTR ENST00000553334.1 alternative 5' UTR ENST00000336440.3 alternative 3' UTR ENST00000376839.3 upstream uORF ENST00000554215.1 alternative 5' UTR ENST00000554681.1 alternative 5' UTR ENST00000409675.1 alternative 5' UTR ENST00000409949.1 alternative 5' UTR ENST00000409242.1 alternative 5' UTR ENST00000413191.1 alternative 5' UTR ENST00000448469.3 alternative 3' UTR ENST00000557697.1 not organism-supported ENST00000031146.4 not organism-supported ENST00000394330.2 NP_891981.1 ENST00000534137.1 NP_489479.1 ENST00000528359.1 NP_150287.1 ENST00000381250.4 not organism-supported ENST00000557151.1 alternative 5' UTR ENST00000358550.2 NAGNAG splice site ENST00000394234.2 NP_851937.1 ENST00000509153.1 NP_851938.2 ENST00000553891.1 not organism-supported ENST00000555072.1 alternative 5' UTR ENST00000527432.1 alternative 5' UTR ENST00000531500.1 alternative 5' UTR ENST00000525161.1 alternative 5' UTR ENST00000557356.1 alternative 5' UTR ENST00000556864.1 alternative 5' UTR ENST00000556533.1 alternative 5' UTR ENST00000556951.1 alternative 5' UTR ENST00000557293.1 alternative 5' UTR ENST00000553719.1 alternative 5' UTR ENST00000553599.1 alternative 5' UTR ENST00000560005.1 alternative 5' UTR ENST00000555254.1 alternative 5' UTR ENST00000553447.2 NMD likely if extended ENST00000554131.1 alternative 5' UTR ENST00000557037.1 alternative 5' UTR ENST00000394164.1 alternative 5' UTR ENST00000556066.1 alternative 5' UTR ENST00000356296.4 alternative 5' UTR ENST00000555307.1 alternative 5' UTR ENST00000554394.1 alternative 5' UTR ENST00000554818.1 alternative 5' UTR ENST00000553558.1 alternative 5' UTR ENST00000556455.1 alternative 5' UTR ENST00000554229.1 alternative 5' UTR ENST00000554113.1 alternative 5' UTR ENST00000555631.1 alternative 5' UTR ENST00000555919.2 alternative 5' UTR ENST00000554871.1 NP_001188295 ENST00000559993.1 alternative 5' UTR ENST00000435371.1 alternative 5' UTR ENST00000421708.1 alternative 5' UTR ENST00000555228.1 alternative 5' UTR ENST00000267568.4 alternative 5' UTR ENST00000554885.1 not organism-supported ENST00000556659.1 alternative 5' UTR ENST00000412490.3 not organism-supported ENST00000556160.1 alternative 5' UTR ENST00000554582.1 alternative 5' UTR ENST00000554797.1 alternative 5' UTR ENST00000554153.1 alternative 5' UTR ENST00000554320.1 alternative 5' UTR ENST00000557177.1 alternative 5' UTR ENST00000554823.1 not organism-supported ENST00000554953.1 alternative 5' UTR ENST00000555592.1 alternative 5' UTR ENST00000553939.1 not organism-supported ENST00000556690.1 not organism-supported ENST00000556359.1 non canonical TEC ENST00000556359.1 overlapping uORF ENST00000557425.1 non canonical TEC ENST00000555330.1 not organism-supported ENST00000553279.1 not organism-supported ENST00000556589.1 upstream uORF ENST00000555249.1 alternative 5' UTR ENST00000556860.1 upstream uORF ENST00000552421.1 not organism-supported ENST00000325680.7 confirm experimentally ENST00000556489.2 non canonical conserved ENST00000556460.1 NAGNAG splice site ENST00000238671.7 NAGNAG splice site ENST00000555647.1 not organism-supported ENST00000555647.1 alternative 5' UTR ENST00000554900.1 not organism-supported ENST00000556776.1 alternative 5' UTR ENST00000238607.6 NAGNAG splice site ENST00000553401.1 not organism-supported ENST00000553713.1 not organism-supported ENST00000556257.1 not organism-supported ENST00000555671.1 not organism-supported ENST00000553263.1 alternative 5' UTR ENST00000557648.1 alternative 5' UTR ENST00000555694.1 alternative 5' UTR ENST00000534151.1 alternative 5' UTR ENST00000238686.8 not organism-supported ENST00000554763.1 alternative 5' UTR ENST00000526130.1 alternative 5' UTR ENST00000525046.1 alternative 5' UTR ENST00000557673.1 alternative 5' UTR ENST00000553823.1 upstream uORF ENST00000553945.1 not organism-supported ENST00000555686.1 overlapping uORF ENST00000555686.1 upstream uORF ENST00000555672.1 overlapping uORF ENST00000555672.1 upstream uORF ENST00000555347.1 overlapping uORF ENST00000419727.2 alternative 5' UTR ENST00000559060.1 not organism-supported ENST00000559060.1 alternative 5' UTR ENST00000557542.1 alternative 5' UTR ENST00000556109.1 alternative 5' UTR ENST00000556663.1 alternative 5' UTR ENST00000509242.1 NP_004443.3 ENST00000556298.1 alternative 5' UTR ENST00000557497.1 alternative 5' UTR ENST00000216450.3 FLJ25377 ENST00000484640.1 FLJ43734 ENST00000554658.1 alternative 5' UTR ENST00000557115.1 alternative 5' UTR ENST00000554447.1 alternative 5' UTR ENST00000555200.1 alternative 5' UTR ENST00000557752.1 subject to nonsense-mediated decay ENST00000557408.1 alternative 5' UTR ENST00000555338.1 alternative 5' UTR ENST00000556514.1 alternative 5' UTR ENST00000554766.1 alternative 5' UTR ENST00000554346.1 alternative 5' UTR ENST00000555389.1 alternative 5' UTR ENST00000555327.1 alternative 5' UTR ENST00000557639.1 alternative 5' UTR ENST00000554846.1 alternative 5' UTR ENST00000553586.1 not organism-supported ENST00000555583.1 alternative 5' UTR ENST00000555603.1 alternative 5' UTR ENST00000343765.2 alternative 5' UTR ENST00000557658.1 alternative 5' UTR ENST00000557466.1 alternative 5' UTR ENST00000557081.1 alternative 5' UTR ENST00000438257.4 alternative 5' UTR ENST00000554188.1 alternative 5' UTR ENST00000553968.1 alternative 5' UTR ENST00000553594.1 alternative 5' UTR ENST00000555529.1 alternative 5' UTR ENST00000556042.1 alternative 5' UTR ENST00000556981.1 alternative 5' UTR ENST00000557055.1 alternative 5' UTR ENST00000554710.1 alternative 5' UTR ENST00000554746.1 alternative 5' UTR ENST00000557316.1 not organism-supported ENST00000555243.1 alternative 5' UTR ENST00000554602.1 alternative 5' UTR ENST00000556945.1 not organism-supported ENST00000555799.1 alternative 5' UTR ENST00000557693.1 alternative 5' UTR ENST00000555120.1 alternative 5' UTR ENST00000557580.1 not organism-supported ENST00000555855.1 alternative 5' UTR ENST00000555034.1 alternative 5' UTR ENST00000553904.1 alternative 5' UTR ENST00000554180.1 alternative 5' UTR ENST00000393454.2 alternative 5' UTR ENST00000556867.1 alternative 5' UTR ENST00000553527.1 alternative 5' UTR ENST00000553989.1 alternative 5' UTR ENST00000556498.1 alternative 5' UTR ENST00000557020.1 alternative 5' UTR ENST00000553542.1 alternative 5' UTR ENST00000556178.1 not organism-supported ENST00000521334.1 alternative 5' UTR ENST00000522837.1 alternative 5' UTR ENST00000518871.1 alternative 5' UTR ENST00000521081.1 alternative 5' UTR ENST00000524232.1 alternative 5' UTR ENST00000522170.1 alternative 5' UTR ENST00000522170.1 not organism-supported ENST00000519950.1 alternative 5' UTR ENST00000523879.1 not organism-supported ENST00000523879.1 alternative 5' UTR ENST00000523837.1 not organism-supported ENST00000518868.1 alternative 5' UTR ENST00000517518.1 alternative 5' UTR ENST00000428926.2 alternative 5' UTR ENST00000517362.1 alternative 5' UTR ENST00000523894.1 alternative 5' UTR ENST00000522322.1 alternative 5' UTR ENST00000523771.1 alternative 5' UTR ENST00000521064.1 alternative 5' UTR ENST00000529102.1 alternative 5' UTR ENST00000557018.1 alternative 5' UTR ENST00000554511.1 alternative 5' UTR ENST00000554560.1 alternative 5' UTR ENST00000556661.1 alternative 5' UTR ENST00000553676.1 alternative 5' UTR ENST00000340892.5 alternative 5' UTR ENST00000360594.5 alternative 5' UTR ENST00000554468.1 alternative 5' UTR ENST00000393287.5 NP_004984.2 ENST00000503767.1 NP_001121168.1 ENST00000340660.6 NP_001121169 ENST00000554592.1 NAGNAG splice site ENST00000556315.1 NAGNAG splice site ENST00000526872.1 not organism-supported ENST00000553377.1 alternative 5' UTR ENST00000553427.1 alternative 5' UTR ENST00000531433.1 NP_705933.2 ENST00000532405.1 NP_705932.2 ENST00000393218.2 alternative 5' UTR ENST00000554397.1 alternative 5' UTR ENST00000554919.1 alternative 5' UTR ENST00000554080.1 alternative 5' UTR ENST00000553371.1 alternative 5' UTR ENST00000553918.1 alternative 5' UTR ENST00000556603.1 alternative 5' UTR ENST00000553452.1 alternative 5' UTR ENST00000557309.1 alternative 5' UTR ENST00000556883.1 alternative 5' UTR ENST00000554968.1 alternative 5' UTR ENST00000555664.1 not organism-supported ENST00000557719.1 alternative 5' UTR ENST00000554404.1 alternative 5' UTR ENST00000393115.3 alternative 5' UTR ENST00000555341.1 alternative 5' UTR ENST00000554448.1 alternative 5' UTR ENST00000554800.1 alternative 5' UTR ENST00000556544.1 alternative 5' UTR ENST00000298902.5 alternative 5' UTR ENST00000555819.1 alternative 5' UTR ENST00000553661.1 alternative 5' UTR ENST00000554173.1 alternative 5' UTR ENST00000557225.1 alternative 5' UTR ENST00000393087.4 alternative 5' UTR ENST00000393088.4 alternative 5' UTR ENST00000404814.4 alternative 5' UTR ENST00000449399.3 alternative 5' UTR ENST00000556091.1 alternative 5' UTR ENST00000557492.1 alternative 5' UTR ENST00000556955.1 alternative 5' UTR ENST00000553327.1 alternative 5' UTR ENST00000557118.1 alternative 5' UTR ENST00000556881.1 alternative 5' UTR ENST00000557004.1 alternative 5' UTR ENST00000298841.5 alternative 5' UTR ENST00000554220.1 alternative 5' UTR ENST00000554760.1 alternative 5' UTR ENST00000554866.1 alternative 5' UTR ENST00000556775.1 alternative 5' UTR ENST00000553511.1 alternative 5' UTR ENST00000554633.1 alternative 5' UTR ENST00000555681.1 alternative 5' UTR ENST00000554276.1 alternative 5' UTR ENST00000557598.1 alternative 5' UTR ENST00000555820.1 alternative 5' UTR ENST00000467132.1 alternative 5' UTR ENST00000526495.1 alternative 5' UTR ENST00000527414.1 alternative 5' UTR ENST00000531162.1 alternative 5' UTR ENST00000529720.1 alternative 5' UTR ENST00000527865.1 alternative 5' UTR ENST00000439999.1 FLJ45244 ENST00000556450.1 alternative 3' UTR ENST00000557043.1 NMD likely if extended ENST00000554119.1 alternative 3' UTR ENST00000556156.1 alternative 3' UTR ENST00000555202.1 alternative 3' UTR ENST00000542454.2 alternative 5' UTR ENST00000555383.1 dotter confirmed ENST00000555181.1 alternative 5' UTR ENST00000553699.1 alternative 5' UTR ENST00000554182.1 alternative 5' UTR ENST00000555757.1 alternative 5' UTR ENST00000553378.1 confirm experimentally ENST00000555496.1 dotter confirmed ENST00000557222.1 dotter confirmed ENST00000557296.1 alternative 5' UTR ENST00000541516.1 alternative 5' UTR ENST00000453938.1 NMD likely if extended ENST00000557441.1 alternative 5' UTR ENST00000555842.1 alternative 5' UTR ENST00000555942.1 NAGNAG splice site ENST00000555822.1 alternative 5' UTR ENST00000554996.1 NMD likely if extended ENST00000554877.1 alternative 5' UTR ENST00000557733.1 dotter confirmed ENST00000556199.1 NAGNAG splice site ENST00000555096.1 NAGNAG splice site ENST00000556714.1 alternative 5' UTR ENST00000557153.1 alternative 5' UTR ENST00000554371.1 alternative 5' UTR ENST00000555735.1 confirm experimentally ENST00000556505.1 alternative 5' UTR ENST00000555927.1 alternative 5' UTR ENST00000556715.1 alternative 3' UTR ENST00000554291.1 alternative 5' UTR ENST00000556458.1 dotter confirmed ENST00000358655.4 alternative 5' UTR ENST00000355338.2 alternative 5' UTR ENST00000344102.5 alternative 5' UTR ENST00000557135.1 alternative 5' UTR ENST00000556645.1 NP_998810 ENST00000554100.1 dotter confirmed ENST00000553395.1 alternative 5' UTR ENST00000556504.1 alternative 5' UTR ENST00000557722.1 alternative 5' UTR ENST00000557297.1 alternative 5' UTR ENST00000556435.1 alternative 5' UTR ENST00000556338.1 alternative 5' UTR ENST00000556698.1 alternative 5' UTR ENST00000553524.1 alternative 5' UTR ENST00000554772.1 alternative 5' UTR ENST00000556660.1 alternative 5' UTR ENST00000553413.1 NAGNAG splice site ENST00000553413.1 alternative 5' UTR ENST00000553769.1 alternative 5' UTR ENST00000553545.1 alternative 5' UTR ENST00000554820.1 alternative 5' UTR ENST00000556209.1 alternative 5' UTR ENST00000554605.1 alternative 5' UTR ENST00000555813.1 alternative 5' UTR ENST00000556695.1 alternative 5' UTR ENST00000556295.1 alternative 5' UTR ENST00000555031.1 alternative 5' UTR ENST00000553934.1 alternative 5' UTR ENST00000553581.1 alternative 5' UTR ENST00000554998.1 alternative 5' UTR ENST00000335290.6 alternative 5' UTR ENST00000556188.1 alternative 5' UTR ENST00000554356.1 alternative 5' UTR ENST00000557378.1 alternative 5' UTR ENST00000554540.1 dotter confirmed ENST00000392848.5 alternative 5' UTR ENST00000429159.2 NR_002766 ENST00000429159.2 PMID:10759892 ENST00000520714.1 NR_003531 ENST00000520714.1 PMID:10759892 ENST00000423456.1 NR_003530 ENST00000423456.1 PMID:10759892 ENST00000554693.1 dotter confirmed ENST00000444846.1 dotter confirmed ENST00000554735.1 TEC ENST00000554735.1 confirm experimentally ENST00000359323.3 upstream ATG ENST00000359323.3 NP_001353.4 ENST00000328724.5 NP_001155198.1 ENST00000557268.1 NP_001155197.1 ENST00000350249.3 NP_848701.1 ENST00000557621.1 not organism-supported ENST00000554137.1 not organism-supported ENST00000558600.1 NAGNAG splice site ENST00000556511.2 NP_851825.1 ENST00000522874.1 not organism-supported ENST00000519265.1 not organism-supported ENST00000559185.1 alternative 5' UTR ENST00000536961.2 NP_001171082.1 ENST00000541568.2 NP_001171083.1 ENST00000558678.1 NP_001166102.1 ENST00000559651.1 alternative 5' UTR ENST00000560748.1 alternative 5' UTR ENST00000559404.1 alternative 5' UTR ENST00000557902.1 alternative 5' UTR ENST00000392745.2 alternative 5' UTR ENST00000560463.1 alternative 5' UTR ENST00000558056.1 alternative 5' UTR ENST00000560338.1 alternative 5' UTR ENST00000560763.1 alternative 5' UTR ENST00000558316.1 alternative 5' UTR ENST00000558265.1 alternative 5' UTR ENST00000561325.1 alternative 5' UTR ENST00000392715.2 alternative 5' UTR ENST00000559130.1 alternative 5' UTR ENST00000559532.1 alternative 5' UTR ENST00000558506.1 alternative 5' UTR ENST00000553878.1 alternative 5' UTR ENST00000557666.1 alternative 5' UTR ENST00000557172.1 alternative 5' UTR ENST00000553286.1 alternative 3' UTR ENST00000554913.1 alternative 5' UTR ENST00000553264.1 alternative 5' UTR ENST00000555055.1 alternative 5' UTR ENST00000556980.1 alternative 5' UTR ENST00000555964.1 alternative 5' UTR ENST00000556682.1 alternative 5' UTR ENST00000553332.1 alternative 5' UTR ENST00000554880.1 alternative 5' UTR ENST00000557040.1 alternative 5' UTR ENST00000557649.1 alternative 5' UTR ENST00000554581.1 alternative 5' UTR ENST00000407796.2 alternative 5' UTR ENST00000402615.2 alternative 5' UTR ENST00000554848.1 alternative 5' UTR ENST00000555926.1 alternative 5' UTR ENST00000342537.7 alternative 5' UTR ENST00000392590.3 alternative 3' UTR ENST00000539291.2 alternative 5' UTR ENST00000549990.1 alternative 5' UTR ENST00000549655.1 alternative 5' UTR ENST00000552127.1 alternative 5' UTR ENST00000550208.1 alternative 5' UTR ENST00000550375.1 alternative 5' UTR ENST00000537513.2 alternative 5' UTR ENST00000547217.1 not organism-supported ENST00000551743.1 not organism-supported ENST00000330233.7 alternative 5' UTR ENST00000392531.3 alternative 5' UTR ENST00000477724.2 subject to nonsense-mediated decay ENST00000553228.1 subject to nonsense-mediated decay ENST00000547184.1 subject to nonsense-mediated decay ENST00000550554.1 subject to nonsense-mediated decay ENST00000551180.1 subject to nonsense-mediated decay ENST00000427614.1 alternative 5' UTR ENST00000455454.1 alternative 5' UTR ENST00000392527.1 alternative 5' UTR ENST00000443229.1 alternative 5' UTR ENST00000421892.1 alternative 5' UTR ENST00000451719.1 alternative 5' UTR ENST00000390539.2 This is one of the 9 functional genes of the IGHC group which comprises 11 mapped genes ENST00000390541.2 IGHE*02, Cepsilon-1 ENST00000390541.2 This is one of the 9 functional genes of the human IGHC group which comprises 11 mapped genes ENST00000390545.2 This is one of the 9 functional genes of the IGHC group which comprises 11 mapped genes ENST00000390545.2 IGHG2*01. Cgamma2 ENST00000390547.2 IGHA1*01 ENST00000390547.2 This is one of the 9 functional genes of the human IGHC group which comprises 11 mapped genes ENST00000390549.2 IGHG1*01, gamma-1 ENST00000390549.2 This is one of the 9 functional genes of the human IGHC group which comprises 11 mapped genes ENST00000390542.2 This is one of the 9 functional genes of the human IGHC group which comprises 11 mapped genes ENST00000390551.2 This is one of the 9 functional genes of the human IGHC group which comprises 11 mapped genes ENST00000390556.2 This is one of the 9 functional genes of the human IGHC group which comprises 11 mapped genes ENST00000390559.2 This is one of the 9 functional genes of the human IGHC group which comprises 11 mapped genes. The IGHM gene comprises four exons encoding the CH1, CH2, CH3 and CH4 domains and two transmembrane exons (M1 and M2) ENST00000390560.2 IGHJ6*03 (4) (3) ENST00000488476.1 IGHJ5*02 (2) (3) ENST00000461719.1 IGHJ4*01 (1) (1) ENST00000463911.1 IGHJ3*02 (2) (3) allele ENST00000390564.2 IGHJ2*01 (1) (1) allele ENST00000390565.1 IGHJ1*01 (1) (1) allele ENST00000439842.1 IGHD7-27*01, DHQ52 allele ENST00000390567.1 IGHD1-26*01, D1-26 allele ENST00000452198.1 IGHD6-25*01, D6-25 allele ENST00000390569.1 IGHD5-24*01, D5-24 allele ENST00000390569.1 This gene is an ORF due to the presence of a non-conserved 5' D-heptamer ENST00000437320.1 IGHD4-23*01, D4-17 allele ENST00000437320.1 This gene is an ORF due to a non-conserved 5' D-heptamer ENST00000390571.1 IGHD3-22*01, D21/9 allele ENST00000390572.1 IGHD2-21*02, D2-21 allele ENST00000450276.1 IGHD1-20*01, D1-20 allele ENST00000390574.1 IGHD6-19*01, D6-19 allele ENST00000390575.1 IGHD5-18*01, D5-18 allele ENST00000431870.1 IGHD4-17*01, D4-17 allele ENST00000390577.1 IGHD3-16*02 allele ENST00000390578.1 IGHD2-15*01, D2 allele ENST00000451044.1 This gene is an ORF due to non-conserved 5' and 3' D-heptamers ENST00000451044.1 IGHD1-14*01, DM2 allele ENST00000390580.1 IGHD6-13*01, DN1 allele ENST00000390581.1 IGHD5-12*01, DK1 allele ENST00000431440.2 This gene is an ORF due to a non-conserved 5' D-heptamer ENST00000431440.2 IGHD4-11*01, DA1 allele ENST00000390583.1 IGHD3-10*01, DXP'1 allele ENST00000390584.1 IGHD3-9*01, DXP1 allele ENST00000390585.1 IGHD2-8*01, DLR1 allele ENST00000430425.1 IGHD1-7*01, DM1 allele ENST00000454691.1 IGHD6-6*01, DN4 allele ENST00000390588.1 IGHD5-5*01, DK4 allele ENST00000414852.1 IGHD4-4*01, DA4 allele ENST00000390590.1 IGHD3-3*01, DXP4 allele ENST00000390591.1 IGHD2-2*01, D4 allele ENST00000482999.1 FLJ43639 ENST00000454908.1 IGHD1-1*01, D1-1 ENST00000452053.1 FLJ36081 ENST00000390604.2 This is one of the 3-4 mapped ORF of the IGHV3 subgroup. This is an ORF due to an unusual V-heptamer sequence: tcctgtg instead of cacagtg ENST00000390610.2 This is one of the 9 mapped functional genes of the IGHV1 subgroup ENST00000390617.2 This gene is an ORF due to an unusual V-heptamer: cactgtg instead of cacagtg ENST00000390618.2 This is an ORF due to an unusual V-heptamer sequence: cacagag instead of cacagtg ENST00000433371.1 FLJ25367 ENST00000433072.2 This is one of the 18-21 functional genes of the IGHV3 subgroup ENST00000390639.2 This is an ORF because LPART1, V-heptamer and V-nonamer have not yet been sequenced and there is so far no known re-arranged transcript, suggesting some defect outside the V-region ENST00000556948.1 not best-in-genome evidence ENST00000435397.2 not best-in-genome evidence ENST00000355145.7 non-submitted evidence ENST00000355145.7 NM_001001413.3 ENST00000283645.4 corf ENST00000398013.3 alternative 5' UTR ENST00000539711.2 alternative 5' UTR ENST00000560039.1 alternative 5' UTR ENST00000559571.1 alternative 5' UTR ENST00000560205.1 alternative 5' UTR ENST00000558241.1 not best-in-genome evidence ENST00000400100.1 alternative 5' UTR ENST00000400097.1 alternative 5' UTR ENST00000553597.1 alternative 5' UTR ENST00000554227.1 CR595630.1 ENST00000400188.3 NP_001178250 ENST00000545868.1 NP_001178249 ENST00000555094.1 alternative 5' UTR ENST00000555811.1 confirm experimentally ENST00000556636.1 alternative 3' UTR ENST00000355395.5 NP_001158509 ENST00000555182.1 alternative 5' UTR ENST00000557484.1 NMD likely if extended ENST00000554038.1 alternative 5' UTR ENST00000554596.1 alternative 5' UTR ENST00000555060.1 alternative 5' UTR ENST00000554599.1 alternative 5' UTR ENST00000561069.1 alternative 5' UTR ENST00000561069.1 not organism-supported ENST00000559709.1 alternative 5' UTR ENST00000558804.1 alternative 5' UTR ENST00000560283.1 alternative 5' UTR ENST00000558206.1 alternative 5' UTR ENST00000558358.1 alternative 5' UTR ENST00000400007.3 not organism-supported ENST00000545208.2 PMID:7682777 ENST00000558445.1 not organism-supported ENST00000558445.1 alternative 5' UTR ENST00000559177.1 not organism-supported ENST00000560598.1 not organism-supported ENST00000560598.1 alternative 5' UTR ENST00000560677.1 non canonical TEC ENST00000561249.1 not organism-supported ENST00000559917.1 not organism-supported ENST00000559333.1 not organism-supported ENST00000560035.1 alternative 5' UTR ENST00000557877.1 alternative 5' UTR ENST00000560108.1 alternative 5' UTR ENST00000559515.1 alternative 5' UTR ENST00000559464.1 alternative 5' UTR ENST00000560611.1 alternative 5' UTR ENST00000397702.2 alternative 5' UTR ENST00000558667.1 alternative 5' UTR ENST00000561120.1 alternative 5' UTR ENST00000559236.1 alternative 5' UTR ENST00000559484.1 alternative 5' UTR ENST00000537011.1 downstream ATG ENST00000559564.1 alternative 5' UTR ENST00000397624.3 alternative 5' UTR ENST00000557796.1 not organism-supported ENST00000558313.1 alternative 5' UTR ENST00000560841.1 alternative 5' UTR ENST00000558625.1 alternative 5' UTR ENST00000558148.1 alternative 5' UTR ENST00000558158.1 not organism-supported ENST00000560819.1 confirm experimentally ENST00000560198.1 confirm experimentally ENST00000397609.2 NP_775882.2 ENST00000397591.2 alternative 5' UTR ENST00000557801.1 confirm experimentally ENST00000397573.1 alternative 5' UTR ENST00000561360.1 non canonical U12 ENST00000561360.1 alternative 5' UTR ENST00000561282.1 alternative 5' UTR ENST00000557870.1 alternative 5' UTR ENST00000560430.1 alternative 5' UTR ENST00000559414.1 NMD likely if extended ENST00000412359.3 non canonical TEC ENST00000561230.1 alternative 5' UTR ENST00000558055.1 alternative 5' UTR ENST00000560346.1 alternative 5' UTR ENST00000558878.1 downstream ATG ENST00000558183.1 downstream ATG ENST00000560806.1 downstream ATG ENST00000558106.1 alternative 5' UTR ENST00000559617.1 alternative 5' UTR ENST00000559139.1 alternative 5' UTR ENST00000560669.1 alternative 5' UTR ENST00000542403.2 alternative 3' UTR ENST00000558658.1 subject to nonsense-mediated decay ENST00000559435.1 subject to nonsense-mediated decay ENST00000319503.3 NP_001034994 ENST00000559520.1 non canonical TEC ENST00000397536.2 FLJ44047 ENST00000559313.1 NP_997263 ENST00000559313.1 FLJ43339 ENST00000557973.1 NMD likely if extended ENST00000448599.2 NP_001139115.1 ENST00000490194.1 NMD likely if extended ENST00000527860.1 alternative 5' UTR ENST00000423169.2 NP_001157742.1 ENST00000557850.1 non canonical TEC ENST00000532743.1 alternative 5' UTR ENST00000382643.3 NP_001157741.1 ENST00000526763.1 alternative 5' UTR ENST00000446533.3 downstream ATG ENST00000260359.6 NAGNAG splice site ENST00000462276.1 NMD likely if extended ENST00000510535.1 alternative 5' UTR ENST00000382448.4 NP_005081.1 ENST00000405106.1 cDNA from signet-ring cell carcinoma ENST00000483208.1 subject to nonsense-mediated decay ENST00000549793.1 subject to nonsense-mediated decay ENST00000466369.1 subject to nonsense-mediated decay ENST00000495723.1 subject to nonsense-mediated decay ENST00000263801.3 alternative 5' UTR ENST00000382044.4 DKFZp686B146 ENST00000476454.1 FLJ41424 ENST00000360135.4 KIAA0377 ENST00000334933.4 DKFZp686I0669 ENST00000396923.2 DKFZp313L0221 ENST00000488768.1 novel transcript ENST00000437534.1 FLJ37003 ENST00000413453.2 alternative 5' UTR ENST00000471703.1 FLJ42591 ENST00000448437.2 FLJ33438 ENST00000485556.1 FLJ44767 ENST00000432436.1 FLJ16411 ENST00000396879.1 FLJ16016 ENST00000469461.1 DKFZp686K0327 ENST00000429276.1 possible poly-T primed artefact ENST00000319359.3 FLJ22637 ENST00000433927.1 alternative 5' UTR ENST00000417761.1 FLJ35914 ENST00000448553.1 novel transcript FLJ40363 ENST00000457418.1 novel transcript DKFZp686A1799 ENST00000299969.6 GENCODE experimental pipeline ENST00000476490.1 novel transcript ENST00000249786.4 alternative 5' UTR ENST00000402131.1 alternative 5' UTR ENST00000409614.1 alternative 5' UTR ENST00000406925.1 alternative 5' UTR ENST00000458412.1 FLJ12373 ENST00000263795.6 FLJ12973 ENST00000381246.2 novel transcript ENST00000402883.1 not organism-supported ENST00000484674.1 novel transcript FLJ41022 ENST00000479319.1 novel transcript ENST00000299957.6 NP_612432 ENST00000561305.1 alternative 3' UTR ENST00000558791.1 alternative 5' UTR ENST00000558966.1 alternative 5' UTR ENST00000559793.1 alternative 5' UTR ENST00000558968.1 alternative 5' UTR ENST00000558006.1 dotter confirmed ENST00000535302.2 NP_001153699 ENST00000560775.1 NP_001138584 ENST00000559916.1 alternative 3' UTR ENST00000560113.1 confirm experimentally ENST00000338264.4 NAGNAG splice site ENST00000558173.1 alternative 5' UTR ENST00000557864.1 alternative 3' UTR ENST00000323030.5 ortholog of mouse Numb-interacting protein 2 (9030623N16Rik) ENST00000267803.4 ortholog of mouse Numb-interacting protein 1 (BC019755) ENST00000267803.4 Non Canonical Donor splice site between exons one and two of this variant AC091117.4-001 ENST00000559014.1 alternative 5' UTR ENST00000558996.1 alternative 5' UTR ENST00000558326.1 alternative 5' UTR ENST00000559988.1 alternative 5' UTR ENST00000559226.1 alternative 5' UTR ENST00000558377.1 alternative 5' UTR ENST00000559644.1 alternative 5' UTR ENST00000558851.1 Non Canonical Donor splice site between exons one and two of this variant AC091117.4-015 ENST00000558851.1 alternative 5' UTR ENST00000321429.4 alternative 5' UTR ENST00000558322.1 alternative 5' UTR ENST00000290894.8 NP_612365 ENST00000561148.1 alternative 5' UTR ENST00000559885.1 alternative 5' UTR ENST00000396650.2 alternative 5' UTR ENST00000558435.1 NMD likely if extended ENST00000396645.2 alternative 5' UTR ENST00000557832.1 not best-in-genome evidence ENST00000559184.1 alternative 5' UTR ENST00000560636.1 alternative 5' UTR ENST00000561133.1 alternative 5' UTR ENST00000558816.1 NP_705872 ENST00000316364.5 alternative 5' UTR ENST00000358066.4 alternative 5' UTR ENST00000559196.1 alternative 5' UTR ENST00000560172.1 alternative 3' UTR ENST00000558813.1 NP_001020420 ENST00000561429.1 dotter confirmed ENST00000537463.2 dotter confirmed ENST00000380950.2 NP_001181927 ENST00000558591.1 alternative 5' UTR ENST00000558220.1 alternative 5' UTR ENST00000327171.3 NP_001001556.1 ENST00000560654.1 alternative 5' UTR ENST00000558145.1 alternative 5' UTR ENST00000544523.1 alternative 5' UTR ENST00000559454.1 alternative 5' UTR ENST00000299338.6 non canonical U12 ENST00000559905.1 alternative 5' UTR ENST00000403028.3 alternative 5' UTR ENST00000558653.1 alternative 5' UTR ENST00000559164.1 dotter confirmed ENST00000560632.1 NAGNAG splice site ENST00000559405.1 alternative 5' UTR ENST00000558498.1 NMD likely if extended ENST00000560479.1 NMD likely if extended ENST00000558829.1 alternative 5' UTR ENST00000380902.4 NP_001153101 ENST00000559513.1 dotter confirmed ENST00000558335.1 alternative 5' UTR ENST00000558970.1 alternative 5' UTR ENST00000560896.1 confirm experimentally ENST00000560187.1 confirm experimentally ENST00000560297.1 alternative 5' UTR ENST00000307179.4 alternative 5' UTR ENST00000560982.1 alternative 5' UTR ENST00000558091.1 alternative 5' UTR ENST00000532404.1 NP_987090 ENST00000560955.1 NAGNAG splice site ENST00000560849.1 NAGNAG splice site ENST00000561393.1 non canonical U12 ENST00000558439.1 non canonical U12 ENST00000261842.5 non canonical U12 ENST00000560508.1 non canonical U12 ENST00000396404.4 alternative 5' UTR ENST00000559878.1 alternative 5' UTR ENST00000558328.1 alternative 5' UTR ENST00000453807.2 alternative 5' UTR ENST00000557858.1 alternative 5' UTR ENST00000559980.1 alternative 5' UTR ENST00000405011.2 alternative 5' UTR ENST00000559646.1 alternative 5' UTR ENST00000558426.1 upstream uORF ENST00000251076.5 NAGNAG splice site ENST00000543779.2 NP_001167587 ENST00000449909.3 NP_001167588 ENST00000542355.2 NP_001158729 ENST00000558709.1 alternative 5' UTR ENST00000560491.1 alternative 5' UTR ENST00000435126.2 NP_001136357.1 ENST00000558455.1 alternative 5' UTR ENST00000260442.3 NP_065129 ENST00000399229.1 Non-canonical donor splice site at exon two,and non-canonical acceptor splice site at exon three ENST00000553916.1 not organism-supported ENST00000557913.1 alternative 5' UTR ENST00000557913.1 not organism-supported ENST00000360509.5 alternative 5' UTR ENST00000559418.1 not organism-supported ENST00000560036.1 overlapping uORF ENST00000560036.1 alternative 5' UTR ENST00000260323.10 confirm experimentally ENST00000260323.10 NP_001074003.1 ENST00000559847.1 non canonical U12 ENST00000559447.1 non canonical U12 ENST00000559000.1 alternative 5' UTR ENST00000559352.1 alternative 5' UTR ENST00000380569.2 Gcom1 variant for GRINL1A combined transcript 1 ENST00000267853.5 Gup1 variant for GRINL1A upstream transcript 1 ENST00000380565.4 Gup2 variant for GRINL1A upstream transcript 2 ENST00000496101.1 Gcom6 variant for GRINL1A combined transcript 6 ENST00000471563.1 Gcom11 variant for GRINL1A combined transcript 11 ENST00000488175.1 Gcom8 variant for GRINL1A combined transcript 8 ENST00000468886.1 Gcom13 variant for GRINL1A combined transcript 13 ENST00000496627.1 Gcom10 variant for GRINL1A combined transcript 10 ENST00000460962.1 Gcom9 variant for GRINL1A combined transcript 9 ENST00000380568.3 Gcom2 variant for GRINL1A combined transcript 2 ENST00000463717.1 Gcom3 variant for GRINL1A combined transcript 3 ENST00000482814.1 Gcom4 variant for GRINL1A combined transcript 4 ENST00000477282.1 Gcom5 variant for GRINL1A combined transcript 5 ENST00000484300.1 Gcom12 variant for GRINL1A combined transcript 12 ENST00000299638.3 Gdown1 and 3 variants for GRINL1A downstream transcripts 1 and 3 ENST00000464277.1 Gdown4 variants for GRINL1A downstream transcripts 4 ENST00000482852.1 Gdown2 variants for GRINL1A downstream transcripts 2 ENST00000380557.4 Gdown6 variants for GRINL1A downstream transcripts 6 ENST00000464308.1 Gdown5 variants for GRINL1A downstream transcripts 5 ENST00000561070.1 alternative 5' UTR ENST00000558239.1 upstream uORF ENST00000558239.1 alternative 5' UTR ENST00000557967.1 alternative 5' UTR ENST00000356113.6 alternative 5' UTR ENST00000470269.1 Chimaeric cDNA EM:Z48614.1 bases 1-351 found on chrX ENST00000450403.2 NAGNAG splice site ENST00000559757.1 alternative 5' UTR ENST00000560494.1 alternative 3' UTR ENST00000558348.1 alternative 5' UTR ENST00000560394.1 alternative 5' UTR ENST00000559628.1 alternative 5' UTR ENST00000557914.1 alternative 5' UTR ENST00000560474.1 alternative 5' UTR ENST00000560074.1 alternative 5' UTR ENST00000560123.1 alternative 5' UTR ENST00000561361.1 alternative 5' UTR ENST00000559189.1 alternative 5' UTR ENST00000560585.1 alternative 5' UTR ENST00000559626.1 alternative 5' UTR ENST00000559200.1 alternative 5' UTR ENST00000396057.4 upstream uORF ENST00000451270.2 alternative 5' UTR ENST00000560014.1 alternative 5' UTR ENST00000421017.2 alternative 5' UTR ENST00000560466.1 alternative 5' UTR ENST00000559818.1 alternative 5' UTR ENST00000560367.1 alternative 5' UTR ENST00000558998.1 alternative 5' UTR ENST00000560389.1 alternative 5' UTR ENST00000560165.1 alternative 5' UTR ENST00000557906.1 alternative 5' UTR ENST00000559725.1 alternative 5' UTR ENST00000559350.1 alternative 5' UTR ENST00000558558.1 alternative 5' UTR ENST00000558986.1 alternative 5' UTR ENST00000559467.1 alternative 5' UTR ENST00000559956.1 alternative 5' UTR ENST00000560468.1 alternative 5' UTR ENST00000557904.1 alternative 5' UTR ENST00000559370.1 alternative 5' UTR ENST00000558169.1 alternative 5' UTR ENST00000557986.1 alternative 5' UTR ENST00000558512.1 alternative 5' UTR ENST00000560072.1 alternative 5' UTR ENST00000560406.1 alternative 5' UTR ENST00000560520.1 alternative 5' UTR ENST00000559251.1 AI024082 ENST00000395896.4 NP_001018098.1 ENST00000558919.1 not organism-supported ENST00000561322.1 not organism-supported ENST00000558940.1 hypothetical protein MGC15885 ENST00000560347.1 hypothetical protein MGC15885 ENST00000559281.1 not organism-supported ENST00000559257.1 not organism-supported ENST00000559711.1 not organism-supported ENST00000560202.1 not organism-supported ENST00000360587.2 upstream ATG ENST00000558532.1 alternative 5' UTR ENST00000560462.1 alternative 5' UTR ENST00000560316.1 alternative 5' UTR ENST00000559303.1 not organism-supported ENST00000559306.1 alternative 5' UTR ENST00000557835.1 alternative 3' UTR ENST00000560829.1 not organism-supported ENST00000433215.2 alternative 5' UTR ENST00000558460.1 alternative 3' UTR ENST00000544319.1 not organism-supported ENST00000409699.1 NP_115821.2 ENST00000319194.5 MGC4562 ENST00000525134.1 alternative 5' UTR ENST00000532580.1 alternative 5' UTR ENST00000261881.3 FLJ20516 ENST00000512104.1 NP_073621.2 ENST00000554240.1 not organism-supported ENST00000554054.1 not organism-supported ENST00000380035.2 not organism-supported ENST00000561153.1 alternative 5' UTR ENST00000395392.2 not organism-supported ENST00000557919.1 not organism-supported ENST00000560589.1 not organism-supported ENST00000559048.1 NAGNAG splice site ENST00000560939.1 NAGNAG splice site ENST00000558201.1 NAGNAG splice site ENST00000558201.1 not organism-supported ENST00000560441.1 not organism-supported ENST00000560107.1 not organism-supported ENST00000355327.3 FLJ13710 ENST00000357769.4 FLJ13710 ENST00000558964.1 NP_001166095 ENST00000345330.4 neuroplastin isoform b precursor ENST00000351217.5 neuroplastin isoform a precursor ENST00000395118.1 alternative 5' UTR ENST00000360639.2 Human protein TrEMBL: Q6ZRI6.2 ENST00000360639.2 Mouse protein TrEMBL: Q3TEI4.2 ENST00000394987.3 alternative 5' UTR ENST00000360439.4 alternative 5' UTR ENST00000558656.1 not organism-supported ENST00000394885.3 upstream ATG ENST00000346495.2 NP_944492.1 ENST00000560626.1 NP_079052.2 ENST00000300584.3 NP_653173.1 ENST00000409931.3 NP_055894.6 ENST00000409568.2 not organism-supported ENST00000328828.5 confirm experimentally ENST00000440911.2 not organism-supported ENST00000483802.2 not organism-supported ENST00000343789.3 alternative 5' UTR ENST00000343789.3 not organism-supported ENST00000446172.2 NP_001123655.1 ENST00000559082.1 alternative 5' UTR ENST00000413382.2 NP_001096138.1 ENST00000557929.1 NAGNAG splice site ENST00000559365.1 alternative 5' UTR ENST00000559437.1 alternative 5' UTR ENST00000560737.1 alternative 5' UTR ENST00000559751.1 NAGNAG splice site ENST00000558480.1 NP_001139120.1 ENST00000394745.3 NP_722522.1 ENST00000478497.1 alternative 5' UTR ENST00000533983.1 alternative 5' UTR ENST00000220244.3 alternative 5' UTR ENST00000356249.5 alternative 5' UTR ENST00000286732.4 upstream ATG ENST00000559383.1 alternative 5' UTR ENST00000559913.1 NMD likely if extended ENST00000561368.1 alternative 5' UTR ENST00000558090.1 alternative 5' UTR ENST00000513601.1 NM_144597.2 ENST00000510439.2 not best-in-genome evidence ENST00000448803.2 alternative 5' UTR ENST00000546275.1 alternative 5' UTR ENST00000442073.3 alternative 5' UTR ENST00000334141.3 NP_060364 ENST00000502939.2 alternative 5' UTR ENST00000379358.3 NP_001007073 ENST00000540894.1 alternative 3' UTR ENST00000560256.1 alternative 5' UTR ENST00000560741.1 alternative 5' UTR ENST00000561243.1 confirm experimentally ENST00000442287.2 alternative 5' UTR ENST00000528881.1 not organism-supported ENST00000525806.1 not organism-supported ENST00000558360.1 alternative 3' UTR ENST00000268138.7 NAGNAG splice site ENST00000560985.1 NAGNAG splice site ENST00000430628.2 alternative 5' UTR ENST00000559874.1 alternative 5' UTR ENST00000560137.1 alternative 5' UTR ENST00000559419.1 alternative 5' UTR ENST00000559322.1 alternative 5' UTR ENST00000332496.6 alternative 5' UTR ENST00000558895.1 alternative 5' UTR ENST00000559792.1 alternative 5' UTR ENST00000558065.1 NMD likely if extended ENST00000561433.1 alternative 5' UTR ENST00000559204.1 alternative 5' UTR ENST00000558291.1 alternative 5' UTR ENST00000558586.1 alternative 5' UTR ENST00000420329.2 non canonical U12 ENST00000420329.2 NAGNAG splice site ENST00000268184.6 non canonical U12 ENST00000268184.6 NAGNAG splice site ENST00000558619.1 non canonical U12 ENST00000561119.1 non canonical U12 ENST00000558005.1 non canonical U12 ENST00000558599.1 NMD likely if extended ENST00000559353.1 alternative 5' UTR ENST00000416779.1 alternative 5' UTR ENST00000414248.2 NP_001137257 ENST00000452243.1 alternative 5' UTR ENST00000443697.1 alternative 5' UTR ENST00000394300.3 NP_001137255 ENST00000444422.2 NP_001137256 ENST00000448367.1 NMD likely if extended ENST00000558290.1 alternative 5' UTR ENST00000558853.1 alternative 5' UTR ENST00000559999.1 alternative 5' UTR ENST00000559965.1 alternative 5' UTR ENST00000558640.1 NMD likely if extended ENST00000556618.1 alternative 5' UTR ENST00000555434.1 not organism-supported ENST00000556722.1 alternative 5' UTR ENST00000554122.1 not organism-supported ENST00000554828.1 not organism-supported ENST00000268035.6 NAGNAG splice site ENST00000558762.1 NAGNAG splice site ENST00000535714.1 upstream uORF ENST00000561323.1 suspected genomic sequence error affecting CDS in exon 1 ENST00000561306.1 suspected genomic sequence error affecting CDS in exon 1 ENST00000558420.1 suspected genomic sequence error affecting CDS in exon 1 ENST00000558663.1 upstream uORF ENST00000558663.1 alternative 5' UTR ENST00000394135.3 upstream uORF ENST00000394135.3 alternative 5' UTR ENST00000561365.1 alternative 5' UTR ENST00000560279.1 upstream uORF ENST00000560279.1 alternative 5' UTR ENST00000560860.1 alternative 5' UTR ENST00000560772.1 alternative 5' UTR ENST00000558078.1 alternative 5' UTR ENST00000560235.1 alternative 5' UTR ENST00000559399.1 NMD likely if extended ENST00000558861.1 alternative 5' UTR ENST00000560493.1 alternative 5' UTR ENST00000354410.5 overlapping uORF ENST00000558812.1 NP_001124399 ENST00000558049.1 alternative 5' UTR ENST00000449277.2 NP_001124400 ENST00000559903.1 alternative 5' UTR ENST00000344791.2 protein_id: AAH41097.2 ENST00000538112.2 alternative 5' UTR ENST00000394113.1 alternative 5' UTR ENST00000558884.1 alternative 5' UTR ENST00000559639.1 alternative 5' UTR ENST00000559736.1 alternative 5' UTR ENST00000559577.1 alternative 5' UTR ENST00000560934.1 alternative 5' UTR ENST00000560272.1 alternative 5' UTR ENST00000558747.1 not organism-supported ENST00000388948.3 NP_078928.3 ENST00000388948.3 not organism-supported ENST00000534045.1 alternative 5' UTR ENST00000525284.1 NAGNAG splice site ENST00000525617.2 NAGNAG splice site ENST00000538064.1 NAGNAG splice site ENST00000561177.1 suspected genomic sequencing error affecting CDS in exon 1 ENST00000561177.1 NP_002561.1 ENST00000560921.1 suspected genomic sequencing error affecting CDS in exon 1 ENST00000560921.1 NP_612192.1 ENST00000561109.1 suspected genomic sequencing error affecting CDS in exon 1 ENST00000561109.1 NP_612193.1 ENST00000559678.1 suspected genomic sequencing error affecting CDS in exon 1 ENST00000559678.1 NP_612194.1 ENST00000560271.1 suspected genomic sequencing error affecting CDS in exon 1 ENST00000560271.1 NP_612196.1 ENST00000558716.1 suspected genomic sequencing error affecting CDS in exon 1 ENST00000558716.1 NP_612197.1 ENST00000561444.1 suspected genomic sequencing error affecting CDS in exon 1 ENST00000561444.1 NP_612198.2 ENST00000347970.3 NP_079417.2 ENST00000333202.3 NP_510883.2 ENST00000335968.3 NP_689547.2 ENST00000417493.1 GENCODE experimental pipeline ENST00000428730.1 GENCODE experimental pipeline ENST00000405960.2 suspected genomic sequencing error affecting CDS in exon 13 ENST00000445810.1 GENCODE experimental pipeline ENST00000428323.2 suspected genomic sequencing error affecting CDS in exon 11 ENST00000419636.1 GENCODE experimental pipeline ENST00000472539.1 This variant and Z84721.3-002 are identical with the exception of the position of the first exon. The genomic sequence is identical at both positions and current evidence cannot discriminate which is genuine ENST00000496585.1 This variant and Z84721.3-003 are identical with the exception of the position of the first exon. The genomic sequence is identical at both positions and current evidence cannot discriminate which is genuine ENST00000447871.1 GENCODE experimental pipeline ENST00000404312.1 GENCODE experimental pipeline ENST00000397735.3 melanoma antigen P15 ENST00000219479.2 protein expressed in non-metastatic cells 4 ENST00000409413.3 FLJ13841 ENST00000293874.2 alternative 5' UTR ENST00000409527.2 FLJ95129 ENST00000409527.2 alternative 5' UTR ENST00000409439.2 alternative 5' UTR ENST00000422307.1 alternative 5' UTR ENST00000439574.1 alternative 5' UTR ENST00000443147.1 FLJ55593 ENST00000480424.2 FLJ30601 ENST00000476438.1 FLJ34754 ENST00000424439.2 alternative 5' UTR ENST00000248139.3 RAR (RAS like GTPASE) like ENST00000509637.1 PUTATIVE novel protein similar to RAR GTP binding protein and RAS like GTPase ENST00000307650.4 novel protein ENST00000491999.1 novel protein ENST00000382862.2 mesothelin ENST00000455294.1 novel transcript ENST00000552943.1 NAGNAG splice site ENST00000549091.1 Human synthetic construct BC172228.1 supports this variant ENST00000549648.1 NAGNAG splice site ENST00000293879.4 confirm experimentally ENST00000293879.4 Human synthetic construct BC172228.1 supports this variant ENST00000293883.4 DKFZp434F054 ENST00000423653.1 upstream uORF ENST00000543963.1 not organism-supported ENST00000537221.1 not organism-supported ENST00000325437.4 alternative 5' UTR ENST00000355803.3 alternative 5' UTR ENST00000397515.2 alternative 5' UTR ENST00000406620.1 alternative 5' UTR ENST00000403747.1 alternative 5' UTR ENST00000402520.1 RPS20 (40S Ribosomal protein S20) pseudogene ENST00000324385.4 KIAA0734 (C2 domain protein) ENST00000007390.2 novel protein similar to predicted yeast, worm and archae-bacterial proteins ENST00000262318.7 chloride channel 7 ENST00000407190.1 RPS3A (40S ribosomal protein S3A) pseudogene ENST00000440447.1 PUTATIVE novel protein similar to NPTX1 (neuronal pentraxin I) ENST00000497339.1 KIAA0683 ENST00000262319.5 DFKZP434A073 ENST00000397417.1 FLJ10306 ENST00000325962.3 non-oragnsim_supported ENST00000454677.1 novel protein similar to heparan sulfate (glucosamine) 3-O-sulfotransferases ENST00000404088.1 cytochrome C-like polypeptide pseudogene ENST00000343262.3 DKFZp667P2125 ENST00000527302.1 alternative 5' UTR ENST00000497886.1 FLJ43106 ENST00000262306.7 NP_996896.1 ENST00000506153.1 locus is a unitary pseudogene ENST00000318782.8 DKFZp547C0916 ENST00000526464.2 alternative 5' UTR ENST00000440815.3 NAGNAG splice site ENST00000440815.3 alternative 5' UTR ENST00000529550.1 alternative 5' UTR ENST00000551122.1 NAGNAG splice site ENST00000551122.1 alternative 5' UTR ENST00000525643.2 alternative 5' UTR ENST00000548807.1 NAGNAG splice site ENST00000548807.1 alternative 5' UTR ENST00000528163.2 alternative 5' UTR ENST00000530890.1 alternative 5' UTR ENST00000444393.3 alternative 5' UTR ENST00000533097.2 alternative 5' UTR ENST00000008180.9 NP_001012652 ENST00000396890.2 alternative 5' UTR ENST00000548652.1 NP_001012654.1 ENST00000530538.2 NAGNAG splice site ENST00000530538.2 alternative 5' UTR ENST00000549213.1 alternative 5' UTR ENST00000548476.1 alternative 5' UTR ENST00000552664.1 NAGNAG splice site ENST00000552664.1 alternative 5' UTR ENST00000552356.1 alternative 5' UTR ENST00000339854.4 confirm experimentally ENST00000339854.4 non-submitted evidence ENST00000537682.1 non-submitted evidence ENST00000542898.1 non-submitted evidence ENST00000536980.1 non-submitted evidence ENST00000538326.1 non-submitted evidence ENST00000536379.1 confirm experimentally ENST00000293995.3 DKFZp686A1965 ENST00000294008.3 DKFZp547D144 ENST00000294008.3 NP_115820 ENST00000486524.1 FLJ16318 ENST00000322048.5 DKFZp564M1672 ENST00000474471.1 non-canonical donor (AT) and acceptor (AT) between exon 5 and 6 ENST00000547605.1 NAGNAG splice site ENST00000552089.1 not organism-supported ENST00000268251.8 DKFZp686E1693 ENST00000333050.6 DKFZp564K2062 ENST00000536829.1 alternative 5' UTR ENST00000261657.5 Not made as NMD as the stop codon is only 48 bp from the end of the exon. Sw:Q2KHT3-3.2 seems to be assigned to the cDNA used to build this object. I am not convinced this is correct ENST00000329565.5 DKFZp761P2414 ENST00000396503.2 DKFZp564M182 ENST00000399147.4 confirm experimentally ENST00000399147.4 LOC729978 ENST00000424107.2 FLJ58277 ENST00000423335.2 FLJ99079, DKFZp686D24206 ENST00000389138.2 DNA-repair protein complementing XP-F cell (Xeroderma pigmentosum group F complementing protein) (DNA excision repair protein ERCC-4). ENST00000462862.1 DNA-repair protein complementing XP-F cell (Xeroderma pigmentosum group F complementing protein) (DNA excision repair protein ERCC-4). ENST00000552140.1 not best-in-genome evidence ENST00000553201.1 not best-in-genome evidence ENST00000360151.4 not best-in-genome evidence ENST00000549219.1 alternative 5' UTR ENST00000255759.5 DKFZp686N1651 ENST00000399410.3 1 ENST00000537112.1 non canonical other ENST00000468219.1 DKFZp686A05212 ENST00000438132.2 NP_064710.4 ENST00000302555.4 DKFZp779J0317 ENST00000302555.4 DKFZp779K2017 ENST00000524149.1 not organism-supported ENST00000520010.1 alternative 5' UTR ENST00000523065.1 alternative 5' UTR ENST00000381337.2 DKFZp686C1054 ENST00000324344.3 DKFZp686O0290 ENST00000261383.3 DKFZp434N074 ENST00000534903.1 alternative 5' UTR ENST00000341400.7 alternative 5' UTR ENST00000544693.1 alternative 5' UTR ENST00000424898.2 not organism-supported ENST00000543407.1 alternative 5' UTR ENST00000356156.3 alternative 5' UTR ENST00000541154.1 alternative 5' UTR ENST00000536620.1 alternative 5' UTR ENST00000538606.1 alternative 5' UTR ENST00000517539.1 alternative 5' UTR ENST00000528249.1 alternative 5' UTR ENST00000414816.1 FLJ45256 ENST00000324873.5 corf ENST00000526384.1 alternative 5' UTR ENST00000529716.1 not best-in-genome evidence ENST00000395503.3 DKFZp779N0852 ENST00000395503.3 DKFZp779D1555 ENST00000395503.3 DKFZp779A1459 ENST00000395503.3 DKFZp779G2251 ENST00000509141.1 alternative 5' UTR ENST00000524087.1 not best-in-genome evidence ENST00000550665.1 not best-in-genome evidence ENST00000358758.5 DKFZp547J199 ENST00000279389.4 DKFZp434I2117 ENST00000251303.6 hypothetical protein MGC5178 ENST00000520915.1 not best-in-genome evidence ENST00000528032.1 alternative 5' UTR ENST00000524644.1 alternative 5' UTR ENST00000380412.4 FLJ23436 ENST00000223459.5 FLJ16133 ENST00000287461.3 FLJ90415 ENST00000300835.3 FLJ90302 ENST00000356166.4 FLJ12489 ENST00000494101.1 FLJ35726 ENST00000411466.1 alternative 5' UTR ENST00000262518.4 FLJ46149 ENST00000471231.1 FLJ45801 ENST00000338343.4 DKFZp434K0410 ENST00000262519.7 KIAA0339 ENST00000262519.7 AT-AC splicing between exons 14 and 15 ENST00000452917.1 alternative 5' UTR ENST00000449974.1 alternative 5' UTR ENST00000394983.1 alternative 5' UTR ENST00000300849.3 FLJ13479, FLJ14492 ENST00000442862.1 alternative 5' UTR ENST00000426488.1 alternative 5' UTR ENST00000428260.1 alternative 5' UTR ENST00000394979.1 KIAA0296 ENST00000486499.1 novel transcript ENST00000492427.1 novel transcript ENST00000354895.4 FLJ26002 ENST00000394951.1 alternative 5' UTR ENST00000219797.3 FLJ14040 ENST00000219797.3 FLJ11810 ENST00000247470.8 FLJ20204 ENST00000327237.2 FLJ20672 ENST00000327237.2 FLJ13868 ENST00000398664.3 DKFZp434I199 ENST00000398679.2 IGHV2/OR16-5*01 ENST00000438532.2 IGHV3/OR16-8*01 allele ENST00000303383.3 FLJ22009 ENST00000303383.3 FLJ31369 ENST00000299138.5 FLJ20388 ENST00000299138.5 DKFZp434E1211 ENST00000299138.5 FLJ13588 ENST00000299138.5 FLJ10752 ENST00000299138.5 DKFZp434P1672 ENST00000219097.2 FLJ13957 ENST00000219097.2 FLJ11884 ENST00000340124.3 FLJ33638 ENST00000303155.4 FLJ90456 ENST00000303155.4 DKFZp686N19198 ENST00000303155.4 DKFZp547L153 ENST00000320640.5 FLJ14690 ENST00000527640.1 alternative 5' UTR ENST00000285737.3 FLJ90294 ENST00000285737.3 FLJ14760 ENST00000285737.3 FLJ14638 ENST00000285737.3 DKFZp762F1410 ENST00000380006.2 FLJ37344 ENST00000380006.2 DKFZp686L1897 ENST00000219197.3 FLJ44674 ENST00000394697.1 KIAA0037 ENST00000300590.3 FLJ31275 ENST00000526417.1 confirm experimentally ENST00000531674.1 alternative 5' UTR ENST00000262133.5 FLJ26459 ENST00000394657.4 DKFZp434G1122 ENST00000394657.4 FLJ13258 ENST00000431610.2 alternative 5' UTR ENST00000460382.1 alternative 5' UTR ENST00000262134.4 FLJ20481 ENST00000521228.2 upstream uORF ENST00000521992.1 NP_001177087.1 ENST00000319165.9 FLJ31547 ENST00000518005.1 upstream uORF ENST00000520435.1 not organism-supported ENST00000541580.1 upstream uORF ENST00000541580.1 overlapping uORF ENST00000541580.1 not organism-supported ENST00000544479.1 not organism-supported ENST00000536025.1 upstream uORF ENST00000536025.1 alternative 5' UTR ENST00000262493.5 FLJ31446 ENST00000492830.1 FLJ13812 ENST00000300291.5 RZPDo834F1115D ENST00000300291.5 DKFZp686H1588 ENST00000336111.4 KIAA1612 ENST00000336111.4 FLJ12068 ENST00000336111.4 FLJ14252 ENST00000336111.4 FLJ12690 ENST00000336111.4 FLJ10826 ENST00000463480.1 non-canonical \ ENST00000308159.4 KIA0095 ENST00000262510.6 FLJ39711 ENST00000544641.1 alternative 5' UTR ENST00000538059.1 alternative 5' UTR ENST00000539144.1 Evidence: human Swiss-Prot isoform Q86WI3-4.3 ENST00000539144.1 confirm experimentally ENST00000538805.1 NAGNAG splice site ENST00000538110.1 NAGNAG splice site ENST00000538930.1 NAGNAG splice site ENST00000538778.1 NAGNAG splice site ENST00000537056.1 NAGNAG splice site ENST00000394420.3 FLJ24006 ENST00000394420.3 KIAA1972 ENST00000219204.2 FLJ90569 ENST00000219207.4 FLJ27074 ENST00000219244.4 corf ENST00000394391.3 FLJ23683 ENST00000340339.4 FLJ46438 ENST00000340339.4 FLJ23926 ENST00000333493.3 FLJ23962 ENST00000219281.2 FLJ13154 ENST00000219299.3 DKFZp434N1418 ENST00000394282.3 FLJ44611 ENST00000317147.4 FLJ90644 ENST00000317147.4 DKFZp686A017 ENST00000317147.4 DKFZp686N183 ENST00000219320.3 FLJ10815 ENST00000525974.1 alternative 5' UTR ENST00000359087.4 FLJ40361 ENST00000394069.3 upstream uORF ENST00000540947.1 upstream ATG ENST00000523360.1 alternative 5' UTR ENST00000522295.1 not organism-supported ENST00000521314.1 not organism-supported ENST00000517685.1 not organism-supported ENST00000517729.1 not organism-supported ENST00000517750.1 not organism-supported ENST00000520304.1 not organism-supported ENST00000409509.1 NP_001004055.1 ENST00000409509.1 alternative 5' UTR ENST00000409037.1 alternative 5' UTR ENST00000424285.1 alternative 5' UTR ENST00000403458.3 NP_001013002 ENST00000459925.1 FLJ41802 ENST00000268793.3 FLJ32839Rik ENST00000398235.2 alternative 5' UTR ENST00000520529.1 alternative 5' UTR ENST00000314423.7 FLJ14728 ENST00000302243.6 FLJ11126 ENST00000393640.4 FLJ45393 ENST00000288078.5 FLJ31894 ENST00000378912.2 FLJ46530 ENST00000485034.1 FLJ41476 ENST00000261776.4 FLJ31871 ENST00000393567.2 confirm experimentally ENST00000393567.2 not organism-supported ENST00000321489.5 FLJ12871 ENST00000539973.1 overlapping uORF ENST00000539973.1 alternative 5' UTR ENST00000545267.1 overlapping uORF ENST00000338099.4 FLJ11171 ENST00000299952.4 FLJ32280 ENST00000268483.3 FLJ20511 ENST00000535461.1 alternative 5' UTR ENST00000539172.1 alternative 5' UTR ENST00000536211.1 alternative 5' UTR ENST00000540440.1 alternative 5' UTR ENST00000219368.2 FLJ25287 ENST00000320619.5 DKFZp434E1228 ENST00000393422.1 FLJ42825 ENST00000478060.1 NP_620481.2 ENST00000525539.1 239702 ENST00000525539.1 non-canonical splice acceptor site between exons 5 and 6 ENST00000405402.1 KIAA0182 ENST00000469381.1 FLJ45416 ENST00000438180.1 FLJ98653 ENST00000262426.3 Protein starts at secodn methionine ENST00000423252.1 alternative 5' UTR ENST00000439677.1 alternative 5' UTR ENST00000436970.1 alternative 5' UTR ENST00000436274.1 alternative 5' UTR ENST00000456902.1 alternative 5' UTR ENST00000537895.1 alternative 5' UTR ENST00000537290.1 alternative 5' UTR ENST00000540697.1 alternative 5' UTR ENST00000406948.3 alternative 5' UTR ENST00000544543.1 alternative 5' UTR ENST00000321214.2 No translation as would be subject to NMD ENST00000393099.3 alternative 5' UTR ENST00000505473.1 NP_443713.2 ENST00000555147.1 upstream uORF ENST00000555810.1 alternative 5' UTR ENST00000556565.1 alternative 5' UTR ENST00000268676.7 FLJ37732 ENST00000521551.1 alternative 5' UTR ENST00000320345.5 Non-canonical donor splice site at exon 2 ENST00000320345.5 alternative 5' UTR ENST00000445774.1 alternative 5' UTR ENST00000334146.3 DKFZp686O06159 ENST00000453066.1 alternative 5' UTR ENST00000491788.1 KIAA1936 ENST00000323164.2 unitary_pseudogene ENST00000452111.1 alternative 5' UTR ENST00000550383.1 subject to nonsense-mediated decay ENST00000552276.1 NAGNAG splice site ENST00000551178.1 NAGNAG splice site ENST00000547178.1 NAGNAG splice site ENST00000381365.3 NP_001139008.1 ENST00000520221.1 not organism-supported ENST00000522798.1 alternative 5' UTR ENST00000521811.1 not organism-supported ENST00000519602.1 alternative 5' UTR ENST00000522249.1 alternative 5' UTR ENST00000518175.1 alternative 5' UTR ENST00000518175.1 not organism-supported ENST00000546495.1 NP_001136270.1 ENST00000546760.1 not organism-supported ENST00000552402.1 NP_00113627.1 ENST00000399506.1 Non-canonical splicing between exon 3 and exon 4 ENST00000399510.1 Non-canonical splicing between exon 5 and exon 6 ENST00000447163.1 Non-canonical splicing between exons 5 and 7 ENST00000455263.2 NMD exception ENST00000420246.2 NMD exception ENST00000445888.2 alternative 5' UTR ENST00000508793.1 alternative 5' UTR ENST00000503591.1 alternative 5' UTR ENST00000431639.2 alternative 5' UTR ENST00000316024.5 FLJ32107 ENST00000457584.2 alternative 5' UTR ENST00000396463.2 alternative 5' UTR ENST00000470531.1 FLJ43940 ENST00000481999.1 FLJ39236 ENST00000441885.2 NP_997269.2 ENST00000343478.5 FLJ45455 ENST00000313495.1 FLJ34690 ENST00000480891.1 FLJ37014 ENST00000395962.1 FLJ37368 ENST00000465825.1 FLJ36693 ENST00000446899.1 non-canonical splice acceptor at exon 5 ENST00000423323.1 FLJ41269 ENST00000389360.3 probably an unprocessed pseudogene of gene AC005224.3 on next clone ENST00000268714.3 probably an unprocessed pseudogene of gene AC005224.3 on next clone ENST00000449363.1 FLJ41105 ENST00000466596.1 FLJ13661 ENST00000379640.1 FLJ45831 ENST00000431343.1 FLJ25830 ENST00000395931.2 not organism-supported ENST00000536146.1 alternative 5' UTR ENST00000539316.1 alternative 5' UTR ENST00000543896.1 alternative 5' UTR ENST00000520956.1 non canonical other ENST00000520956.1 FLJ36674 ENST00000524205.1 non-canonical acceptor splice site between exons 3 and 4 ENST00000524205.1 non canonical other ENST00000524205.1 alternative 5' UTR ENST00000519864.1 upstream uORF ENST00000522212.1 non canonical other ENST00000481756.2 non canonical other ENST00000481756.2 non-canonical acceptor splice site between exon 6 and 7 ENST00000518506.1 non-canonical acceptor splice site between exons 6 and 7 ENST00000518506.1 non canonical other ENST00000438826.2 non-canonical acceptor splice site betwween exons 6 and 7 ENST00000523573.1 non-canonical acceptor splice site betwween exons 6 and 7 ENST00000416464.2 FLJ31464 ENST00000413242.2 unusual chimeric transcript ENST00000413242.2 subject to nonsense-mediated decay ENST00000413242.2 KIAA1874 ENST00000464963.1 novel transcript ENST00000491819.1 novel transcript ENST00000469477.1 novel transcript ENST00000399277.1 FLJ36065 ENST00000472495.1 alternative 3' UTR ENST00000261647.3 upstream ATG ENST00000261647.3 FLJ32316 ENST00000486880.1 alternative 3' UTR ENST00000475723.1 FLJ31218 ENST00000481107.1 FLJ37500 ENST00000465567.1 DKFZp667J2313 ENST00000395851.1 KIAA1047 ENST00000430577.1 alternative 5' UTR ENST00000475953.1 MGC40157 ENST00000409083.3 FLJ35696 ENST00000395824.1 alternative 5' UTR ENST00000448349.1 alternative 5' UTR ENST00000340621.4 FLJ36492 ENST00000399273.1 FLJ36492 ENST00000393005.2 TL132-like (LOC162632) ENST00000429445.1 not best-in-genome evidence ENST00000261651.2 LOC906597 ENST00000428142.1 LOC284191 ENST00000321560.2 LOC201164 ENST00000399187.1 DKFZP586M1120 ENST00000412324.1 non canonical TEC ENST00000399138.3 FLJ20308 ENST00000425211.1 FLJ42795 ENST00000446853.1 novel transcript ENST00000457330.1 novel transcript DKFZp686G1086 ENST00000442583.1 novel transcript ENST00000425214.1 novel transcript ENST00000445752.1 novel transcript FLJ36492 ENST00000455629.1 novel transcript ENST00000450277.1 novel transcript ENST00000345096.3 FLJ40244 ENST00000301938.4 DKFZp434O1826 ENST00000307767.7 DKFZp686F19101 ENST00000476139.1 DKFZp686O1440 ENST00000482741.1 FLJ46240 ENST00000507171.1 not best-in-genome evidence ENST00000441887.1 alternative 5' UTR ENST00000414602.1 alternative 5' UTR ENST00000492129.1 DKFZp686D15157 ENST00000432893.1 alternative 5' UTR ENST00000431320.1 alternative 5' UTR ENST00000455992.1 alternative 5' UTR ENST00000412418.1 alternative 5' UTR ENST00000419284.1 alternative 5' UTR ENST00000422237.1 alternative 5' UTR ENST00000395647.2 FLJ25217 ENST00000399096.1 FLJ41564 ENST00000442355.2 not best-in-genome evidence ENST00000435028.2 not best-in-genome evidence ENST00000399093.1 LOC388436 ENST00000399087.1 LOC440409 ENST00000314728.4 KIAA1065 ENST00000395628.1 FLJ14053 ENST00000395620.1 FLJ11134 ENST00000395626.1 FLJ10629 ENST00000443215.1 alternative 5' UTR ENST00000395604.3 alternative 5' UTR ENST00000270570.4 FLJ10847 ENST00000497548.1 novel transcript ENST00000495425.1 novel transcript ENST00000446398.1 alternative 5' UTR ENST00000395575.1 alternative 5' UTR ENST00000476965.1 DKFZp686E23276 ENST00000463318.1 novel transcript DKFZp686M24231 ENST00000478689.1 novel transcript FLJ31196 ENST00000467379.1 novel transcript ENST00000479677.1 FLJ36558 ENST00000478057.1 FLJ36436 ENST00000487650.1 FLJ33953 ENST00000487650.1 non-canonical splicing between exons 7 and 8 ENST00000439102.1 alternative 5' UTR ENST00000426645.1 alternative 5' UTR ENST00000395544.3 KIAA0623 ENST00000395530.1 FLJ36955 ENST00000468196.1 Turned into transcript because of sequence errors (which are reported in Jira ticket HG-422. (lw2) ENST00000526076.1 alternative 5' UTR ENST00000426869.2 NP_976326 ENST00000398988.2 There is no full length human cDNA across here at present. Left as start not found ENST00000542029.1 alternative 5' UTR ENST00000395321.1 alternative 5' UTR ENST00000412625.1 alternative 5' UTR ENST00000353676.5 alternative 5' UTR ENST00000540632.1 not organism-supported ENST00000535762.1 not organism-supported ENST00000541381.1 non canonical TEC ENST00000394835.3 NP_940931 ENST00000357754.1 FLJ44815 ENST00000526861.1 alternative 5' UTR ENST00000524511.1 alternative 5' UTR ENST00000394386.1 alternative 5' UTR ENST00000502449.1 NP_542117.3 ENST00000360317.2 non-canonical splice acceptor intron 4 ENST00000394175.2 non-canonical first splice acceptor ENST00000394148.3 NP_757374.2 ENST00000543876.1 non canonical TEC ENST00000543876.1 alternative 5' UTR ENST00000537255.1 non canonical TEC ENST00000538884.1 non canonical TEC ENST00000538884.1 alternative 5' UTR ENST00000540388.1 suspected genomic sequence error effecting CDS in exon 1 ENST00000541245.1 non canonical TEC ENST00000538981.1 non canonical TEC ENST00000538981.1 alternative 5' UTR ENST00000476049.1 joins two neighboring genes ENST00000394042.1 non-canonical splice donor and acceptor between exons 4 and 5 ENST00000391419.3 NP_001116859.1 ENST00000333822.4 non_best_in_genome ENST00000391353.1 conserved in mouse ENST00000310778.5 P54257.3 ENST00000341193.5 P54257-4 ENST00000435506.2 not organism-supported ENST00000448203.1 alternative 5' UTR ENST00000552162.1 alternative 5' UTR ENST00000550504.1 alternative 5' UTR ENST00000550406.1 alternative 5' UTR ENST00000415845.1 alternative 5' UTR ENST00000444283.1 alternative 5' UTR ENST00000301683.3 FLJ31222 ENST00000454303.1 alternative 5' UTR ENST00000451885.1 alternative 5' UTR ENST00000491747.2 NP_009229.2 ENST00000470026.1 alternative 5' UTR ENST00000494123.1 alternative 5' UTR ENST00000489037.1 alternative 5' UTR ENST00000464237.1 Non canonical acceptor splice site between exons 3 and 4 of this variant ENST00000520406.1 alternative 5' UTR ENST00000523762.1 alternative 5' UTR ENST00000523934.1 alternative 5' UTR ENST00000521178.1 alternative 5' UTR ENST00000522172.1 alternative 5' UTR ENST00000518478.1 alternative 5' UTR ENST00000527034.1 NAGNAG splice site ENST00000527034.1 not organism-supported ENST00000533177.1 not organism-supported ENST00000533177.1 alternative 5' UTR ENST00000436088.1 alternative 5' UTR ENST00000393606.3 alternative 5' UTR ENST00000526094.1 not organism-supported ENST00000526094.1 alternative 5' UTR ENST00000529383.1 not organism-supported ENST00000529383.1 alternative 5' UTR ENST00000537550.1 not organism-supported ENST00000432494.1 alternative 5' UTR ENST00000456912.1 alternative 5' UTR ENST00000525011.1 non-canonical splice site between exons 4 and 5 ENST00000357776.2 alternative 5' UTR ENST00000410006.1 alternative 5' UTR ENST00000540511.1 suspected genomeic sequence error affecting CDS in exon 10 ENST00000532038.1 not organism-supported ENST00000531735.1 not organism-supported ENST00000532891.1 not organism-supported ENST00000525495.1 not organism-supported ENST00000531206.1 NP_001107563 ENST00000560629.1 subject to nonsense-mediated decay ENST00000523285.1 alternative 5' UTR ENST00000519772.1 alternative 5' UTR ENST00000525037.1 not best-in-genome evidence ENST00000526247.1 non-canonical splice acceptor site at exon 4; possibly SNP rs2610393 ENST00000290208.7 alternative 5' UTR ENST00000393408.3 alternative 5' UTR ENST00000444685.1 alternative 5' UTR ENST00000311626.4 alternative 5' UTR ENST00000498678.1 alternative 5' UTR ENST00000476342.1 alternative 5' UTR ENST00000225648.3 alternative 5' UTR ENST00000550387.1 not organism-supported ENST00000456415.1 alternative 5' UTR ENST00000513119.1 alternative 5' UTR ENST00000507076.1 alternative 5' UTR ENST00000502761.1 alternative 5' UTR ENST00000393366.2 alternative 5' UTR ENST00000514929.1 Em:BF685140.1 -used until 727 only ENST00000511277.1 alternative 5' UTR ENST00000515635.1 alternative 5' UTR ENST00000507680.1 alternative 5' UTR ENST00000511673.1 alternative 5' UTR ENST00000511066.1 alternative 5' UTR ENST00000512250.1 alternative 5' UTR ENST00000430262.2 alternative 5' UTR ENST00000419140.2 alternative 5' UTR ENST00000504124.1 alternative 5' UTR ENST00000512041.1 alternative 5' UTR ENST00000446735.1 alternative 5' UTR ENST00000434917.2 alternative 5' UTR ENST00000509200.1 alternative 5' UTR ENST00000504102.1 alternative 5' UTR ENST00000503676.1 alternative 5' UTR ENST00000509079.1 alternative 5' UTR ENST00000505581.1 alternative 5' UTR ENST00000507970.1 alternative 5' UTR ENST00000514121.1 alternative 5' UTR ENST00000510476.1 alternative 5' UTR ENST00000508805.1 alternative 5' UTR ENST00000451526.2 alternative 5' UTR ENST00000502268.1 alternative 5' UTR ENST00000506533.1 alternative 5' UTR ENST00000508030.1 alternative 5' UTR ENST00000503614.1 alternative 5' UTR ENST00000505440.1 alternative 5' UTR ENST00000512238.1 alternative 5' UTR ENST00000511964.1 alternative 5' UTR ENST00000501501.2 suspected genomic sequence error affecting CDS in exon 1 ENST00000507382.1 alternative 5' UTR ENST00000511860.1 alternative 5' UTR ENST00000506187.1 alternative 3' UTR ENST00000258969.4 alternative 3' UTR ENST00000503246.1 alternative 5' UTR ENST00000503690.1 alternative 5' UTR ENST00000514874.1 alternative 5' UTR ENST00000515126.1 alternative 5' UTR ENST00000507467.1 alternative 5' UTR ENST00000507510.2 non canonical U12 ENST00000508045.1 alternative 5' UTR ENST00000504563.2 alternative 5' UTR ENST00000240304.1 alternative 3' UTR ENST00000510984.1 alternative 5' UTR ENST00000507200.1 alternative 5' UTR ENST00000268957.3 alternative 5' UTR ENST00000013034.3 alternative 5' UTR ENST00000456492.1 alternative 5' UTR ENST00000514264.1 alternative 5' UTR ENST00000503064.1 alternative 5' UTR ENST00000393190.1 alternative 5' UTR ENST00000436971.1 FLJ20055 ENST00000481416.1 not organism-supported ENST00000299415.2 annotated in mouse by eah: Didn't want to annotate this non-splicing mRNA but the longest theoretical translation (given here) is over 100 amino acids and a pfam search. reveals the presence of coiled-coil (pfam A) domains. Please see RP24-402O2.1 ENST00000299415.2 I am not convinced by the poly A tail from EM:AW137783.1. Ignored ENST00000520404.1 not organism-supported ENST00000518576.1 not organism-supported ENST00000482005.1 non-organism_supported ENST00000245479.2 NP_000337.1 ENST00000403627.3 NP_116226 ENST00000403627.3 FLJ14775, FLJ90274 ENST00000405159.3 NP_001092302 ENST00000449312.1 based on mouse protein A2AAF5.1 from the syntenic region of mouse chr 11 ENST00000439590.2 alternative 5' UTR ENST00000533498.1 alternative 5' UTR ENST00000389916.4 NP_694941 ENST00000524389.1 alternative 5' UTR ENST00000392620.1 FLJ31882 ENST00000293190.5 Glutamate {NMDA} receptor subunit epsilon 3 precursor (N-methyl D-aspartate receptor subtype 2C) (NR2C) (NMDAR2C) ENST00000375215.3 NP_001156467 ENST00000425876.1 upstream_ATG-28 ENST00000405575.3 NP_001138771.1 ENST00000411744.2 NP_001138770 ENST00000435555.1 alternative 5' UTR ENST00000436498.1 alternative 5' UTR ENST00000423915.1 alternative 5' UTR ENST00000543327.2 NP_00119141.1 ENST00000551068.1 NP_001191139.1 ENST00000547406.1 not organism-supported ENST00000460042.1 FLJ40457 ENST00000262763.4 Non-organism supported ENST00000269385.4 FLJ90079 ENST00000269397.4 NP_003646 ENST00000508628.2 NP_065965.4 ENST00000541246.1 alternative 5' UTR ENST00000505490.1 NM_005782.3 ENST00000425009.1 alternative 5' UTR ENST00000333437.4 FLJ35767 ENST00000340116.5 cDNA and EST evidence contain differing numbers of the 18 bp repeat which defines exon 1 compared with the genomic translation ENST00000455369.1 alternative 5' UTR ENST00000552383.1 alternative 5' UTR ENST00000550958.1 alternative 5' UTR ENST00000548489.1 NP_775299.1 ENST00000549780.1 not organism-supported ENST00000549780.1 alternative 5' UTR ENST00000549253.1 alternative 5' UTR ENST00000405385.2 alternative 5' UTR ENST00000407501.2 not organism-supported ENST00000407501.2 alternative 5' UTR ENST00000546979.1 NAGNAG splice site ENST00000546979.1 alternative 5' UTR ENST00000551541.1 alternative 5' UTR ENST00000345133.5 alternative 5' UTR ENST00000549546.1 not organism-supported ENST00000549546.1 alternative 5' UTR ENST00000549468.1 alternative 5' UTR ENST00000551333.1 alternative 5' UTR ENST00000472042.1 NP_775301.1 ENST00000400105.2 NP_775735 ENST00000532723.1 alternative 5' UTR ENST00000419673.2 NP_001010000.1 ENST00000531294.1 not organism-supported ENST00000400556.3 FLJ21856, FLJ23411 ENST00000547442.1 not best-in-genome evidence ENST00000391405.1 Possible pseudogene ENST00000506447.1 NP_115518.3 ENST00000399022.2 FLJ10656 ENST00000552979.1 alternative 5' UTR ENST00000553704.1 non-submitted evidence ENST00000420468.2 NP_001012530.1 ENST00000555288.1 alternative 5' UTR ENST00000425392.1 Alternatively spliced 5' UTR, shares CDs with AC072051.1-001 (partial) ENST00000425392.1 alternative 5' UTR ENST00000526932.1 This allelic splice variant of HMSD is the precursor of the histocompatibility antigen ACC-6. It is translated in a different frame to HMSD. PubMed=17409267 ENST00000560918.1 alternative 5' UTR ENST00000560661.1 alternative 5' UTR ENST00000524431.2 suspected genomic sequence error affecting CDS in exon 4 ENST00000529449.2 suspected genomic sequence error affecting CDS in exon 1 ENST00000532857.1 alternative 5' UTR ENST00000415242.1 FLJ44881 ENST00000498683.2 alternative 5' UTR ENST00000397860.3 alternative 5' UTR ENST00000316249.3 Potassium voltage-gated channel subfamily G member 2 (Potassium channel Kv6) (Cardiac potassium channel subunit). ENST00000559951.1 alternative 5' UTR ENST00000521445.1 not organism-supported ENST00000524850.1 alternative 5' UTR ENST00000409293.3 NP_060384.3 ENST00000382445.4 non canonical U12 ENST00000395484.3 alternative CDS long version needs verifiying ENST00000388824.5 non-canonical splicing (c/at cag\) between exons 2 and 3 ENST00000532824.1 not organism-supported ENST00000525591.1 NP_001171473 ENST00000329478.1 upstream_ATG16 ENST00000454697.1 alternative 5' UTR ENST00000398665.3 FLJ00192 ENST00000482433.1 FLJ37961 ENST00000416526.1 alternative 5' UTR ENST00000453933.1 alternative 5' UTR ENST00000322315.5 NP_573568.1 ENST00000301286.3 confirm experimentally ENST00000301286.3 PubMed=15111493 ENST00000394548.1 last intron has non-canonical and ambiguous splice sites ENST00000524754.1 alternative 5' UTR ENST00000527106.1 alternative 5' UTR ENST00000529165.1 alternative 5' UTR ENST00000531085.1 alternative 5' UTR ENST00000531199.1 alternative 5' UTR ENST00000532464.1 alternative 5' UTR ENST00000528505.1 alternative 5' UTR ENST00000541263.1 alternative 5' UTR ENST00000457024.1 best match in genome ENST00000552585.1 alternative 5' UTR ENST00000419849.1 alternative 5' UTR ENST00000361664.2 NP_940936.2 ENST00000421818.1 alternative 5' UTR ENST00000397910.2 confirm experimentally ENST00000344844.3 unitary_pseudogene ENST00000448965.1 unitary_pseudogene ENST00000302851.3 NP_689502.2 ENST00000421525.1 alternative 5' UTR ENST00000435550.1 alternative 5' UTR ENST00000264828.3 NP_056534 ENST00000393796.4 NP_001035754.1 ENST00000430370.1 alternative 5' UTR ENST00000403903.3 NP_001096637 ENST00000393708.3 MGC19604 ENST00000393708.3 NP_001026904 ENST00000531836.1 alternative 5' UTR ENST00000413806.2 non canonical conserved ENST00000450717.2 NAGNAG splice site ENST00000450717.2 non canonical conserved ENST00000444061.2 non canonical conserved ENST00000444061.2 NAGNAG splice site ENST00000538456.1 non canonical conserved ENST00000455727.2 NP_001182729 ENST00000535915.1 NP_001182728 ENST00000545707.1 NP_001182732 ENST00000561343.1 NP_001182731 ENST00000558013.1 NP_001182727 ENST00000357901.4 NP_689568.2 ENST00000552904.1 alternative 5' UTR ENST00000478765.1 alternative 5' UTR ENST00000547560.1 alternative 5' UTR ENST00000547473.1 subject to nonsense-mediated decay ENST00000547628.1 confirm experimentally ENST00000430024.1 subject to nonsense-mediated decay ENST00000434822.1 subject to nonsense-mediated decay ENST00000553179.1 alternative 3' UTR ENST00000549706.1 not organism-supported ENST00000549706.1 alternative 5' UTR ENST00000445042.1 Human alpha1A-voltage-dependent calcium channel mRNA, splice form BI-1 ENST00000548523.1 not organism-supported ENST00000343945.5 not organism-supported ENST00000547589.1 not organism-supported ENST00000533683.2 confirm experimentally ENST00000269724.5 not organism-supported ENST00000242783.6 isoform 2 ENST00000342216.4 isoform 1 ENST00000449848.1 unitary_pseudogene ENST00000527093.1 alternative 5' UTR ENST00000533747.1 alternative 5' UTR ENST00000340880.4 NP_443122 ENST00000547332.1 non canonical polymorphism ENST00000547471.1 non canonical polymorphism ENST00000518629.2 alternative 3' UTR ENST00000518629.2 non canonical polymorphism ENST00000548501.1 non canonical polymorphism ENST00000548435.1 alternative 3' UTR ENST00000548435.1 non canonical polymorphism ENST00000546792.1 non canonical polymorphism ENST00000517734.1 non canonical polymorphism ENST00000324632.9 not organism-supported ENST00000324632.9 alternative 5' UTR ENST00000552048.1 alternative 3' UTR ENST00000552048.1 non canonical polymorphism ENST00000397381.3 Wang et al. (2008) PMID: 18501714 ENST00000549354.1 LOC126536 ENST00000198939.6 not organism-supported ENST00000524140.2 Human Swiss-Prot isoform Q149M9-3.3 (1432aa) ENST00000549814.1 not organism-supported ENST00000552788.1 confirm experimentally ENST00000317040.6 potential upstream ATG but variants 13 + 14 fit criteria for non-coding RNA ENST00000551649.1 not organism-supported ENST00000552293.1 not organism-supported ENST00000550896.1 not organism-supported ENST00000534474.1 non canonical TEC ENST00000535612.1 downstream ATG ENST00000537263.1 alternative 5' UTR ENST00000540707.1 alternative 5' UTR ENST00000541725.1 downstream ATG ENST00000541725.1 alternative 5' UTR ENST00000269932.6 alternative 5' UTR ENST00000540792.1 upstream ATG ENST00000540792.1 alternative 5' UTR ENST00000536098.1 alternative 5' UTR ENST00000541898.1 alternative 5' UTR ENST00000543877.1 downstream ATG ENST00000535288.1 alternative 5' UTR ENST00000538663.1 alternative 5' UTR ENST00000392336.3 downstream ATG ENST00000392336.3 alternative 5' UTR ENST00000540634.1 alternative 3' UTR ENST00000354191.3 subject to nonsense-mediated decay ENST00000514819.2 subject to nonsense-mediated decay ENST00000424583.2 NP_001139257.1 ENST00000421262.2 alternative 5' UTR ENST00000457895.1 alternative 5' UTR ENST00000448576.1 alternative 5' UTR ENST00000432704.1 alternative 5' UTR ENST00000429242.1 alternative 5' UTR ENST00000444839.1 alternative 5' UTR ENST00000474284.1 Exon 3 overlaps a ribosomal protein S16 (RPS16) Transcribed_processed_pseudogene annotated as OTTHUMG00000158058. The CDS of the pseudogene contains 9 substitutions, but is full length with no in-frame stop-codons or frame-shifts. However, the downstream splice junction would make this transcript a target for the nonsense mediated decay pathway ENST00000418063.2 NP_009069.1 ENST00000497576.1 This pseudogene overlaps exon 3 of variant CTC-260E6.1-003 of a zinc finger protein 90 (ZNF90) annotated as OTTHUMG00000158057. The CDS of the pseudogene contains 9 substitutions, but is full length with no in-frame stop-codons or frame-shifts. However, the downstream splice junction would make this transcript a target for the nonsense mediated decay pathway ENST00000402377.3 FLJ16502 ENST00000402377.3 NP_612143 ENST00000486528.1 alternative 5' UTR ENST00000496398.1 Parent gene Swiss-Prot P08865.4 ENST00000525354.2 NP_001177758.1 ENST00000502743.1 alternative 5' UTR ENST00000506901.1 alternative 5' UTR ENST00000505242.1 alternative 5' UTR ENST00000505163.1 alternative 5' UTR ENST00000423823.2 alternative 5' UTR ENST00000505365.1 alternative 5' UTR ENST00000492450.1 NP_001025168.2 ENST00000419602.1 NP_001119528.2 ENST00000222284.4 seven transmembrane domain protein (NIFIE14). ENST00000481182.1 Novel protein similar to testis zinc finger protein, clone MGC:21109. ENST00000392197.1 TESTIS ZINC FINGER PROTEIN. ENST00000222270.6 suspected genome sequence error affecting CDS in exon 8 ENST00000004982.3 novel protein similar to heat shock 20kDa like-protein (FLJ32389). ENST00000444637.2 NAGNAG splice site ENST00000544099.1 suspected genomic sequence error affecting CDS in exon 8 ENST00000301165.5 NAGNAG splice site ENST00000536950.1 NAGNAG splice site ENST00000535581.1 NAGNAG splice site ENST00000537459.1 NAGNAG splice site ENST00000421853.2 NAGNAG splice site ENST00000545674.1 NAGNAG splice site ENST00000539771.1 NAGNAG splice site ENST00000246551.3 NP_055081.1 ENST00000292894.1 alternative 5' UTR ENST00000452939.1 alternative 5' UTR ENST00000427002.1 alternative 5' UTR ENST00000292928.2 There are 2 extra aa S129 and K130 compared to the SwissProt entry SW:Q96SR6.1, as there is some extra sequence in the genome compared to some of the cDNAs ENST00000528994.1 alternative 5' UTR ENST00000525288.1 alternative 5' UTR ENST00000527645.1 alternative 5' UTR ENST00000532141.1 alternative 5' UTR ENST00000529555.1 alternative 5' UTR ENST00000331800.4 alternative 5' UTR ENST00000520965.1 alternative 5' UTR ENST00000436120.1 gene for novel protein, KIAA1829. ENST00000392149.1 gene for novel protein, FLJ32053 ENST00000330173.1 gene for novel protein, FLJ30791. ENST00000351218.1 gene for novel protein, KIAA0961. ENST00000420980.2 NP_004638.2 ENST00000438060.1 alternative 5' UTR ENST00000438365.1 alternative 5' UTR ENST00000409235.3 alternative 5' UTR ENST00000215071.4 NP_002803 ENST00000414941.1 alternative 5' UTR ENST00000407552.1 alternative 5' UTR ENST00000381766.4 alternative 5' UTR ENST00000437828.1 alternative 5' UTR ENST00000447739.1 alternative 5' UTR ENST00000451354.1 alternative 5' UTR ENST00000478523.1 alternative 5' UTR ENST00000412609.1 LOC400696 ENST00000430325.2 NP_079153.2 ENST00000392032.2 alternative 5' UTR ENST00000409587.1 alternative 5' UTR ENST00000356508.5 alternative 5' UTR ENST00000409735.3 alternative 5' UTR ENST00000409281.1 alternative 5' UTR ENST00000359274.5 alternative 5' UTR ENST00000469741.1 FLJ41131 ENST00000432607.1 This is AC157553.4 in mouse - novel protein possible ortholgue of rat cytochrome P450 monooxygenase CYP2T1 (Cyp2t1). May possibly be a pseudogene in mouse ENST00000437853.1 This is Cyp2f2 cytochrome P450, family 2, subfamily f, polypeptide 2 in mouse ENST00000531409.1 NAGNAG splice site ENST00000413014.2 alternative 5' UTR ENST00000537354.1 alternative 5' UTR ENST00000342187.5 alternative 5' UTR ENST00000546362.1 alternative 3' UTR ENST00000535712.1 alternative 3' UTR ENST00000542943.1 not organism-supported ENST00000401731.1 alternative 3' UTR ENST00000405816.1 alternative 3' UTR ENST00000454993.1 Glutamate receptor, ionotropic kainate 5 precursor ( Glutamate receptor KA-2) (KA2) (Excitatory amino acid receptor 2) (EAA2) ENST00000560398.1 not organism-supported ENST00000187910.2 NP_001027020.1 ENST00000401740.1 alternative 3' UTR ENST00000329509.5 alternative 3' UTR ENST00000401942.1 alternative 3' UTR ENST00000489959.1 novel transcript ENST00000489959.1 FLJ40353 ENST00000292140.5 NP_942147 ENST00000391965.2 alternative 5' UTR ENST00000533118.1 alternative 5' UTR ENST00000528387.1 alternative 5' UTR ENST00000529930.1 alternative 5' UTR ENST00000446628.1 FLJ41856 ENST00000446628.1 novel transcript ENST00000187830.2 FLJ36858 ENST00000358777.4 FLJ77499 ENST00000403660.3 NP_064604 ENST00000480278.1 FLJ23504 ENST00000459648.1 FLJ46368 ENST00000446996.1 alternative 5' UTR ENST00000425718.1 alternative 5' UTR ENST00000391941.1 TFIIH basal transcripti on factor complex helicase subunit (EC 3.6.1.-) (DNA-repair protein complementin g XP-D cells) (Xeroderma pigmentosum group D complementing protein) (CXPD) (DNA excision repair protein ERCC-2). ENST00000391942.1 TFIIH basal transcripti on factor complex helicase subunit (EC 3.6.1.-) (DNA-repair protein complementin g XP-D cells) (Xeroderma pigmentosum group D complementing protein) (CXPD) (DNA excision repair protein ERCC-2). ENST00000485403.1 TFIIH basal transcripti on factor complex helicase subunit (EC 3.6.1.-) (DNA-repair protein complementin g XP-D cells) (Xeroderma pigmentosum group D complementing protein) (CXPD) (DNA excision repair protein ERCC-2). ENST00000391945.3 TFIIH basal transcripti on factor complex helicase subunit (EC 3.6.1.-) (DNA-repair protein complementin g XP-D cells) (Xeroderma pigmentosum group D complementing protein) (CXPD) (DNA excision repair protein ERCC-2). ENST00000451287.1 NP_001073870.1 appears to match this gene object. However, the physical evidence on zmap does not cover the whole ref_seq object ENST00000415077.1 Entrez has the following remark for the ref_seq made from this cDNA - NM_178494.2 was permanently suppressed because it is a nonsense-mediated mRNA decay (NMD) candidate ENST00000391916.2 NP_659493.2 ENST00000552360.1 upstream ATG ENST00000552360.1 NP_848606.2 ENST00000391901.3 Mus musculus testis-specific protein ABI17929.1 ENST00000557738.1 a larger exon 4 ENST00000517510.1 alternative 5' UTR ENST00000518979.1 alternative 5' UTR ENST00000520153.1 alternative 5' UTR ENST00000520015.1 alternative 5' UTR ENST00000522068.1 alternative 5' UTR ENST00000522889.1 alternative 5' UTR ENST00000522431.1 alternative 5' UTR ENST00000520007.1 alternative 5' UTR ENST00000521437.1 alternative 5' UTR ENST00000315396.7 NP_653178.3 ENST00000522966.1 alternative 5' UTR ENST00000518572.1 not organism-supported ENST00000522945.1 not organism-supported ENST00000522945.1 alternative 5' UTR ENST00000407032.1 alternative 3' UTR ENST00000411700.1 alternative 5' UTR ENST00000451312.1 alternative 5' UTR ENST00000523250.1 not organism-supported ENST00000522614.1 not organism-supported ENST00000415969.2 NP_620119.2 ENST00000529284.1 alternative 5' UTR ENST00000527382.1 alternative 5' UTR ENST00000534465.1 alternative 5' UTR ENST00000526224.1 alternative 5' UTR ENST00000533418.1 alternative 5' UTR ENST00000391833.1 alternative 5' UTR ENST00000391832.3 alternative 5' UTR ENST00000391831.1 alternative 5' UTR ENST00000391830.1 alternative 5' UTR ENST00000447370.2 NP_443116.2 ENST00000391814.1 Based on a rat mRNA ENST00000529888.1 NP_665902 ENST00000250351.4 NP_665901.1 ENST00000425629.2 NP_001236.4 ENST00000301399.5 NP_116068.2 ENST00000420592.1 alternative 5' UTR ENST00000458390.1 alternative 5' UTR ENST00000453272.1 alternative 5' UTR ENST00000446514.1 alternative 5' UTR ENST00000419138.1 alternative 5' UTR ENST00000391791.3 Non-canonical splicing between exons 3 and 4 ENST00000468240.1 NP_653285.2 ENST00000487863.1 The fourth exon of this variant overlaps a ribosomal protein L39 (RPL39) pseudogene annotated as OTTHUMG00000158225. No independent transcript from the ZNF808 gene can be made for the pseudogene ENST00000465448.1 alternative 5' UTR ENST00000461779.1 alternative 5' UTR ENST00000461321.1 alternative 5' UTR ENST00000477141.1 This pseudogene overlaps exon 4 of variant CTD-3099C6.3-002 of a putative zinc finger protein 808 ZNF808 annotated as OTTHUMG00000158230. No independent transcript from the ZNF808 gene can be made for this pseudogene ENST00000438150.2 alternative 5' UTR ENST00000457749.2 NM_006969.3 ENST00000357666.4 alternative 5' UTR ENST00000457013.2 alternative 5' UTR ENST00000270443.4 novel transcript ENST00000270443.4 DKFZp686I0252, FLJ35274 ENST00000467003.1 The 3' UTR this putative zinc finger protein 525 ZNF525 overlaps a ribosomal protein L39 (RPL39) pseudogene annotated as OTTHUMG00000158259. No independent transcript from the ZNF525 gene can be made for the pseudogene ENST00000459631.1 This pseudogene overlaps the 3' UTR of putative zinc finger protein 525 ZNF525 annotated as OTTHUMG00000158277. No independent transcript from the ZNF525 gene can be made for this pseudogene ENST00000340310.5 4 bases missing (bases 2-5) of exon 2 ENST00000396403.4 The 3' UTR this zinc finger protein 813 ZNF813 overlaps a ribosomal protein L39 (RPL39) pseudogene annotated as OTTHUMG00000158303. No independent transcript from the ZNF813 gene can be made for the pseudogene ENST00000483735.1 This pseudogene overlaps the 3' UTR of zinc finger protein 813 ZNF813 annotated as OTTHUMG00000158309. No independent transcript from the ZNF813 gene can be made for this pseudogene ENST00000253144.9 alternative 5' UTR ENST00000511593.1 alternative 5' UTR ENST00000502248.1 alternative 5' UTR ENST00000514374.1 alternative 5' UTR ENST00000411977.2 alternative 5' UTR ENST00000509047.1 alternative 5' UTR ENST00000509585.1 alternative 5' UTR ENST00000513999.1 alternative 5' UTR ENST00000512387.1 alternative 5' UTR ENST00000511567.1 alternative 5' UTR ENST00000514022.1 alternative 5' UTR ENST00000505949.1 alternative 5' UTR ENST00000513265.1 alternative 5' UTR ENST00000502616.1 alternative 5' UTR ENST00000504493.1 alternative 5' UTR ENST00000505426.1 alternative 5' UTR ENST00000270458.2 Translation start site is non-ATG (supported by Chu et al. Gene 280 (2001) 37-48 on the basis of conservation with mouse and rat) ENST00000420715.1 GENCODE experimental pipeline ENST00000391755.1 GENCODE experimental pipeline ENST00000245620.9 NAGNAG splice site ENST00000314446.5 alternatively spliced in 5' UTR, shares CDS with AC010518.1-001 ENST00000314446.5 alternative 5' UTR ENST00000391743.3 FLJ40550 ENST00000475389.1 FLJ36240 ENST00000472198.1 FLJ44736 ENST00000439657.1 alternative 5' UTR ENST00000443957.1 alternative 5' UTR ENST00000482404.1 novel transcript FLJ00060 ENST00000439534.1 alternative 5' UTR ENST00000251376.3 FLJ26660 ENST00000462628.1 FLJ37515 ENST00000433772.2 alternative 5' UTR ENST00000391719.1 NAGNAG splice site ENST00000391719.1 not organism-supported ENST00000559463.1 alternative 5' UTR ENST00000558131.1 not organism-supported ENST00000391718.2 NP_149104 ENST00000420723.2 Ref_Seq has this annotated as a pseudogene - see LOC100130827. Very little genuine protein evidence, as most seems to be derived from genomic DNA ENST00000534327.1 not best-in-genome evidence ENST00000467807.1 Non canonical donor splice site between exons 1 and 2 of this variant ENST00000537943.1 alternative 5' UTR ENST00000391778.3 alternative 5' UTR ENST00000558128.1 alternative 5' UTR ENST00000561219.1 alternative 5' UTR ENST00000559879.1 alternative 5' UTR ENST00000561033.1 alternative 5' UTR ENST00000558626.1 alternative 5' UTR ENST00000554048.1 not best-in-genome evidence ENST00000334181.4 FLJ16360 ENST00000334181.4 NP_001018855 ENST00000524372.1 non-canonical splice donor site between exons 3 and 4 ENST00000442920.2 non-canonical splice donor site between exons 3 and 4 ENST00000523439.1 non-canonical splice donor site between exons 3 and 4 ENST00000517598.1 non-canonical splice donor site between exons 3 and 4 ENST00000221735.7 non-canonical splice donor site between exons 4 and 5 ENST00000317656.4 KIAA2003 ENST00000317178.5 NP_775903.3 ENST00000551380.1 alternative 5' UTR ENST00000547121.1 alternative 5' UTR ENST00000552184.1 alternative 5' UTR ENST00000550135.1 LOC100128398 ENST00000511556.1 NP_003427.3 ENST00000360321.2 FLJ40075 ENST00000382352.3 PUTATIVE novel protein ENST00000382352.3 supported by FGENES and GENSCAN ENST00000414676.1 novel transcript ENST00000442637.1 novel transcript ENST00000492242.1 novel transcript ENST00000382291.3 FLJ23329 ENST00000470439.1 novel transcript ENST00000449710.1 alternative 5' UTR ENST00000411647.1 alternative 5' UTR ENST00000461188.1 FLJ31011, DKFZp686B10111 ENST00000354200.4 FLJ45119 ENST00000494633.1 FLJ37791 ENST00000217244.3 alternative 5' UTR ENST00000381962.3 DKFZp727A181, FLJ45527 ENST00000488788.1 FLJ43353 ENST00000381944.3 FLJ90169 ENST00000473664.1 novel transcript ENST00000488495.1 novel transcript ENST00000304189.2 alternative splicing in 5' UTR, shares CDS with RP11-371L19.3-001 ENST00000304189.2 alternative 5' UTR ENST00000381939.1 alternative splicing in 5' UTR, shares CDS with RP11-371L19.3-001 ENST00000381939.1 alternative 5' UTR ENST00000246100.3 alternative splicing in 5' UTR, shares CDS with RP11-371L19.3-001 ENST00000246100.3 alternative 5' UTR ENST00000217260.4 FLJ16018 ENST00000381899.4 alternative 5' UTR ENST00000461847.1 FLJ25476 ENST00000461847.1 non-canonical splice donor site between exons 4 and 5 ENST00000381894.3 FLJ11190 ENST00000481747.1 chromosome 20 open reading frame 46 ENST00000246108.3 alternative 5' UTR ENST00000446423.1 novel transcript ENST00000412497.1 putative novel transcript ENST00000474657.1 non-consensus splicing between exons 3 and 4 ENST00000216879.4 FLJ36526 ENST00000481731.1 protein tyrosine phosphatase, non-receptor type 1-like ENST00000486775.1 protein tyrosine phosphatase, non-receptor type 1-like ENST00000359801.3 protein tyrosine phosphatase, non-receptor type 1-like ENST00000381630.1 protein tyrosine phosphatase, non-receptor type 1-like ENST00000453770.1 PTPNS (protein tyrosine phosphatase, non-receptor type substrate 1) protein family pseudogene ENST00000279477.7 FLJ26614 ENST00000456177.1 FLJ36200 ENST00000340424.4 PTPNS (protein tyrosine phosphatase, non-receptor type substrate) family pseudogene ENST00000447206.1 putative novel protein ENST00000446562.1 FLJ33362 ENST00000427639.1 ribosomal protein L7 pseudogene 2 ENST00000381482.3 NP_543026.2 ENST00000447956.1 putative novel transcript ENST00000411839.1 putative novel transcript ENST00000461548.1 subject to nonsense-mediated decay ENST00000465019.1 FLJ31172 ENST00000278772.4 FLJ39592 ENST00000445484.1 zinc finger protein 343 (novel KRAB box protein) ENST00000445484.1 alternative 5' UTR ENST00000421216.1 alternative 5' UTR ENST00000496948.1 FLJ37470 ENST00000329276.5 DKFZp686B1699 ENST00000413522.1 RNA, U56 small nuclear ENST00000448188.1 RNA, U57 small nuclear ENST00000469213.1 non-canonical splice site at 5' end of exon 5 ENST00000474315.1 non-canonical splice site at the 3' end of exon 12 ENST00000466999.1 isocitrate dehydrogenase 3 (NAD+) beta (IDH3B) ENST00000418739.1 putative novel transcript ENST00000449079.2 novel protein (KIAA1442) ENST00000497450.1 novel transcript ENST00000342725.4 novel protein ENST00000469215.1 novel transcript ENST00000463145.1 novel transcript ENST00000491472.1 novel transcript ENST00000481662.1 novel transcript ENST00000477287.1 novel transcript ENST00000411635.1 ribosomal protein L19 pseudogene 1 ENST00000380605.2 FLJ14755 ENST00000356872.3 FLJ22376 ENST00000360652.2 FLJ31791 ENST00000474714.1 novel transcript ENST00000478539.1 non-canonical splice acceptor site between exons 6 and 7 ENST00000478539.1 novel transcript ENST00000487501.1 novel transcript ENST00000448755.1 alternative 5' UTR ENST00000439542.1 alternative 5' UTR ENST00000380445.3 contains DKFZp547D213 ENST00000380469.3 FLJ31225 ENST00000380443.3 vacuolar protein sorting 16 (yeast) ENST00000455631.1 alternative 5' UTR ENST00000216877.5 alternative 5' UTR ENST00000431048.1 alternative 5' UTR ENST00000418580.1 alternative 5' UTR ENST00000318266.5 alternative 5' UTR ENST00000430705.1 alternative 5' UTR ENST00000359100.2 alternative 5' UTR ENST00000217173.2 KIAA0860 ENST00000348031.2 FLJ12382 ENST00000449731.1 alternative 5' UTR ENST00000380266.3 FLJ13149 ENST00000329152.3 KIAA0552 ENST00000496781.1 novel transcript ENST00000470203.1 novel transcript ENST00000474451.1 FLJ33838 ENST00000252032.9 chromosome 20 open reading frame 194 (DKFZp434N061) ENST00000498079.1 chromosome 20 open reading frame 194 novel transcript (FLJ13857) ENST00000430836.1 ubiquitin-conjugating enzyme E2 variant 1 pseudogene 1 ENST00000421444.1 pseudogene similar to TCEAL1 (transcription elongation factor A (SII)-like 1 ENST00000446317.1 splicing factor 3a, subunit 3 pseudogene ENST00000290417.2 isoform a ENST00000319242.3 isoform b ENST00000477160.1 isoform c ENST00000466620.1 DKFZp434K0521 ENST00000483362.1 FLJ36751 ENST00000479330.1 FLJ38634 ENST00000419548.1 FLJ00051, FLJ00073 ENST00000254963.2 FLJ32150 ENST00000379772.3 FLJ40236, FLJ12651, FLJ14158 ENST00000487464.1 novel transcript ENST00000471499.1 DKFZp434I114 ENST00000467519.1 FLJ35394 ENST00000245960.5 CDC25B3 ENST00000439880.2 CDC25B1 ENST00000340833.4 CDC25B2 ENST00000379567.2 FLJ36013 ENST00000379567.2 alternative 5' UTR ENST00000455742.1 alternative 5' UTR ENST00000246041.2 FLJ11168 ENST00000428216.2 KIAA1271, FLJ13737 ENST00000451507.1 putative novel transcript ENST00000497424.1 FLJ11729, DKFZp547J0513 ENST00000316562.4 FLJ40477 ENST00000358395.6 alternative 5' UTR ENST00000440049.1 ribosomal protein L21 pseudogene 2 ENST00000379526.1 novel protein ENST00000493223.1 novel transcript ENST00000379460.2 FLJ20746 ENST00000379460.2 alternative 5' UTR ENST00000457205.1 FLJ22285 ENST00000466004.1 novel transcript ENST00000419003.1 novel transcript ENST00000448825.1 putative novel transcript ENST00000419863.1 putative novel transcript ENST00000429405.1 ribosomal protein L7a like 2 (pseudogene) ENST00000458402.1 ribosomal protein S4 pseudogene ENST00000430350.2 alternative 5' UTR ENST00000424424.1 alternative 5' UTR ENST00000457586.1 alternative 5' UTR ENST00000418528.1 alternative 5' UTR ENST00000423718.2 alternative 5' UTR ENST00000432048.1 isopentenyl-diphosphate delta isomerase 1 (IDI1) pseudogene ENST00000379400.3 KIAA0168 ENST00000338244.1 alternative 5' UTR ENST00000435457.1 RPS21 (ribosomal protein S21) pseudogene ENST00000379283.2 alternative 5' UTR ENST00000379299.2 alternative 5' UTR ENST00000202834.7 alternative 5' UTR ENST00000379286.2 FLJ31138 ENST00000379286.2 alternative 5' UTR ENST00000379279.2 alternative 5' UTR ENST00000492419.1 novel transcript ENST00000379277.2 alternative 5' UTR ENST00000379160.3 alternative 5' UTR ENST00000460006.1 FLJ14789, FLJ10552 ENST00000468817.1 FLJ33726 ENST00000379070.3 FLJ38111 ENST00000414677.1 novel transcript ENST00000422352.1 this variant and variant fragment dJ828H9.3.2 could be part of one single variant ENST00000422352.1 novel transcript ENST00000420529.1 novel transcript ENST00000430097.2 novel transcript (LOC284769) ENST00000456714.1 novel transcript (LOC284769) ENST00000379053.2 novel transcript ENST00000430333.1 novel transcript ENST00000450640.1 novel transcript ENST00000447840.1 ribosomal protein S18 pseudogene 1 ENST00000413249.1 novel transcript ENST00000379019.4 KIAA1434, FLJ11085 ENST00000481038.1 novel transcript ENST00000481038.1 DKFZp45101715 ENST00000418646.1 novel protein ENST00000462080.1 novel transcript ENST00000473797.1 novel transcript ENST00000481690.1 novel transcript ENST00000422311.1 EIF4E (eukaryotic translation initiation factor 4E) pseudogene ENST00000445603.1 alternative 5' UTR ENST00000488832.1 FLJ30309 ENST00000473131.1 novel transcript ENST00000466974.1 KIAA1153 ENST00000466974.1 novel transcript ENST00000493972.1 novel transcript ENST00000378896.3 FLJ14738 ENST00000421490.1 pseudogene similar to part of cytochrome c oxidase I ENST00000489345.1 novel transcript ENST00000464921.1 novel transcript ENST00000478846.1 novel transcript ENST00000478194.1 novel transcript ENST00000478194.1 FLJ20116 ENST00000468424.1 non-canonical splice acceptor and donor sites between exons 11 and 12 ENST00000378844.1 alternative 5' UTR ENST00000442013.1 TAR DNA-binding protein pseudogene ENST00000434910.1 NS1-associated protein 1 (NSAP1) pseudogene ENST00000415932.1 novel transcript ENST00000445589.1 putative novel transcript ENST00000425900.1 putative novel transcript ENST00000449581.1 novel transcript ENST00000428954.1 putative novel transcript ENST00000455299.1 novel transcript ENST00000400616.2 FUSIP1 pseudogene (pFUSIP1) ENST00000450951.1 phosphorylase kinase, beta pseudogene 1 ENST00000378641.3 alternative 3' UTR ENST00000338037.6 KIAA0581 ENST00000378637.2 alternative 3' UTR ENST00000487210.1 DKFZp434A0814 ENST00000494924.1 FLJ13627 ENST00000451443.1 putative novel transcript ENST00000441231.1 putative novel transcript ENST00000439121.1 ribosomal protein L31 (RPL31) pseudogene ENST00000407043.2 alternative 5' UTR ENST00000441846.1 alternative 5' UTR ENST00000437503.1 alternative 5' UTR ENST00000416836.1 alternative 5' UTR ENST00000443469.1 novel transcript ENST00000378429.3 KIAA1264 ENST00000378429.3 alternative 5' UTR ENST00000353224.5 alternative 5' UTR ENST00000378423.1 alternative 5' UTR ENST00000428769.1 putative novel transcript ENST00000449270.1 putative novel transcript ENST00000437504.1 putative novel transcript ENST00000426491.1 novel transcript ENST00000453544.1 novel transcript ENST00000421143.1 novel transcript ENST00000438646.1 novel transcript ENST00000451151.1 novel transcript ENST00000378380.3 alternative 5' UTR ENST00000378380.3 FLJ40370, FLJ21669, FLJ23883 ENST00000424931.1 putative novel transcript ENST00000458004.1 putative novel transcript ENST00000416198.1 hypoxia induced gene 1 (HIG1) pseudogene ENST00000446637.1 ribosomal protein L23a pseudogene 6 ENST00000441308.1 novel (FLJ10498) pseudogene ENST00000399054.2 alternative 5' UTR ENST00000417299.1 putative novel transcript ENST00000418690.1 novel transcript ENST00000421788.1 exon 1 donor or 3' splice site is not a consensus site ENST00000421788.1 novel transcript ENST00000448859.1 novel transcript ENST00000406588.1 FAT tumour suppressor homolog 1 (Drosophila) pseudogene 1 ENST00000378252.1 novel protein ENST00000412405.1 Putative novel transcript. ENST00000412405.1 Variant 1 ENST00000444792.1 Variant 2 ENST00000451072.1 ribosomal protein S11, pseudogene 1 ENST00000437662.1 phosphoglycerate mutase 3 pseudogene ENST00000254977.3 NP_852108 ENST00000399006.2 alternative 5' UTR ENST00000405977.1 KIAA0952 ENST00000450368.1 alternative 5' UTR ENST00000422390.1 alternative 5' UTR ENST00000439529.1 novel transcript ENST00000455132.1 putative novel transcript ENST00000442389.1 putative novel transcript ENST00000414718.1 proliferation-associated 2G4 pseudogene 2 ENST00000456265.1 novel transcript ENST00000449841.1 novel transcript ENST00000432244.1 novel transcript ENST00000476791.1 FLJ11112 ENST00000434210.1 alternative 5' UTR ENST00000445249.1 putative novel transcript ENST00000447521.1 chromosome 20 open reading frame 82 (similar to Xenopus laevis Isthmin (ISM)) ENST00000431407.1 Putative novel transcript ENST00000420044.1 Putative novel transcript ENST00000337743.4 FLJ20212, FLJ22018 ENST00000432206.1 glyceraldehyde-3-phosphate dehydrogenase pseudogene 2 ENST00000378081.5 FLJ33741 ENST00000485738.1 novel transcript ENST00000477732.1 novel transcript ENST00000475968.1 novel transcript ENST00000481249.1 novel transcript ENST00000476536.1 novel transcript ENST00000469177.1 novel transcript ENST00000464269.1 novel transcript ENST00000479716.1 novel transcript ENST00000487478.1 novel transcript ENST00000476124.1 novel transcript ENST00000476200.1 novel transcript ENST00000479682.1 novel transcript ENST00000486772.1 novel transcript ENST00000476952.1 chromosome 20 open reading frame 50 (dJ631M13.1, similar to SEL1L) (C20orf50)(DJ842G6.2, DKFZp434C1826) ENST00000477435.1 chromosome 20 open reading frame 50 (dJ631M13.1, similar to SEL1L) (C20orf50)(DJ842G6.2, DKFZp434C1826) ENST00000217246.4 FLJ16368 ENST00000477147.1 novel transcript ENST00000483997.1 novel transcript ENST00000492055.1 novel transcript ENST00000462552.1 novel transcript ENST00000494602.1 novel transcript ENST00000490428.1 novel transcript ENST00000463861.1 novel transcript ENST00000464883.1 novel transcript ENST00000497992.1 novel transcript ENST00000402914.1 novel protein (LOC284776) ENST00000486914.1 novel transcript ENST00000407045.3 novel protein (LOC284776) ENST00000456781.1 ribosomal protein S3 pseudogene 1 ENST00000418670.1 small inducible cytokine subfamily E, member 1 (endothelial-monocyte activating) pseudogene ENST00000378053.3 KIAA1469, FLJ90402, FLJ14391 ENST00000341420.4 FLJ90428 ENST00000341420.4 alternative 5' UTR ENST00000427702.1 ring finger protein 11B pseudogene ENST00000430953.1 ribosomal protein S10 pseudogene 2 ENST00000455291.1 novel transcript ENST00000441428.1 novel transcript ENST00000453972.1 putative novel transcript ENST00000392855.2 cyclic AMP phosphoprotein (ARPP-19) pseudogene ENST00000438507.1 peptidylprolyl isomerase (cyclophilin) pseudogene 11 ENST00000354981.2 FLJ23045 ENST00000408042.1 KIAA1590, FLJ20135 ENST00000457002.1 ribosomal protein, large, P0 pseudogene 1 ENST00000443141.1 ribosomal protein L7a-like 3 (pseudogene) ENST00000425939.1 novel transcript ENST00000377943.5 alternative 5' UTR ENST00000422574.1 novel transcript ENST00000459871.1 FLJ34186 ENST00000474024.1 DKFZp686O20275 ENST00000377813.1 KIAA1398, DKFZp586A1420 ENST00000468428.1 FLJ41000 ENST00000470422.1 FLJ36146 ENST00000398782.2 alternative 5' UTR ENST00000427254.1 alternative 5' UTR ENST00000246090.5 alternative 5' UTR ENST00000467330.1 novel transcript ENST00000377768.3 FLJ22574 ENST00000377759.3 FLJ10931, FLJ25994 ENST00000483485.1 FLJ30072 ENST00000278780.5 FLJ12222 ENST00000377710.5 FLJ14597 ENST00000463219.1 novel transcript ENST00000467391.1 novel transcript ENST00000377681.2 not organism-supported ENST00000464792.1 alternative 5' UTR ENST00000489422.1 alternative 5' UTR ENST00000484001.1 alternative 5' UTR ENST00000492286.1 alternative 5' UTR ENST00000462170.1 FLJ16801 ENST00000377630.5 non canonical acceptor site between exons 11 and 12 ENST00000377630.5 FLJ30982 ENST00000476058.1 novel transcript FLJ22653 ENST00000487128.1 non canonical acceptor site between exons 8 and 9 ENST00000487128.1 novel transcript ENST00000480488.1 non canonical acceptor site between exons 1 and 2 ENST00000480488.1 novel transcript ENST00000460891.1 non canonical acceptor splicing site between exons 12 and 13 ENST00000460891.1 novel transcript ENST00000470526.1 novel transcript ENST00000450074.1 alternative 5' UTR ENST00000336714.3 alternative 5' UTR ENST00000377475.3 alternative 5' UTR ENST00000411646.1 FLJ20941 ENST00000494921.1 FLJ23724 ENST00000412553.1 FLJ37287 ENST00000446849.1 putative novel transcript ENST00000319682.2 FLJ40178 ENST00000255006.6 FLJ37565 ENST00000310450.4 NM_181528.2 ENST00000377327.4 AT-AC splicing between exons 6 and 7 ENST00000377327.4 DKFZp762M013, FLJ12846, FLJ13184, FLJ13666, FLJ22689 ENST00000521379.1 not organism-supported ENST00000245957.5 novel protein ENST00000377306.1 novel protein (DKFZP434K156) ENST00000377303.2 alternative 5' UTR ENST00000442372.1 novel protein ENST00000431753.1 this variant and variant fragment dJ1178H5.4.2 could be part of one single variant ENST00000431753.1 chromosome 20 open reading frame 26 ENST00000468719.1 novel transcript ENST00000476414.1 novel transcript ENST00000493330.1 novel transcript ENST00000497372.1 novel transcript ENST00000377293.1 novel protein ENST00000486624.1 novel transcript ENST00000488640.1 novel transcript ENST00000443692.1 located in intron of gene dJ1178H5.4 ENST00000443692.1 putative novel transcript ENST00000443692.1 partially supported by GENSCAN; could be a pseudogene ENST00000445304.1 ribosomal Protein L17 pseudogene 1 ENST00000417022.1 novel protein similar to rat tulip proteins 1 and 2 ENST00000417022.1 a base deletion at position 111866 and base deletion at 11417 change the protein translation compared to the EMBL entry Em:BC013749 ENST00000417022.1 novel protein similar to rat tulip proteins 1 and 2, variant 6 (contains FLJ22541) ENST00000430436.1 novel protein (FLJ11349) similar to rat tulip proteins 1 and 2, (KIAA1272) ENST00000430436.1 novel protein (FLJ11349) similar to rat tulip proteins 1 and 2, (KIAA1272), variant 1 (contains FLJ22541) ENST00000427175.1 novel protein (FLJ12819) similar to rat tulip proteins 1 and 2 ENST00000495793.1 novel transcript ENST00000432524.1 novel protein ENST00000424981.1 novel protein ENST00000438161.1 novel protein ENST00000417696.1 putative novel transcript ENST00000437558.1 mitochondrial ribosmal protein S11 pseudogene 1 ENST00000432942.1 putative novel transcript ENST00000420705.1 putative novel transcript ENST00000455890.1 putative novel transcript ENST00000421023.1 ribosomal protein L24 pseudogene 2 ENST00000447448.1 Suspected genomic error affecting CDS in exon 7 ENST00000441136.1 chromosome 20 open reading frame 19 ENST00000423272.1 novel transcript ENST00000246027.8 Suspected genomic error affecting CDS in exon 7 ENST00000425746.1 putative novel transcript ENST00000434043.1 putative novel transcript ENST00000457423.1 ribosomal protein S15a pseudogene 1 ENST00000443753.1 novel transcript ENST00000433213.1 novel transcript ENST00000437614.1 novel zinc finger pseudogene ENST00000377191.3 FLJ10711, FLJ20077, DKFZp434M182 ENST00000351817.4 not organism-supported ENST00000421090.1 hydroxysteroid (17-beta) dehydrogenase 12 (HSD17B12) pseudogene ENST00000447621.1 glutathione S-transferase M3 pseudogene ENST00000431034.1 putative novel transcript ENST00000398485.2 NP_006183.2 ENST00000412123.1 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 5-like pseudogene ENST00000484902.1 ribosomal protein L41, pseudogene 1 ENST00000438222.1 putative novel transcript ENST00000449427.1 putative novel transcript ENST00000439450.1 putative novel transcript ENST00000420928.1 putative novel transcript ENST00000377121.1 novel transcript (LOC284788) ENST00000419308.2 alternatively spliced in 5' UTR, ENST00000419308.2 alternative 5' UTR ENST00000422494.1 novel transcript ENST00000441568.1 novel transcript ENST00000437696.1 novel transcript ENST00000451602.1 keratin 18 pseudogene 3 ENST00000396692.2 cytochrome b-5 pseudogene 4 ENST00000415260.1 kinesin-like 7 (KNSL7) pseudogene ENST00000440798.1 novel transcript ENST00000440921.1 putative novel transcript ENST00000419734.1 putative novel transcript ENST00000411595.1 putative novel transcript ENST00000442884.1 putative novel transcript ENST00000254998.2 FLJ22707 ENST00000442440.1 putative novel transcript ENST00000444981.1 putative novel transcript ENST00000452395.1 putative novel transcript ENST00000338121.5 FLJ21794, FLJ31597, FLJ31915 ENST00000424216.1 alternative 5' UTR ENST00000449810.1 alternative 5' UTR ENST00000400563.2 novel transcript ENST00000413633.1 novel transcript ENST00000376987.1 possible pseudogene ENST00000398411.1 alternative 3' UTR ENST00000398409.1 alternative 5' UTR ENST00000217423.3 FLJ27028 ENST00000398402.1 alternative 5' UTR ENST00000286890.4 alternative 5' UTR ENST00000278765.4 alternative 5' UTR ENST00000457224.1 putative novel transcript ENST00000457274.1 novel transcript (FLJ33581) ENST00000453921.1 putative novel transcript ENST00000458397.1 GAPD (glyceraldehyde-3-phosphate dehydrogenase) pseudogene ENST00000376862.3 FLJ14220 ENST00000482637.1 novel transcript ENST00000458461.1 putative novel transcript ENST00000432834.1 putative novel transcript ENST00000484396.1 FLJ43935, FLJ33532, DKFZp666B209 ENST00000323482.4 FLJ14911, KIAA1846 ENST00000376726.3 FLJ37095 ENST00000376709.3 variant L1 ENST00000454676.1 novel transcript (LOC284798) (FLJ38481) ENST00000438287.1 novel transcript (LOC284798) ENST00000426854.1 novel transcript (LOC284798) ENST00000440357.1 novel transcript (LOC284798) ENST00000440642.1 novel pseudogene ENST00000354989.5 DKFZp761J1915 ENST00000376652.4 FLJ90210 ENST00000435520.1 alternative 5' UTR ENST00000485936.1 FLJ36711 ENST00000490187.1 FLJ38389 ENST00000465694.1 alternative 3' UTR ENST00000465694.1 novel transcript ENST00000339157.5 DKFZp434P106 ENST00000491682.1 novel transcript ENST00000481556.1 novel transcript ENST00000471287.1 novel transcript ENST00000461204.1 novel transcript ENST00000414143.1 peptidylprolyl isomerase A (cyclophilin A) pseudogene 2 ENST00000262460.4 novel protein (KIAA0186) ENST00000484893.1 novel transcript ENST00000473460.1 novel transcript ENST00000481735.1 novel transcript ENST00000464285.1 novel transcript FLJ11792 ENST00000496509.1 novel transcript ENST00000336104.5 KIAA0980 protein ENST00000489780.1 novel transcript ENST00000461642.1 novel transcript ENST00000304788.3 FLJ30910, DKFZp31301829 ENST00000455791.1 novel transcript ENST00000421829.1 novel transcript ENST00000420803.1 novel transcript ENST00000414393.1 novel transcript ENST00000428254.1 novel transcript ENST00000439498.1 novel transcript ENST00000456611.1 endothelial-derived gene 1 (EG1) pseudogene ENST00000376436.1 FLJ43466 ENST00000252979.5 alternative 5' UTR ENST00000252979.5 FLJ31622 ENST00000431580.1 vomeronasal organ phermone receptor family pseudogene ENST00000376445.3 putative novel transcript ENST00000453481.2 novel transcript ENST00000485279.1 putative novel transcript ENST00000510553.1 novel zinc-finger pseudogene ENST00000424021.1 putative novel transcript ENST00000437782.1 putative novel transcript ENST00000448580.1 putative novel transcript ENST00000376401.4 zinc-finger pseudogene ENST00000389261.3 alternative 5' UTR ENST00000439881.1 alternative 5' UTR ENST00000471057.1 novel transcript ENST00000482133.1 novel transcript ENST00000478176.1 novel transcript ENST00000416563.1 putative novel transcript ENST00000432499.1 novel transcript ENST00000427348.1 novel transcript ENST00000416638.1 Putative novel transcript ENST00000376400.2 Pseudogene similar to part of the cystic fibrosis transmembrane conductance regulator (CFTR) ENST00000380888.3 FLJ45832 ENST00000454331.1 A putative novel transcript ENST00000445151.1 non-canonical splicing between exons 2 and 3 ENST00000278882.3 novel protein similar to FSHD (fascioscapulohumeral muscular dystrophy) region gene 1 (FRG1) ENST00000468180.1 novel protein similar to FSHD (fascioscapulohumeral muscular dystrophy) region gene 1 (FRG1), variant 3 (alternative UTR) ENST00000482423.1 novel protein similar to FSHD (fascioscapulohumeral muscular dystrophy) region gene 1 (FRG1), variant 4 (alternative UTR) ENST00000479318.1 novel protein similar to FSHD (fascioscapulohumeral muscular dystrophy) region gene 1 (FRG1) ENST00000418346.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (MLLT10) pseudogene ENST00000446917.1 putative novel transcript ENST00000400550.2 DKKL1-pending (soggy-1) (SGY-1) pseudogene ENST00000445194.2 CDK5 regulatory subunit associated protein 3 (CDK5RAP3) pseudogene ENST00000458430.1 ribosomal protein L31 pseudogene 3 ENST00000433254.1 FLJ20060l (KIAA1574) pseudogene ENST00000433453.1 defensin, beta 122 (DEFB-22) ENST00000376309.3 defensin, beta 123 (DEFB-23) ENST00000340852.5 FLJ90802 ENST00000498035.1 FLJ90205 ENST00000468559.1 ) ENST00000394552.2 MCT-1 (multiple copies in a T-cell malignancies) pseudogene ENST00000307677.4 alternative 5' UTR ENST00000450273.1 alternative 5' UTR ENST00000420488.1 alternative 5' UTR ENST00000456404.1 alternative 5' UTR ENST00000422920.1 alternative 5' UTR ENST00000439267.1 alternative 5' UTR ENST00000434194.1 alternative 5' UTR ENST00000428124.1 ATP synthase, H+ transporting, mitochondrial F0 complex subunit f isoform 2 (ATP5J2) pseudogene ENST00000375994.2 alternative 5' UTR ENST00000278979.3 FLJ40111 ENST00000486996.1 FLJ34641 ENST00000449519.1 novel transcript ENST00000375862.2 NAGNAG at the start of exon 4 ENST00000375862.2 NP_001165601 ENST00000520553.1 NP_001165600 ENST00000518730.1 NP_001165602 ENST00000375852.2 NP_002101 ENST00000470092.1 hemopoietic cell kinase ENST00000398022.2 NP_055557 ENST00000217315.5 KIAA0255 ENST00000495749.1 FLJ42420 ENST00000476365.1 TSPY-like 3 (pseudogene) ENST00000246229.4 FLJ23298 ENST00000246229.4 KIAA0198 ENST00000375749.3 KIAA0180 ENST00000375712.3 KIAA0359 ENST00000375712.3 FLJ25565 ENST00000375687.4 KIAA0978 ENST00000359676.5 FLJ31724 ENST00000475781.1 novel transcript ENST00000375678.3 FLJ40485 ENST00000470428.1 this variant fragment and either of variant fragments .4.1 and .2.1 through to .2.4 could be part of one single variant ENST00000470428.1 novel transcript ENST00000485364.1 novel transcript ENST00000442179.1 translation of cDNA DFKZp564J1762 (Em:AL080086)) ENST00000442179.1 this gene is contained within gene .2 on the oposite strand and could be artifactual ENST00000413983.1 novel transcript ENST00000457213.1 putative novel transcript ENST00000375670.1 novel protein ENST00000360785.3 FLJ33706 ENST00000474815.1 novel transcript ENST00000445368.1 family with sequence similarity 16, member A, X-linked (FAM16AX) (GS1) pseudogene ENST00000445356.1 novel transcript ENST00000375483.3 NP_872325 ENST00000375483.3 5' extension based on mouse ortholog A2BGH0.1 ENST00000494121.1 novel transcript ENST00000253362.2 alternative 5' UTR ENST00000417727.1 suppressor of cytokine signalling 2 pseudogene 1 ENST00000419613.1 putative novel transcript ENST00000490499.1 novel transcript ENST00000354297.4 alternative 3' UTR ENST00000375422.2 alternative 3' UTR ENST00000440080.1 ribosomal protein L12 pseudogene 3 ENST00000464032.1 novel transcript ENST00000498525.1 non-canonical splice acceptor site between exons 3 and 4 ENST00000454955.1 alternative 5' UTR ENST00000480994.1 amyloid beta (A4) precursor protein-binding family A, member 2 protein ENST00000330271.4 Orthologous transcripts can also be found in mouse, where a longer CDS can be annotated ENST00000413849.1 ribosomal protein L31 pseudogene 2 ENST00000397772.2 tropomyosin 5 pseudogene ENST00000425307.1 Down syndrome critical region gene 5 (DSCR5) pseudogene ENST00000440595.1 putative novel transcript ENST00000419662.1 putative novel transcript ENST00000432859.1 putative novel transcript ENST00000451556.1 novel transcript ENST00000434010.1 ribosomal protein S2, pseudogene 1 ENST00000443317.1 exportin, tRNA (nuclear export receptor for tRNAs) pseudogene 1 ENST00000433096.1 density-regulated protein (DENR) (DRP1, SMAP-3) pseudogene ENST00000437424.1 pseudogene similar to part of laminin receptor 1 (ribosomal protein SA, 67kDa) (LAMR1) ENST00000456658.1 cell division cycle 42 pseudogene 1 ENST00000454205.1 putative novel transcript ENST00000449115.1 ferredoxin 1 (FDX1) pseudogene ENST00000397709.1 alternative 3' UTR ENST00000450770.1 cytochrome c oxidase III (MTCO3) pseudogene ENST00000359003.2 alternative 5' UTR ENST00000393368.2 high mobility group (nonhistone chromosomal) protein 4-like (pseudogene) ENST00000470929.1 FLJ10085 ENST00000374492.3 FLJ10783, FLJ13869 ENST00000374436.3 alternative 5' UTR ENST00000456600.1 alternative 5' UTR ENST00000374408.3 FLJ33819 ENST00000472559.1 novel transcript DKFZp686O0680 ENST00000374394.3 novel transcript FLJ12680 ENST00000374384.2 NP_955781.2 ENST00000374385.5 FLJ10850 ENST00000453855.1 novel transcript ENST00000497717.1 novel transcript ENST00000443429.1 novel transcript ENST00000498651.1 novel transcript ENST00000491125.1 novel transcript ENST00000495752.1 novel transcript ENST00000446710.1 tissue_lung ENST00000446710.1 5RACE054_RP3-477O4.2-001_CEP2:_lung ENST00000446710.1 encode_confirmed ENST00000446710.1 exons_1-5 ENST00000446710.1 alternative 5' UTR ENST00000420564.1 alternative 5' UTR ENST00000397524.1 CDS added 12/4/07 by jm12 ENST00000425934.1 GENCODE experimental pipeline ENST00000422671.1 GENCODE experimental pipeline ENST00000246199.2 FLJ25360 ENST00000357394.4 FLJ90069, DKFZp547A2190 ENST00000492184.1 FLJ39165 ENST00000325076.5 novel transcript FLJ22613 ENST00000262870.6 FLJ13459 ENST00000400461.2 DKFZp666J207 ENST00000411519.1 DKFZp686F01207 ENST00000412452.1 novel transcript ENST00000434843.1 novel transcript ENST00000317677.5 alternative 5' UTR ENST00000437340.1 alternative 5' UTR ENST00000412056.1 alternative 5' UTR ENST00000414664.1 alternative 5' UTR ENST00000416778.1 alternative 5' UTR ENST00000439806.1 alternative 5' UTR ENST00000420363.1 alternative 5' UTR ENST00000434795.1 alternative 5' UTR ENST00000440240.1 alternative 5' UTR ENST00000458038.1 alternative 5' UTR ENST00000437100.1 alternative 5' UTR ENST00000414711.1 alternative 5' UTR ENST00000435747.1 alternative 5' UTR ENST00000374085.1 FLJ31680 ENST00000397425.1 alternative 5' UTR ENST00000359646.1 alternative 5' UTR ENST00000374104.3 alternative 5' UTR ENST00000424458.1 alternative 5' UTR ENST00000374078.1 alternative 5' UTR ENST00000336695.4 alternative 5' UTR ENST00000339089.6 alternative 5' UTR ENST00000374000.4 alternative 5' UTR ENST00000305978.2 alternative 5' UTR ENST00000432589.1 alternative 5' UTR ENST00000406771.2 alternative 5' UTR ENST00000430276.1 alternative 5' UTR ENST00000452261.1 alternative 5' UTR ENST00000447825.1 alternative 5' UTR ENST00000427533.1 alternative 5' UTR ENST00000373945.1 alternative 5' UTR ENST00000441208.1 novel transcript (FLJ33601) ENST00000320849.4 alternative 5' UTR ENST00000373913.3 KIAA0964 ENST00000478910.1 FLJ30590 ENST00000373874.2 alternative 5' UTR ENST00000558028.1 alternative 5' UTR ENST00000560025.1 alternative 5' UTR ENST00000451198.2 heterogeneous nuclear ribonucleoprotein A3 pseudogene ENST00000480314.1 non-canonical splicing between exons 4 and 5 looks artefactual rather than a genuine splicing event ENST00000473615.1 non-canonical splicing between exons 3 and 4 looks artefactual ratrher than a genuine splicing event ENST00000447406.1 alternative 5' UTR ENST00000489902.1 non-canonical splicing between exons 14 and 15 looks artefactual ENST00000465671.1 alternative 3' UTR ENST00000411933.1 ribosomal protein S3A pseudogene 3 ENST00000453803.1 ribosomal protein S27a pseudogene 3 ENST00000343811.4 novel protein ENST00000343811.4 deletion/polymorphism at bp 19647-19644 truncates the CDS at the 5' end. mRNA evidence Em:BC030006.1 contains an additional 29 nucleotides that enable the N terminal end of the annotated CDS to be extended by 40 amino acids ENST00000417458.1 novel protein (DKFZp434N0426) ENST00000466091.1 novel transcript ENST00000421643.1 deletion/polymorphism at bp 19647-19644 truncates the CDS at the 5' end. mRNA evidence Em:AK093432.1 contains an additional 29 nucleotides that enable the N terminal end of the annotated CDS to be extended by 40 amino acids ENST00000421643.1 novel protein (FLJ36113) ENST00000400440.2 genomic sequence contains a polymorphism/deletion at bp 19644-19467. Supporting evidence EM:BC057767.1 contains 29 additional nucleotides AGTGCCGGCCGCGGGGCCCTGTCTATAAG which are missing from the alignment with genomic sequence at this point and allow the ORF to be extended 5' to an upstream methionine ENST00000434295.1 novel protein ENST00000422138.1 alternatively spliced in 5' UTR, shares CDS with dJ343K2.3.2 ENST00000422138.1 novel protein ENST00000422138.1 alternative 5' UTR ENST00000447075.1 ribososmal protein L13 (RPL13) pseudogene ENST00000373606.3 alternative 5' UTR ENST00000397152.3 alternative 5' UTR ENST00000397151.1 alternative 5' UTR ENST00000497734.1 May be alternative 5' UTR to main variant ENST00000373567.2 Same CDS but alternative 5' UTR to main variant ENST00000397137.1 alternative 5' UTR ENST00000397135.1 alternative 5' UTR ENST00000397134.1 alternative 5' UTR ENST00000397131.1 alternative 5' UTR ENST00000432507.1 alternative 5' UTR ENST00000445723.1 alternative 5' UTR ENST00000414080.1 alternative 5' UTR ENST00000456058.1 alternative 5' UTR ENST00000361383.6 AT-AC splicing between exons 4 and 5 ENST00000447935.1 AT-AC splicing between exons 4 and 5 ENST00000373447.3 alternative 5' UTR ENST00000485572.1 non-canonical splicing between exons 2 and 3 and exons 12 and 13 looks artefactual and is unlikely to represent a true splicing event ENST00000373403.3 alternative 5' UTR ENST00000453095.1 alternative 5' UTR ENST00000279024.4 KIAA1755 ENST00000451435.1 FLJ31292 ENST00000490381.1 bactericidal/permeability-increasing protein ENST00000422519.1 FLJ33613 ENST00000418383.1 novel transcript (LOC128439) ENST00000444816.1 novel transcript (LOC128439) ENST00000453698.1 novel transcript (LOC128439) ENST00000457218.1 novel transcript (LOC128439) ENST00000432153.1 novel transcript (LOC128439) ENST00000359074.4 novel transcript (LOC128439) ENST00000400436.2 novel transcript (FLJ30872) (LOC128439) ENST00000483342.1 novel transcript (LOC128439) ENST00000442419.1 novel transcript (LOC128439) ENST00000434729.1 novel transcript (LOC128439) ENST00000449351.1 novel transcript (LOC128439) ENST00000440918.1 novel transcript (LOC128439) ENST00000437028.1 novel transcript (LOC128439) ENST00000421599.1 novel transcript (LOC128439) ENST00000420006.1 novel transcript (LOC128439) ENST00000397040.1 alternative 5' UTR ENST00000243967.4 contains a RhoGAP domain ENST00000217429.4 FLJ31231 ENST00000252011.3 FLJ22759 ENST00000493450.1 FLJ32148 ENST00000419507.1 autophagy Apg3p/Aut1p-like (APG3) pseudogene ENST00000444436.1 putative protein ENST00000421494.1 heat shock 10 kDa protein 1 (chaperonin 10) pseudogene ENST00000432633.1 putative novel transcript ENST00000445606.1 putative novel transcript ENST00000423153.1 novel transcript ENST00000445278.1 Putative novel transcript ENST00000373261.1 alternative 5' UTR ENST00000436440.1 alternative 5' UTR ENST00000487057.1 triple homeobox 1 ENST00000487057.1 alternative 5' UTR ENST00000455252.1 ribosomal protein L23 (RPL23) pseudogene ENST00000438914.1 SIPL protein (SIPL) pseudogene ENST00000373257.3 lipin 3 (LIPN3L) ENST00000445975.1 lipin 3 (LIPN3L) ENST00000496565.1 lipin 3 (LIPN3L) ENST00000491528.1 lipin 3 (LIPN3L) ENST00000332312.3 DKFZp434A2410 ENST00000440222.1 novel pseudogene ENST00000373233.3 chromodomain helicase DNA binding protein 6 (contains KIAA1335, FLJ34232) ENST00000480022.1 chromodomain helicase DNA binding protein 6 (FLJ40825) ENST00000440697.1 chromodomain helicase DNA binding protein 6 (RIGB) ENST00000476641.1 chromodomain helicase DNA binding protein 6 ENST00000470470.1 chromodomain helicase DNA binding protein 6 ENST00000373222.3 chromodomain helicase DNA binding protein 6 ENST00000482596.1 chromodomain helicase DNA binding protein 6 ENST00000440647.1 chromodomain helicase DNA binding protein 6 ENST00000423903.1 lymphocyte antigen 6 complex, locus H (LY6H) pseudogene ENST00000431589.1 putative novel transcript ENST00000432563.1 neurofilament heavy polypeptide 200kDa (NEFH) pseudogene ENST00000412348.1 Putative novel transcript ENST00000373190.1 protein tyrosine phosphatase, receptor type, T (RPTPRHO, KIAA0283) ENST00000373187.1 protein tyrosine phosphatase, receptor type, T (RPTPRHO, KIAA0283) ENST00000373193.3 protein tyrosine phosphatase, receptor type, T (RPTPRHO, KIAA0283) ENST00000373193.3 non canonical splice acceptor site between exons 1 and 2 ENST00000356100.2 protein tyrosine phosphatase, receptor type, T (RPTPRHO, KIAA0283) ENST00000373198.3 protein tyrosine phosphatase, receptor type, T (RPTPRHO, KIAA0283) ENST00000373198.3 non canonical splice acceptor site between exons 1 and 2 ENST00000373184.1 protein tyrosine phosphatase, receptor type, T (RPTPRHO, KIAA0283) ENST00000373201.1 protein tyrosine phosphatase, receptor type, T (RPTPRHO, KIAA0283) ENST00000485499.1 protein tyrosine phosphatase, receptor type, T (RPTPRHO, KIAA0283) ENST00000446195.1 pseudogene similar to part of ATP5O (ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit (oligomycin sensitivity conferring protein)) ENST00000457704.1 novel transcript ENST00000412519.1 novel transcript ENST00000430025.1 putative novel transcript ENST00000464473.1 peptidylprolyl isomerase A (cyclophilin A) pseudogene ENST00000443304.1 pseudogene similar to part of NBP (nucleotide binding protein) ENST00000450009.1 eukaryotic translation initiation factor 4E binding protein 2 pseudogene ENST00000244020.3 splicing factor, arginine/serine-rich 6 (SRP55-1)(variant 1) ENST00000483871.1 splicing factor, arginine/serine-rich 6 (SRP55-2)(variant 2) ENST00000427442.2 upstream ATG ENST00000427442.2 NP_155479.4 ENST00000439769.1 alternative 5' UTR ENST00000422861.1 KIAA0681 ENST00000373133.1 DKFZp586P1522 ENST00000494117.1 FLJ41181 ENST00000432727.1 HSPC194 pseudogene ENST00000442482.1 putative novel transcript ENST00000373100.1 serum/glucocorticoid regulated kinase 2 ENST00000373100.1 alternatively spliced 5' UTR; shares CDS with dJ138B7.2.1 ENST00000373100.1 alternative 5' UTR ENST00000373092.3 serum/glucocorticoid regulated kinase 2, variant 1 (isoform alpha) ENST00000496343.1 serum/glucocorticoid regulated kinase 2 ENST00000496343.1 non canonical splice acceptor site between exons 13 and 14 ENST00000373077.1 serum/glucocorticoid regulated kinase 2 ENST00000412111.1 serum/glucocorticoid regulated kinase 2 ENST00000341458.4 serum/glucocorticoid regulated kinase 2, variant 2 (isoform beta) ENST00000485914.1 serum/glucocorticoid regulated kinase 2 ENST00000373030.3 chromosome 20 open reading frame 9 (C20orf9)(NGD5, CGI-53) ENST00000373030.3 continued from dJ138B7.1.1 in Em:Z98752 ENST00000373039.4 chromosome 20 open reading frame 9 (C20orf9)(NGD5, CGI-53) ENST00000373039.4 continued from dJ138B7.1.3 in Em:Z98752 ENST00000486243.1 chromosome 20 open reading frame 9 (C20orf9)(NGD5, CGI-53) ENST00000476986.1 chromosome 20 open reading frame 9 (C20orf9)(NGD5, CGI-53) ENST00000467024.1 chromosome 20 open reading frame 9 (C20orf9)(NGD5, CGI-53) ENST00000468420.1 chromosome 20 open reading frame 9 (C20orf9)(NGD5, CGI-53) ENST00000460014.1 chromosome 20 open reading frame 9 (C20orf9)(NGD5, CGI-53) ENST00000461012.1 chromosome 20 open reading frame 9 (C20orf9)(NGD5, CGI-53) ENST00000471199.1 chromosome 20 open reading frame 9 (C20orf9)(NGD5, CGI-53) ENST00000358609.4 RPL27AP (ribosomal protein L27a pseudogene) ENST00000217026.4 v-myb avian myeloblastosis viral oncogene homolog-like 2 ENST00000446932.1 novel transcript ENST00000428529.1 putative novel transcript ENST00000442881.1 novel HMG (high mobility group) box protein similar to KIAA0737, KIAA0808 and TNRC9 (CAGF9) ENST00000442881.1 alternatively spliced in 5' UTR, shares CDS with dJ495O3.1.2 ENST00000442881.1 alternative 5' UTR ENST00000372999.1 novel HMG (high mobility group) box protein similar to KIAA0737, KIAA0808 and TNRC9 (CAGF9) ENST00000358131.5 novel HMG (high mobility group) box protein (FLJ30573) similar to KIAA0737, KIAA0808 and TNRC9 (CAGF9) ENST00000413823.1 novel HMG (high mobility group) box protein similar to KIAA0737, KIAA0808 and TNRC9 (CAGF9) ENST00000413823.1 this variant and variant fragment .2.3 could be part of one single variant ENST00000372980.3 junctophilin 2 (JPH2)(JP2, JP-2) ENST00000342272.3 junctophilin 2 (JPH2)(JP2, JP-2) ENST00000255174.2 novel protein ENST00000372970.1 novel protein ENST00000342560.5 ganglioside-induced differentiation-associated protein 1-like 1 (FLJ31689) ENST00000438466.1 ganglioside-induced differentiation-associated protein 1-like 1 ENST00000372952.3 ganglioside-induced differentiation-associated protein 1-like 1 ENST00000445952.1 ganglioside-induced differentiation-associated protein 1-like 1 ENST00000447658.1 ganglioside-induced differentiation-associated protein 1-like 1 ENST00000217043.2 R3HDML domain (binds single-stranded nucleic acids) containing-like (similar to trypsin inhibitor proteins) ENST00000438702.1 novel transcript ENST00000430481.1 novel transcript ENST00000316673.4 hepatocyte nuclear factor 4, alpha (TCF, MODY1, NR2A1, TCF14, NR2A21) ENST00000372920.1 hepatocyte nuclear factor 4, alpha (TCF, MODY1, NR2A1, TCF14, NR2A21) ENST00000316099.3 hepatocyte nuclear factor 4, alpha (TCF, MODY1, NR2A1, TCF14, NR2A21) ENST00000443598.2 hepatocyte nuclear factor 4, alpha (TCF, MODY1, NR2A1, TCF14, NR2A21) ENST00000452481.1 novel transcript ENST00000455642.1 putative novel transcript ENST00000262605.4 alternative 5' UTR ENST00000372904.3 FLJ31616 ENST00000461134.1 FLJ43136 ENST00000411544.1 alternative 3' UTR ENST00000372892.3 alternative 5' UTR ENST00000372891.3 alternative 5' UTR ENST00000372889.1 alternative 5' UTR ENST00000372886.1 alternative 5' UTR ENST00000349959.3 alternative 5' UTR ENST00000464097.1 DKFZp6667G2419 ENST00000372868.2 alternative 5' UTR ENST00000497421.1 FLJ90214 ENST00000471629.1 FLJ26149 ENST00000372851.3 FLJ44857, DKFZp686D0748 ENST00000353703.4 alternative 5' UTR ENST00000428262.1 alternative 5' UTR ENST00000445830.1 alternative 5' UTR ENST00000490798.1 novel transcript ENST00000476056.1 novel transcript ENST00000372819.1 FLJ23107 ENST00000478877.1 novel transcript ENST00000465761.1 novel transcript ENST00000474208.1 novel transcript ENST00000489068.1 novel transcript ENST00000482486.1 novel transcript ENST00000372813.3 FLJ20587 ENST00000434401.1 FLJ32636 ENST00000445571.1 non-canonical splice site between exons 2 and 3 ENST00000372756.1 matrilin 4, variant 1 (contains FLJ14417) ENST00000372754.1 matrilin 4, variant 2 (contains FLJ14417) ENST00000372753.1 matrillin 4, variant 3 (contains FLJ14417) ENST00000372743.1 recombining binding protein suppressor of hairless (Drosophila)-like ENST00000372741.3 recombining binding protein suppressor of hairless (Drosophila)-like ENST00000372741.3 the CDS of this variant differs from that of mRNAs Em:AB026048 and Em:AB024964 on which it was based ENST00000343694.3 recombining binding protein suppressor of hairless (Drosophila)-like ENST00000464504.1 recombining binding protein suppressor of hairless (Drosophila)-like ENST00000372733.3 syndecan 4 (amphiglycan, ryudocan) ENST00000372727.1 alternative 5' UTR ENST00000453003.1 alternative 5' UTR ENST00000419593.1 subject to nonsense-mediated decay ENST00000458187.1 subject to nonsense-mediated decay ENST00000452133.1 subject to nonsense-mediated decay ENST00000452541.1 NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15 kDa (NDUFB4) pseudogene ENST00000372723.3 alternative 5' UTR ENST00000372722.3 NP_001041691.1 ENST00000357275.2 alternative 5' UTR ENST00000372712.2 alternative 5' UTR ENST00000429598.1 ribosomal protein L5 pseudogene 2 ENST00000496898.1 FLJ44034 ENST00000356562.2 alternative 5' UTR ENST00000440968.1 heterogenous nuclear ribonucleoprotein A1 pseudogene 3 ENST00000466252.1 chromosome 20 open reading frame 161 ENST00000486165.1 novel protein ENST00000457981.1 novel protein ENST00000426915.1 novel protein ENST00000372519.3 chromosome 20 open reading frame 165 ENST00000419493.1 alternative 5' UTR ENST00000372459.1 alternative 5' UTR ENST00000484855.1 protective protein for beta-galactosidase (galactosialidosis) (GSL, CTSA, GLB2, NGBE, PPCA) ENST00000372420.1 Phospholipid Transfer Protein (Lipid Transfer Protein II) (variant 2) ENST00000477313.1 alternative 5' UTR ENST00000372409.3 novel protein similar to Drosophila CG11399 ENST00000479348.1 novel transcript ENST00000322927.2 Zinc finger protein 335 ENST00000475002.1 Zinc finger protein 335 ENST00000476822.1 Zinc finger protein 335 ENST00000494955.1 Zinc finger protein 335 ENST00000449155.1 ferritin, light polypeptide pseudogene ENST00000372330.3 matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase) (CLG4B) ENST00000419897.1 Putative novel transcipt ENST00000428198.1 putative novel transcript ENST00000413737.1 putative novel transcript ENST00000290231.6 nuclear receptor coactivator 5 (KIAA1637) ENST00000372291.3 nuclear receptor coactivator 5 ENST00000440687.1 ribosomal protein L13 pseudogene 2 ENST00000372285.3 tumor necrosis factor receptor superfamily, member 5 ENST00000372276.3 tumor necrosis factor receptor superfamily, member 5 ENST00000466205.1 tumor necrosis factor receptor superfamily, member 5 ENST00000489304.1 tumor necrosis factor receptor superfamily, member 5 ENST00000477696.1 tumor necrosis factor receptor superfamily, member 5 ENST00000461171.1 tumor necrosis factor receptor superfamily, member 5 ENST00000450586.1 putative novel transcript ENST00000372262.3 cadherin-like 22 ENST00000474438.1 cadherin-like 22 ENST00000317734.8 ovarian cancer overexpressed 1 ENST00000243896.2 ovarian cancer overexpressed 1 ENST00000243896.2 alternatively spliced in 5' UTR, shares CDS with bA394O2.1.1 ENST00000243896.2 alternative 5' UTR ENST00000372227.1 ovarian cancer overexpressed 1 ENST00000372227.1 alternatively spliced in 5' UTR, shares CDS with bA394O2.1.1 ENST00000372227.1 alternative 5' UTR ENST00000493599.1 ovarian cancer overexpressed 1 (FLJ37039) ENST00000372229.1 ovarian cancer overexpressed 1 ENST00000372229.1 non-canonical splice donor site between exons 2 and 3 ENST00000372230.5 ovarian cancer overexpressed 1 (CGI-15) ENST00000480329.1 ovarian cancer overexpressed 1 ENST00000487729.1 ovarian cancer overexpressed 1 ENST00000484318.1 ovarian cancer overexpressed 1 ENST00000481809.1 ovarian cancer overexpressed 1 ENST00000420518.1 ovarian cancer overexpressed 1 ENST00000424568.1 ovarian cancer overexpressed 1 ENST00000484188.1 this variant and either of variant fragments .1.11 or .1.10 could be part of one single variant ENST00000484188.1 ovarian cancer overexpressed 1 ENST00000290246.6 engulfment and cell motility 2 (ced-12 homolog, C. elegans) (CED12) (KIAA1834) ENST00000372176.1 engulfment and cell motility 2 (ced-12 homolog, C. elegans) (CED12) ENST00000467800.1 engulfment and cell motility 2 (ced-12 homolog, C. elegans (CED12) (DKFZp761J1417) ENST00000452857.1 engulfment and cell motility 2 (ced-12 homolog, C. elegans (CED12) ENST00000461126.1 engulfment and cell motility 2 (ced-12 homolog, C. elegans (CED12) (FLJ11656) ENST00000352077.2 engulfment and cell motility 2 (ced-12 homolog, C. elegans (CED12) ENST00000464448.1 engulfment and cell motility 2 (ced-12 homolog, C. elegans (CED12) ENST00000425546.1 engulfment and cell motility 2 (ced-12 homolog, C. elegans (CED12) ENST00000462491.1 engulfment and cell motility 2 (ced-12 homolog, C. elegans) (CED12) ENST00000481852.1 engulfment and cell motility 2 (ced-12 homolog, C. elegans (CED12) ENST00000488853.1 engulfment and cell motility 2 (ced-12 homolog, C. elegans) (CED12) ENST00000450812.1 engulfment and cell motility 2 (ced-12 homolog, C. elegans) (CED12) (FLJ32470) ENST00000480042.1 engulfment and cell motility 2 (ced-12 homolog, C. elegans (CED12) ENST00000469801.1 engulfment and cell motility 2 (ced-12 homolog, C. elegans) (CED12) ENST00000460474.1 engulfment and cell motility 2 (ced-12 homolog, C. elegans (CED12) ENST00000497412.1 engulfment and cell motility 2 (ced-12 homolog, C. elegans) (CED12) ENST00000487583.1 engulfment and cell motility 2 (ced-12 homolog, C. elegans) (CED12) ENST00000462593.1 engulfment and cell motility 2 (ced-12 homolog, C. elegans) (CED12) ENST00000472805.1 Krueppel type zinc-finger protein pseudogene ENST00000400371.2 novel transcript (DKFZp547G0215) ENST00000433469.1 Makorin (MKRN1 or MKRN3) ring finger protein pseudogene ENST00000433469.1 contains Zinc finger C-x8-C-x5-C-x3-H type (and similar) domains ENST00000347606.4 novel zinc finger protein ENST00000279028.2 novel protein ENST00000279028.2 RP23-395E18.4 in mouse ENST00000279027.4 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 (NADC3, SDCT2) ENST00000468915.1 alternative 5' UTR ENST00000464518.1 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 (NADC3, SDCT2) ENST00000450298.1 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 (NADC3, SDCT2) ENST00000420568.1 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 (NADC3, SDCT2) ENST00000417157.2 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 (NADC3, SDCT2) ENST00000372114.3 chromosome 20 open reading frame 64 (Nori-2p, dJ28H20.2) (C20orf64)(PRPK, Nori-2, dJ101A2.2) ENST00000372102.3 chromosome 20 open reading frame 64 (Nori-2p, dJ28H20.2) (C20orf64)(PRPK, Nori-2, dJ101A2.2) ENST00000359271.2 solute carrier family 2 (facilitated glucose transporter), member 10 ENST00000423396.1 RPL13 (ribosomal protein L13) pseudogene ENST00000327619.5 eyes absent homolog 2 (Drosophila) (EYA2) ENST00000497062.1 eyes absent homolog 2 (Drosophila) (EYA2) ENST00000497428.1 eyes absent homolog 2 (Drosophila) (EYA2) ENST00000479843.1 eyes absent homolog 2 (Drosophila) (EYA2) ENST00000471081.1 eyes absent homolog 2 (Drosophila) (EYA2) ENST00000458636.1 eyes absent homolog 2 (Drosophila) (EYA2) ENST00000475856.1 eyes absent homolog 2 (Drosophila) (EYA2) ENST00000414085.1 novel transcript ENST00000432657.1 glyceraldehyde 3-phosphate dehydrogenase (GAPD) pseudogene ENST00000429337.1 RPL27A (ribosomal protein L27A) pseudogene ENST00000400363.2 ribosomal protein S2 (RPS2) pseudogene ENST00000311275.7 KIAA1125 ENST00000468376.1 DKFZp564P1772 ENST00000435836.1 protein kinase C binding protein 1, variant 4 (alternative 5' UTR) ENST00000446894.1 protein kinase C binding protein 1, variant 6 (alternative 5' UTR) ENST00000441977.1 protein kinase C binding protein 1 ENST00000413818.2 putative novel transcript ENST00000437920.1 novel transcript ENST00000425552.1 ribosomal protein L35a pseudogene ENST00000372004.1 nuclear receptor coactivator 3 (ACTR, AIB1, RAC3, CTG26, p/CIP, CAGH16, TNRC14, TNRC16, TRAM-1) ENST00000371998.3 nuclear receptor coactivator 3 (ACTR, AIB1, RAC3, CTG26, p/CIP, CAGH16, TNRC14, TNRC16, TRAM-1) ENST00000371997.3 nuclear receptor coactivator 3 (ACTR, AIB1, RAC3, CTG26, p/CIP, CAGH16, TNRC14, TNRC16, TRAM-1) ENST00000490248.1 nuclear receptor coactivator 3 (ACTR, AIB1, RAC3, CTG26, p/CIP, CAGH16, TNRC14, TNRC16, TRAM-1) ENST00000497292.1 nuclear receptor coactivator 3 (ACTR, AIB1, RAC3, CTG26, p/CIP, CAGH16, TNRC14, TNRC16, TRAM-1) ENST00000448675.1 ribosomal protein S3A (RPS3A) pseudogene ENST00000484875.1 alternative 5' UTR ENST00000437955.1 alternative 5' UTR ENST00000398959.2 spermidine synthase pseudogene 1 ENST00000431915.1 putative novel transcript ENST00000416646.1 putative novel transcript ENST00000428999.1 putative novel transcript ENST00000425385.1 putative novel transcript ENST00000420477.1 novel transcript (LOC284749) ENST00000416742.1 novel transcript (LOC284749) ENST00000425021.1 novel transcript (LOC284749) ENST00000433094.1 novel transcript (DKFZp667F0617) (LOC284749) ENST00000451572.1 putative novel transcript ENST00000446280.1 putative novel transcript ENST00000457536.1 putative novel transcript ENST00000371941.3 P-Rex1 (PREX1, KIAA1415) ENST00000371941.3 P-Rex1 (PREX1, KIAA1415), variant 1 (contains DKFZp762C0215 and DKFZp761D0724) ENST00000482556.1 P-Rex1 (PREX1) ENST00000496915.1 novel transcript ENST00000371917.4 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) ENST00000493140.1 ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited) ENST00000433229.1 synaptosomal-associated protein, 23 kDa pseudogene ENST00000417781.1 putative novel transcript ENST00000428190.1 putative novel transcript ENST00000371856.2 staufen, RNA binding protein (Drosophila) (variant b) ENST00000360426.4 alternatively spliced 5' UTR; shares CDS with dJ470L14.2.3 and dJ470L14.2.4 ENST00000360426.4 staufen, RNA binding protein (Drosophila) (variant a) ENST00000360426.4 alternative 5' UTR ENST00000347458.5 alternatively spliced 5' UTR; shares CDS with dJ470L14.2.2 and dJ470L14.2.4 ENST00000347458.5 alternative 5' UTR ENST00000347458.5 staufen, RNA-binding protein (Drosophila) (variant a) ENST00000371805.1 alternatively spliced 5' UTR; shares CDS with dJ470L14.2.2 and dJ470L14.2.3 ENST00000371805.1 staufen, RNA binding protein (Drosophila) (variant a) ENST00000371805.1 alternative 5' UTR ENST00000371802.1 staufen, RNA binding protein (Drosophila) ENST00000371792.1 staufen, RNA binding protein (Drosophila) ENST00000437404.1 alternatively spliced 5' UTR; shares partial CDS with dJ470L14.2.6 ENST00000437404.1 alternative 5' UTR ENST00000437404.1 staufen, RNA binding protein (Drosophila) ENST00000456866.1 staufen, RNA binding protein (Drosophila) ENST00000371754.4 FLJ39275 ENST00000371752.1 FLJ13774 ENST00000371744.1 alternative 5' UTR ENST00000371744.1 FLJ11277 ENST00000455070.1 FLJ12579 ENST00000484427.1 DKFZp686H1510 ENST00000471144.1 FLJ45185, DKFZp667N057 ENST00000326677.5 putative novel transcript ENST00000244043.3 prostaglandin I2 (prostacyclin) synthase ENST00000361573.2 AT-AC splicing between exons 9 and 10 ENST00000361573.2 KIAA0939, DKFZp686D0256 ENST00000490250.1 FLJ42500 ENST00000289431.5 spermatogenesis associated protein 2, PD1 (KIAA0757) ENST00000244061.2 zinc finger protein 313 ENST00000244061.2 supported by FGENES and GENSCAN ENST00000422599.1 keratin 18 pseudogene 4 ENST00000244050.2 snail 1 (drosophila homolog), zinc finger protein ENST00000431460.1 putative novel transcript ENST00000396059.3 DKFZp686G1080, DKFZp686I21199 ENST00000340309.3 alternative 5' UTR ENST00000435301.1 putative novel transcript ENST00000435301.1 Could link to .2, but an exact structure is not known at this time. ENST00000444478.1 putative novel transcript ENST00000451960.1 putative novel transcript ENST00000411453.1 Variant 1 ENST00000411453.1 novel putative transcript ENST00000427333.1 Variant 2 ENST00000425497.1 novel transcript ENST00000445003.1 novel transcript ENST00000422459.1 novel transcript ENST00000421019.1 novel transcript ENST00000371639.3 ambiguous CDS ENST00000371639.3 novel transcript (FLJ33286) (LOC284751) ENST00000457853.1 novel transcript (LOC284751) ENST00000441214.1 novel transcript ENST00000431019.1 FLJ43874 ENST00000462493.1 FLJ32230 ENST00000358791.5 FLJ20495 ENST00000371602.2 alternative 5' UTR ENST00000349014.3 alternative 5' UTR ENST00000396032.2 alternative 5' UTR ENST00000534467.1 alternative 5' UTR ENST00000371571.4 alternative 5' UTR ENST00000439216.1 alternative 5' UTR ENST00000433903.1 alternative 5' UTR ENST00000447736.1 alternative 5' UTR ENST00000506387.1 FLJ46888 ENST00000338821.5 FLJ23963 ENST00000438154.1 FLJ38966 ENST00000371523.4 FLJ12628 ENST00000216923.4 FLJ10734 ENST00000346617.4 FLJ10882 ENST00000436286.2 FLJ31870 ENST00000424252.1 FLJ14031 ENST00000431687.1 alternative 5' UTR ENST00000448484.1 DKFZp686B1850 ENST00000433766.1 FLJ31488 ENST00000395915.3 alternative 5' UTR ENST00000312783.6 alternative 5' UTR ENST00000371356.2 alternative 5' UTR ENST00000395913.3 alternative 5' UTR ENST00000441357.1 alternative 5' UTR ENST00000420474.1 alternative 5' UTR ENST00000422322.1 alternative 5' UTR ENST00000456249.1 alternative 5' UTR ENST00000451915.1 alternative 5' UTR ENST00000415828.1 alternative 5' UTR ENST00000428552.1 alternative 5' UTR ENST00000452950.1 alternative 5' UTR ENST00000434344.1 FLJ14854 ENST00000023939.4 FLJ20474 ENST00000243913.4 FLJ16060 ENST00000437350.1 this gene fragment and gene fragment RP5-843L14.3-001 are part of the same gene; the exact exon structure linking the fragments remains to be determined ENST00000434176.1 this gene fragment and gene fragment RP5-843L14.1-001 are part of the same gene; the exact exon structure linking the fragments remains to be determined ENST00000442780.1 non-canonical splice acceptor site between exons 1 and 2 ENST00000445956.1 putative novel transcript ENST00000371242.2 alternative 5' UTR ENST00000411894.1 alternative 5' UTR ENST00000429339.1 alternative 5' UTR ENST00000395840.2 alternative 5' UTR ENST00000452119.1 alternative 5' UTR ENST00000462438.1 FLJ44036 ENST00000417346.1 FLJ39107 ENST00000344785.6 ssDNA binding protein SEB4D (HSRNASEB) ENST00000371219.2 alternative 5' UTR ENST00000467047.1 DKFZp779F2021 ENST00000395822.3 FLJ16296 ENST00000461547.1 FLJ46548 ENST00000395816.3 alternative 5' UTR ENST00000371169.1 FLJ46124 ENST00000493688.1 FLJ33021 ENST00000495058.1 DKFZp313O0420 ENST00000244040.3 FLJ30205, FLJ33861 ENST00000475243.1 FLJ13179 ENST00000265619.2 FLJ45319 ENST00000463370.1 FLJ41544 ENST00000476395.1 FLJ46565 ENST00000371149.3 FLJ90166 ENST00000427140.1 FLJ30075 ENST00000447767.1 FLJ34385 ENST00000355957.5 NP_001128245.1 ENST00000358029.4 NP_001128244.1 ENST00000468590.1 not organism-supported ENST00000530122.1 subject to nonsense-mediated decay ENST00000356091.6 FLJ11583 ENST00000416241.1 pseudogene similar to KIAA0233 ENST00000424094.1 SANG (GNAS antisense transcript) ENST00000313949.7 NESP55 ENST00000313949.7 NMD exception ENST00000371098.2 NESP55 ENST00000371098.2 NMD exception ENST00000371075.3 NESP55 ENST00000371075.3 NMD exception ENST00000371075.3 /gt tg\ splicing between exons 3 and 4 ENST00000453292.1 NESP55 ENST00000453292.1 /gt tg\ splicing between exons 2 and 3 ENST00000453292.1 NMD exception ENST00000419558.1 NESP55 ENST00000419558.1 NMD exception ENST00000462499.1 /gt tg\ splicing between exons 2 and 3 ENST00000490374.1 /gt tg\ splicing between exons 3 and 4 ENST00000467227.1 /gt tg\ splicing between exons 3 and 4 ENST00000371099.2 XLb1 ENST00000371100.3 XL-alpha-s ENST00000371102.4 XL-alpha-s ENST00000371102.4 /gt tg\ splicing between exons 2 and 3 ENST00000464624.1 XLb2 ENST00000306120.3 ALEX ENST00000450130.1 XL-alpha-s ENST00000349036.3 XL-alpha-s ENST00000349036.3 /gt tg\ splicing between exons 3 and 4 ENST00000488546.1 /gt tg\ splicing between exons 2 and 3 ENST00000468895.1 /gt tg\ splicing between exons 2 and 3 ENST00000485673.1 /gt tg\ splicing between exons 2 and 3 ENST00000470512.1 /gt tg\ splicing between exons 3 and 4 ENST00000478585.1 /gt tg\ splicing between exons 2 and 3 ENST00000480232.1 /gt tg\ splicing between exons 4 and 5 ENST00000484504.1 GNAS complex locus novel transcript ENST00000461152.1 /gt tg\ splicing between exons 2 and 3 ENST00000371095.3 /gt tg\ splicing between exons 2 and 3 ENST00000371095.3 alpha-s-1 ENST00000371085.3 alpha-s-1 ENST00000371085.3 FLJ22911 ENST00000354359.7 /gt tg\ splicing between exons 3 and 4 ENST00000354359.7 alpha-s-1 ENST00000265620.7 alpha-s-1 ENST00000492907.1 /gt tg\ splicing between exons 2 and 3 ENST00000487862.1 /gt tg\ splicing between exons 1 and 2 ENST00000487862.1 FLJ36215 ENST00000496934.1 FLJ30300 ENST00000476196.1 FLJ16311 ENST00000344018.2 FLJ13865 ENST00000460601.1 alternative 3' UTR ENST00000478389.1 FLJ45523 ENST00000243997.3 FLJ22903 ENST00000371030.2 DKFZp667G1522 ENST00000359926.3 FLJ25922 ENST00000434923.1 alternative 5' UTR ENST00000371015.1 FLJ34313 ENST00000473657.1 FLJ33493 ENST00000357552.2 /at-ac\ splicing between exons 5 and 6 ENST00000357552.2 DKFZp686I1629, DKFZp68601832 ENST00000446834.1 /at-ac\ splicing between exons 5 and 6 ENST00000476314.1 /at-ac\ splicing between exons 2 and 3 ENST00000425931.1 /at-ac\ splicing between exons 4 and 5 ENST00000358293.3 FLJ43083 ENST00000360816.3 alternative 5' UTR ENST00000421092.1 alternative 5' UTR ENST00000350849.6 FLJ23897 ENST00000313426.1 novel protein (FLJ33860) ENST00000432910.1 novel transcript (FLJ35486) (LOC284757) ENST00000458422.1 novel transcript (LOC284757) ENST00000437035.1 novel transcript (LOC284757) ENST00000421257.1 novel transcript (LOC284757) ENST00000426753.1 novel transcript (LOC284757) ENST00000427691.1 novel transcript (LOC284757) ENST00000431181.1 novel transcript (LOC284757) ENST00000431181.1 novel transcript ENST00000428772.1 novel transcript (LOC284757) ENST00000439507.1 novel transcript (LOC284757) ENST00000457508.1 novel transcript (LOC284757) ENST00000427820.1 novel transcript (LOC284757) ENST00000424648.1 cytochrome c oxidase II-like (pseudogene) ENST00000443366.1 putative novel transcript ENST00000420710.1 putative novel transcript ENST00000441660.1 putative novel transcript ENST00000360469.4 retinal cadherin 4 type 1 (R-cadherin) ENST00000360469.4 cadherin 4, type 1, R-cadherin (retinal) ENST00000317652.1 novel protein (FLJ40547) ENST00000442888.1 putative novel transcript ENST00000447909.1 exon 1 from dotter alignment ENST00000447909.1 putative novel transcript ENST00000447909.1 drawn to PmeI vectorette bubble site at 3' end ENST00000474089.1 TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135 kDa (TAF2C, TAF4A, TAF2C1, TAFII130, TAFII135) ENST00000252996.3 TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135 kDa (TAF2C, TAF4A, TAF2C1, TAFII130, TAFII135) ENST00000436129.1 non canonical splice acceptor site between exons 2 and 3 ENST00000436129.1 TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135 kDa (TAF2C, TAF4A, TAF2C1, TAFII130, TAFII135) ENST00000488539.1 TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135 kDa (TAF2C, TAF4A, TAF2C1, TAFII130, TAFII135) ENST00000479744.1 TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135 kDa (TAF2C, TAF4A, TAF2C1, TAFII130, TAFII135) ENST00000486599.1 TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135 kDa (TAF2C, TAF4A, TAF2C1, TAFII130, TAFII135) ENST00000442115.1 RPL17 (ribosomal protein L17) pseudogene ENST00000370915.1 chromosome 20 open reading frame 40 (similar to Pleurodeles waltlii RAP55 protein) ENST00000400318.2 chromosome 20 open reading frame 40 (similar to Pleurodeles waltlii RAP55 protein) ENST00000479741.1 chromosome 20 open reading frame 40 (FT005) (similar to Pleurodeles waltlii RAP55 protein) ENST00000279069.7 chromosome 20 open reading frame 40 (similar to Pleurodeles waltlii RAP55 protein) ENST00000370906.1 chromosome 20 open reading frame 40 (FLJ25473) ENST00000361670.3 chromosome 20 open reading frame 40 ENST00000370873.4 proteasome (prosome, macropain) subunit, alpha type, 7, (C6, HSPC, RC6-1, XAPC7, MGC3755) ENST00000442551.1 proteasome (prosome, macropain) subunit, alpha type, 7, (C6, HSPC, RC6-1, XAPC7, MGC3755) ENST00000484488.1 proteasome (prosome, macropain) subunit, alpha type, 7, (C6, HSPC, RC6-1, XAPC7, MGC3755) ENST00000370861.1 proteasome (prosome, macropain) subunit, alpha type, 7, (C6, HSPC, RC6-1, XAPC7, MGC3755) ENST00000486193.1 proteasome (prosome, macropain) subunit, alpha type, 7, (C6, HSPC, RC6-1, XAPC7, MGC3755) ENST00000370858.3 proteasome (prosome, macropain) subunit, alpha type, 7, (C6, HSPC, RC6-1, XAPC7, MGC3755) ENST00000331758.3 synovial sarcoma translocation gene on chromosome 18-like 1 (KIAA0693) ENST00000450482.1 this variant and either of variant fragments .3.3 and .3.4 could be part of one single variant ENST00000450482.1 synovial sarcoma translocation gene on chromosome 18-like 1 ENST00000491916.1 this variant and variant fragment .3.2 could be part of one single variant ENST00000491916.1 synovial sarcoma translocation gene on chromosome 18-like 1 ENST00000492466.1 this variant and variant fragment .3.2 could be part of one single variant ENST00000492466.1 synovial sarcoma translocation gene on chromosome 18-like 1 ENST00000466933.1 GTP binding protein 5 (putative) (GTPBP5)(FLJ10741, DKFZP434C0935) ENST00000471352.1 GTP binding protein 5 (putative) (GTPBP5)(FLJ10741, DKFZP434C0935) ENST00000467101.1 GTP binding protein 5 (putative) (GTPBP5)(FLJ10741, DKFZP434C0935) ENST00000370823.3 GTP binding protein 5 (putative) (GTPBP5)(FLJ10741, DKFZP434C0935) ENST00000448254.1 GTP binding protein 5 (putative) (GTPBP5)(FLJ10741, DKFZP434C0935) ENST00000472005.1 GTP binding protein 5 (putative) (GTPBP5)(FLJ10741, DKFZP434C0935) ENST00000466099.1 GTP binding protein 5 (putative) (GTPBP5)(FLJ10741, DKFZP434C0935) ENST00000461411.1 GTP binding protein 5 (putative) (GTPBP5)(FLJ10741, DKFZP434C0935) ENST00000471962.1 GTP binding protein 5 (putative) (GTPBP5)(FLJ10741, DKFZP434C0935) ENST00000472790.1 GTP binding protein 5 (putative) (GTPBP5)(FLJ10741, DKFZP434C0935) ENST00000488748.1 GTP binding protein 5 (putative) (GTPBP5)(FLJ10741, DKFZP434C0935) ENST00000340177.5 histamine receptor H3 ENST00000358053.2 similar to oxysterol-binding protein ENST00000358053.2 KIAA0772 ENST00000313733.3 similar to oxysterol-binding protein ENST00000313733.3 KIAA0772 ENST00000448156.1 similar to oxysterol-binding protein ENST00000448156.1 KIAA0772 ENST00000471817.1 similar to oxysterol-binding protein ENST00000471817.1 KIAA0772 ENST00000253003.2 cell membrane glycoprotein (surface antigen), 110000 M(r) (GP110) ENST00000414042.1 putative novel transcript ENST00000448371.1 putative novel transcript ENST00000252999.3 KIAA0533 ENST00000252999.3 laminin alpha 5 ENST00000370677.3 laminin alpha 5 ENST00000456721.1 putative novel transcript ENST00000317311.5 ribosomal protein S21 ENST00000370592.1 ribosomal protein S21 ENST00000492356.1 ribosomal protein S21 ENST00000370562.1 ribosomal protein S21 ENST00000252998.1 chromosome 20 open reading frame 151 (FLJ90438) (weakly similar to retinoblastoma binding protein 8 (RBBP8)) ENST00000433121.1 novel transcript ENST00000370545.1 GATA binding protein 5 ENST00000497276.1 GATA binding protein 5 ENST00000412495.1 novel transcript (FLJ31984) ENST00000475015.1 novel transcript (FLJ30313) ENST00000436101.1 novel transcript ENST00000370527.3 chromosome 20 open reading frame 166 ENST00000370523.1 chromosome 20 open reading frame 166 ENST00000441388.1 ribosomal protein L7 pseudogene 3 ENST00000427132.1 novel transcript ENST00000418953.1 putative novel transcript ENST00000370520.3 novel protein (FLJ32154) ENST00000497209.1 solute carrier family 21 (organic anion transporter) member 12 (SLC21A12) ENST00000370507.1 solute carrier family 21 (organic anion transporter) member 12 (SLC21A12) ENST00000470412.1 solute carrier family 21 (organic anion transporter) member 12 (SLC21A12) ENST00000495889.1 solute carrier family 21 (organic anion transporter) member 12 (SLC21A12) ENST00000466961.1 solute carrier family 21 (organic anion transporter) member 12 (SLC21A12) ENST00000451793.1 solute carrier family 21 (organic anion transporter) member 12 (SLC21A12) ENST00000497919.1 solute carrier family 21 (organic anion transporter) member 12 (SLC21A12) ENST00000466818.1 solute carrier family 21 (organic anion transporter) member 12 (SLC21A12) ENST00000451648.1 novel transcript ENST00000411824.1 novel transcript ENST00000433126.1 novel transcript ENST00000435412.1 originally annotated as C20orf90 ENST00000370501.3 neurotensin receptor 1 (high affinity) ENST00000482259.1 neurotensin receptor 1 (high affinity) ENST00000430184.1 putative novel transcript ENST00000412500.1 putative novel transcript ENST00000370487.3 chromosome 20 open reading frame 20 (similar to D. melanogaster CG13746) ENST00000431361.1 novel transcript ENST00000290291.6 opioid growth factor receptor (7-60 protein), variant 1 (FLJ12172) ENST00000370468.3 opioid growth factor receptor (7-60 protein) ENST00000370468.3 non canonical splice acceptor site between exons 7 and 8 ENST00000370461.1 opioid growth factor receptor (7-60 protein), variant 2 (FLJ00084) ENST00000450048.1 opioid growth factor receptor (7-60 protein) ENST00000430209.1 ADP-ribosylation factor 4 pseudogene 2 ENST00000395343.1 DKFZp434P1115 ENST00000395340.1 KIAA0333 ENST00000370371.4 FLJ11265 ENST00000370368.1 alternative 5' UTR ENST00000354665.4 alternative 5' UTR ENST00000497101.1 UTR of a novel protein (FLJ20602) ENST00000370351.4 found in lymphoblastic leukemia ENST00000370351.4 chromosome 20 open reading frame 59 ENST00000370349.3 chromosome 20 open reading frame 59 ENST00000488738.1 chromosome 20 open reading frame 59 (FLJ00178) ENST00000411611.1 chromosome 20 open reading frame 59 ENST00000459704.1 chromosome 20 open reading frame 59 ENST00000487303.1 chromosome 20 open reading frame 59 ENST00000483113.1 chromosome 20 open reading frame 59 ENST00000370341.3 DKFZp434E222 ENST00000455711.1 novel transcript ENST00000370283.4 FLJ10767 ENST00000523114.1 alternative 5' UTR ENST00000547204.1 upstream ATG ENST00000549047.1 upstream ATG ENST00000518601.2 upstream ATG ENST00000522403.2 alternative 5' UTR ENST00000550188.1 alternative 5' UTR ENST00000358894.6 NP_065933 ENST00000422202.1 KIAA1510 ENST00000415763.1 KIAA1510 ENST00000471582.1 DKFZp547J124 ENST00000494913.1 FLJ25836 ENST00000475033.1 FLJ43386 ENST00000428531.1 novel transcript ENST00000357249.2 potassium voltage-gated channel, KQT-like subfamily, member 2 (EBN, BFNC, EBN1, ENB1) ENST00000359125.2 potassium voltage-gated channel, KQT-like subfamily, member 2 (EBN, BFNC, EBN1, ENB1) ENST00000370226.1 potassium voltage-gated channel, KQT-like subfamily, member 2 (EBN, BFNC, EBN1, ENB1) ENST00000344462.3 potassium voltage-gated channel, KQT-like subfamily, member 2 (EBN, BFNC, EBN1, ENB1) ENST00000370224.1 potassium voltage-gated channel, KQT-like subfamily, member 2 (EBN, BFNC, EBN1, ENB1) ENST00000370222.3 potassium voltage-gated channel, KQT-like subfamily, member 2 (EBN, BFNC, EBN1, ENB1) ENST00000370221.1 potassium voltage-gated channel, KQT-like subfamily, member 2 (EBN, BFNC, EBN1, ENB1) ENST00000482957.1 potassium voltage-gated channel, KQT-like subfamily, member 2 (EBN, BFNC, EBN1, ENB1) ENST00000344425.5 potassium voltage-gated channel, KQT-like subfamily, member 2 (EBN, BFNC, EBN1, ENB1) ENST00000436263.1 putative novel transcript ENST00000298049.7 eukaryotic translation elongation factor 1 alpha 2 ENST00000458368.1 putative novel transcript ENST00000370179.3 chromosome 20 open reading frame 149 (FLJ21046) ENST00000464438.1 chromosome 20 open reading frame 149 ENST00000370178.1 chromosome 20 open reading frame 149 ENST00000370178.1 non-canonical splice acceptor site between exons 4 and 5 ENST00000370177.1 chromosome 20 open reading frame 149 ENST00000473620.1 chromosome 20 open reading frame 149 ENST00000217185.2 tyrosine kinase ENST00000217188.1 novel tyrosine kinase ENST00000370098.3 novel protein MGC5356 ENST00000370097.1 novel protein MGC5356 ENST00000370097.1 alternatively spliced in 5' UTR, shares CDS with dJ697K14.10.1 ENST00000370097.1 alternative 5' UTR ENST00000427522.2 peroxisomal proliferator-activated receptor A interacting complex 285 (PRIC285)(FLJ00244, KIAA1769) ENST00000478861.1 peroxisomal proliferator-activated receptor A interacting complex 285 (PRIC285)(FLJ00244, KIAA1769) ENST00000479540.1 novel protein (LOC200213) ENST00000370082.1 novel protein (LOC200213) ENST00000454223.1 putative novel transcript ENST00000266068.1 glucocorticoid modulatory element binding protein 2 ENST00000266068.1 glucocorticoid modulary element binding protein 2 ENST00000370069.1 glucocorticoid modulatory element binding protein 2 (DFKZp434F097) ENST00000370077.1 glucocorticoid modulatory element binding protein 2 (KIAA1269) ENST00000370077.1 alternatively spliced in 5' UTR, shares CDS with bK3184A7.1.1 ENST00000370077.1 alternative 5' UTR ENST00000449500.1 putative novel transcript ENST00000411579.1 putative novel transcript ENST00000370053.1 SCG10-like protein (SCLIP) (ortholog of rabbit neuroplasticin-2 (NPC2)) ENST00000370018.3 non canonical splice donor site between exons 32 and 33 ENST00000360203.5 not organism-supported ENST00000492259.2 subject to nonsense-mediated decay ENST00000482936.1 subject to nonsense-mediated decay ENST00000369996.1 tumor necrosis factor receptor superfamily, member 6b, decoy, (isoform d, M68E) ENST00000485858.1 ADP-ribosylation factor related protein 1 ENST00000217224.5 ADP-ribosylation factor related protein 1 ENST00000324228.2 ADP-ribosylation factor related protein 1 ENST00000424545.1 ADP-ribosylation factor related protein 1 ENST00000355969.6 alternative 5' UTR ENST00000477340.1 FLJ90480 ENST00000490623.1 FLJ16589 ENST00000431125.1 alternative 5' UTR ENST00000369967.3 alternative 5' UTR ENST00000328969.5 FLJ14972 ENST00000496820.1 novel transcript ENST00000444951.1 alternative 5' UTR ENST00000490824.1 novel transcript (FLJ30160) ENST00000465591.1 novel transcript ENST00000309546.3 novel protein (FLJ20406) ENST00000487026.1 novel transcript ENST00000480139.1 novel transcript ENST00000493265.1 novel transcript ENST00000489212.1 novel transcript ENST00000476183.1 novel transcript ENST00000494776.1 novel transcript ENST00000467211.1 SLC2A4 regulator (SLC2A4RG)(GEF) ENST00000245663.3 BTB (POZ) domain containing 4 (BTBD4)(RINZF, ZNF340, FLJ13502) ENST00000245663.3 BTB (POZ) domain containing 4 (RINZF, ZNF340, FLJ13502) ENST00000460757.1 novel transcript ENST00000480766.1 novel transcript ENST00000447343.1 putative novel transcript ENST00000433905.1 putative novel transcript ENST00000435912.1 novel transcript ENST00000346249.4 tumor protein D52-like 2 (D54) ENST00000348257.5 tumor protein D52-like 2 (D54) ENST00000352482.4 tumor protein D52-like 2 (D54) ENST00000351424.4 tumor protein D52-like 2 ENST00000217121.5 tumor protein D52-like 2 ENST00000358548.4 tumor protein D52-like 2, variant 5 (FLJ30506) ENST00000474176.1 tumor protein D52-like 2 ENST00000360864.4 DnaJ (Hsp40) homolog, subfamily C, member 5 (FLJ00118, FLJ00095, FLJ13070) ENST00000470551.1 DnaJ (Hsp40) homolog, subfamily C, member 5 (FLJ13070) ENST00000354216.6 uridine kinase-like 1 (FLJ20517) ENST00000430743.1 uridine kinase-like 1 ENST00000492660.1 uridine kinase-like 1 ENST00000418992.1 uridine kinase-like 1 (FLJ20517) ENST00000483710.1 uridine kinase-like 1 ENST00000369888.1 novel protein (KIAA1196) ENST00000369886.3 chromosome 20 open reading frame 136 ENST00000498830.1 chromosome 20 open reading frame 136 novel transcript ENST00000478694.1 chromosome 20 open reading frame 136 novel transcript ENST00000450107.1 chromosome 20 open reading frame 136 ENST00000266079.4 TOM (putative mitochondrial outer membrane protein import receptor (similar to yeast pre-mRNA splicing factors Prp1/Zer1 and Prp6) ENST00000266079.4 putative mitochondrial outer membrane protein import receptor (TOM), similar to yeast pre-mRNA splicing factors Prp1/Zer1 and Prp6 ENST00000444463.1 novel transcript (LOC284739) ENST00000431158.1 novel transcript (DKFZp434G015) (LOC284739) ENST00000340356.7 SRY (sex determining region Y)-box 18 ENST00000475792.1 transcription elongation factor A (SII), 2 (TFIIS) ENST00000361317.2 transcription elongation factor A (SII), 2 (TFIIS) ENST00000361317.2 5'UTR ENST00000361317.2 alternative 5' UTR ENST00000343484.5 transcription elongation factor A (SII), 2 (TFIIS) ENST00000487164.1 transcription elongation factor A (SII), 2 (TFIIS) ENST00000476113.1 transcription elongation factor A (SII), 2 (TFIIS) ENST00000339217.4 transcription elongation factor A (SII), 2 (TFIIS) ENST00000339217.4 alternative 5' UTR ENST00000415602.1 transcription elongation factor A (SII), 2 (TFIIS) ENST00000415602.1 alternative 5' UTR ENST00000440819.1 transcription elongation factor A (SII), 2 (TFIIS) ENST00000440819.1 alternative 5' UTR ENST00000470559.1 transcription elongation factor A (SII), 2 (TFIIS) ENST00000465111.1 transcription elongation factor A (SII), 2 (TFIIS) ENST00000458442.1 transcription elongation factor A (SII), 2 (TFIIS) ENST00000458442.1 alternative 5' UTR ENST00000465433.1 transcription elongation factor A (SII), 2 (TFIIS) ENST00000477783.1 transcription elongation factor A (SII), 2 (TFIIS) ENST00000495168.1 transcription elongation factor A (SII), 2 (TFIIS) ENST00000461072.1 Transcription elongation factor A (SII), 2 (TCEA2), transcript variant 6 ENST00000461072.1 alternative 3' UTR ENST00000475236.1 transcription elongation factor A (SII), 2 (TFIIS) ENST00000455524.1 putative novel transcript ENST00000332298.5 regulator of G-protein signalling 19 (GAIP,RGSGAIP) ENST00000493165.1 regulator of G-protein signalling 19 (GAIP,RGSGAIP) ENST00000493165.1 alternative 5' UTR ENST00000479996.1 regulator of G-protein signalling 19 (GAIP,RGSGAIP) ENST00000336866.2 opiate receptor-like protein 1 (ORL1, NOCIR, KOR-3D) ENST00000336866.2 alternative 5' UTR ENST00000355631.4 opiate receptor-like protein 1 (ORL1, NOCIR, KOR-3D) ENST00000355631.4 alternative 5' UTR ENST00000349451.3 opiate receptor-like protein 1 (ORL1, NOCIR, KOR-3D) ENST00000349451.3 alternative 5' UTR ENST00000369768.1 G protein-coupled receptor 8 ENST00000328439.1 KIAA0835, similar to myelin transcription factor 1 (MYT1) ENST00000447359.1 capicua homolog (Drosophila) (CIC) pseudogene ENST00000425473.1 novel transcript ENST00000445252.1 novel transcript ENST00000302092.5 GENCODE experimental pipeline ENST00000451532.1 GENCODE experimental pipeline ENST00000496773.1 myeloid/lymphoid or mixed-lineage leukemia 3 (MLL3) pseudogene ENST00000414133.1 GENCODE experimental pipeline ENST00000414503.1 GENCODE experimental pipeline ENST00000457565.1 GENCODE experimental pipeline ENST00000447861.1 chromosome 21 open reading frame 99 novel transcript ENST00000471407.1 chromosome 21 open reading frame 99 novel transcript ENST00000444901.1 GENCODE experimental pipeline ENST00000427446.1 GENCODE experimental pipeline ENST00000398098.2 GENCODE experimental pipeline ENST00000431297.1 GENCODE experimental pipeline ENST00000444356.1 GENCODE experimental pipeline ENST00000311003.6 GENCODE experimental pipeline ENST00000443486.1 GENCODE experimental pipeline ENST00000433312.1 GENCODE experimental pipeline ENST00000400583.2 GENCODE experimental pipeline ENST00000428301.1 chromosome 21 open reading frame 15 novel transcript ENST00000436765.1 novel transcript ENST00000428576.1 chromosome 21 open reading frame 81 novel transcript ENST00000432875.1 chromosome 21 open reading frame 81 novel transcript ENST00000429521.1 chromosome 21 open reading frame 81 novel transcript ENST00000344693.5 chromosome 21 open reading frame 81 novel transcript ENST00000432621.1 GENCODE experimental pipeline ENST00000468643.1 FLJ34012 ENST00000429114.1 GENCODE experimental pipeline ENST00000470891.1 evidence from RNA_seq data: COMBG00000015491-57-0/1-100.1, COMBG00000015491-57-0/1-100.1, COMBG00000015491-50-0/1-100.1 ENST00000400566.1 FLJ43154 ENST00000389438.3 non-submitted evidence ENST00000442499.1 non-submitted evidence ENST00000427957.1 non-submitted evidence ENST00000435825.1 non-submitted evidence ENST00000400562.1 GENCODE experimental pipeline ENST00000449214.1 GENCODE experimental pipeline ENST00000455253.1 GENCODE experimental pipeline ENST00000453699.1 GENCODE experimental pipeline ENST00000435315.1 GENCODE experimental pipeline ENST00000448152.2 GENCODE experimental pipeline ENST00000412426.1 GENCODE experimental pipeline ENST00000454795.1 GENCODE experimental pipeline ENST00000430391.1 GENCODE experimental pipeline ENST00000400202.1 alternative 5' UTR ENST00000411932.1 alternative 5' UTR ENST00000446301.1 GENCODE experimental pipeline ENST00000436429.1 GENCODE experimental pipeline ENST00000449746.1 GENCODE experimental pipeline ENST00000449602.1 GENCODE experimental pipeline ENST00000450823.1 GENCODE experimental pipeline ENST00000433588.1 GENCODE experimental pipeline ENST00000454157.1 GENCODE experimental pipeline ENST00000285679.6 FLJ12385 ENST00000478932.1 FLJ36764 ENST00000433427.1 GENCODE experimental pipeline ENST00000458468.1 novel transcript FLJ38295 ENST00000456342.1 novel transcript ENST00000399358.2 GENCODE experimental pipeline ENST00000418544.1 GENCODE experimental pipeline ENST00000413645.1 GENCODE experimental pipeline ENST00000444868.1 GENCODE experimental pipeline ENST00000430064.1 GENCODE experimental pipeline ENST00000433383.1 GENCODE experimental pipeline ENST00000445481.1 GENCODE experimental pipeline ENST00000413813.1 GENCODE experimental pipeline ENST00000457956.1 alternative 5' UTR ENST00000416641.1 GENCODE experimental pipeline ENST00000430815.1 GENCODE experimental pipeline ENST00000284881.4 FLJ13763 ENST00000493464.1 novel transcript ENST00000482915.1 novel transcript ENST00000452759.1 non-submitted evidence ENST00000465099.1 non-submitted evidence ENST00000427223.1 non-submitted evidence ENST00000400128.1 FLJ12627 ENST00000428689.1 GENCODE experimental pipeline ENST00000447175.1 novel transcript ENST00000456825.1 GENCODE experimental pipeline ENST00000432412.1 GENCODE experimental pipeline ENST00000455391.1 GENCODE experimental pipeline ENST00000437492.1 GENCODE experimental pipeline ENST00000416002.1 GENCODE experimental pipeline ENST00000358455.4 GENCODE experimental pipeline ENST00000440372.1 GENCODE experimental pipeline ENST00000449840.1 GENCODE experimental pipeline ENST00000450653.1 GENCODE experimental pipeline ENST00000424219.1 GENCODE experimental pipeline ENST00000413933.1 GENCODE experimental pipeline ENST00000433210.1 GENCODE experimental pipeline ENST00000448908.1 GENCODE experimental pipeline ENST00000282964.5 GENCODE experimental pipeline ENST00000400117.2 GENCODE experimental pipeline ENST00000443479.1 GENCODE experimental pipeline ENST00000436373.1 GENCODE experimental pipeline ENST00000425091.1 GENCODE experimental pipeline ENST00000447938.1 GENCODE experimental pipeline ENST00000413190.1 GENCODE experimental pipeline ENST00000416768.1 FLJ37539 ENST00000435279.1 DKFZp686B23275 ENST00000448832.1 GENCODE experimental pipeline ENST00000425058.1 GENCODE experimental pipeline ENST00000428205.1 GENCODE experimental pipeline ENST00000416182.1 GENCODE experimental pipeline ENST00000419069.1 novel transcript ENST00000425979.1 GENCODE experimental pipeline ENST00000452500.1 GENCODE experimental pipeline ENST00000420255.1 GENCODE experimental pipeline ENST00000419431.1 novel transcript ENST00000454567.1 GENCODE experimental pipeline ENST00000444130.1 GENCODE experimental pipeline ENST00000379571.3 GENCODE experimental pipeline ENST00000441759.1 GENCODE experimental pipeline ENST00000438328.1 GENCODE experimental pipeline ENST00000421604.1 GENCODE experimental pipeline ENST00000445341.1 GENCODE experimental pipeline ENST00000262354.4 GENCODE experimental pipeline ENST00000447052.1 GENCODE experimental pipeline ENST00000425085.1 GENCODE experimental pipeline ENST00000433101.1 GENCODE experimental pipeline ENST00000441465.1 GENCODE experimental pipeline ENST00000447405.1 GENCODE experimental pipeline ENST00000434859.1 GENCODE experimental pipeline ENST00000448063.1 GENCODE experimental pipeline ENST00000416218.1 GENCODE experimental pipeline ENST00000453784.1 FLJ42200 ENST00000415182.1 DKFZp686M0457 ENST00000441009.1 GENCODE experimental pipeline ENST00000446404.1 GENCODE experimental pipeline ENST00000444178.1 GENCODE experimental pipeline ENST00000424017.1 GENCODE experimental pipeline ENST00000453802.1 GENCODE experimental pipeline ENST00000426609.1 GENCODE experimental pipeline ENST00000409758.1 GENCODE experimental pipeline ENST00000425147.1 GENCODE experimental pipeline ENST00000441013.1 novel transcript ENST00000332587.4 novel transcript ENST00000439840.1 novel transcript ENST00000440205.1 novel transcript ENST00000468736.1 evidence: COMBG00000011417-104-0/3-100.1 ENST00000489205.1 evidence: COMBG00000011417-104-0/3-100.3 ENST00000467945.1 Evidence: COMBG00000011417-105-0/3-100.1 ENST00000465390.1 Evidence: COMBG00000011417-104-0/3-100.2 ENST00000419694.1 GENCODE experimental pipeline ENST00000352957.4 FLJ20451 ENST00000450769.1 GENCODE experimental pipeline ENST00000400094.1 alternative 5' UTR ENST00000284971.3 DKFZp566A221 ENST00000457143.2 NP_001003701 ENST00000457143.2 alternative 5' UTR ENST00000400090.3 alternative 5' UTR ENST00000400087.3 alternative 5' UTR ENST00000400093.3 alternative 5' UTR ENST00000354828.3 DKFZp686G2131 ENST00000354828.3 alternative 5' UTR ENST00000436405.1 GENCODE experimental pipeline ENST00000456904.1 GENCODE experimental pipeline ENST00000455275.1 GENCODE experimental pipeline ENST00000435878.1 GENCODE experimental pipeline ENST00000444306.1 not organism-supported ENST00000429340.1 GENCODE experimental pipeline ENST00000429340.1 not organism-supported ENST00000357401.3 FLJ43348 ENST00000299340.4 FLJ30019, DKFZp667C226 ENST00000464589.1 FLJ13733 ENST00000284984.2 DKFZp686E01144, KIAA1346, DKFZp762C1110 ENST00000426771.1 GENCODE experimental pipeline ENST00000429271.1 GENCODE experimental pipeline ENST00000420186.2 GENCODE experimental pipeline ENST00000447384.1 GENCODE experimental pipeline ENST00000420241.1 GENCODE experimental pipeline ENST00000447844.1 GENCODE experimental pipeline ENST00000426418.1 GENCODE experimental pipeline ENST00000411460.1 novel transcript ENST00000425376.1 novel transcript ENST00000442550.1 novel transcript ENST00000433344.1 GENCODE experimental pipeline ENST00000324988.3 novel transcript ENST00000426534.1 FLJ35800 ENST00000453420.1 GENCODE experimental pipeline ENST00000433310.1 GENCODE experimental pipeline ENST00000412526.1 novel transcript ENST00000455939.1 novel transcript ENST00000400014.2 GENCODE experimental pipeline ENST00000389194.2 KIAA0714, FLJ11053 ENST00000389194.2 A(GC)-(AG) splicing between exons 2 and 3 ENST00000483326.1 FLJ13437 ENST00000320371.6 GENCODE experimental pipeline ENST00000493196.1 FLJ20049 ENST00000399975.3 FLJ21451 ENST00000399976.2 FLJ22336 ENST00000334352.4 alternatively spliced in 5' UTR, shares CDS with AF129075.4-002 ENST00000334352.4 alternative 5' UTR ENST00000485067.1 FLJ33457 ENST00000432178.1 alternative 3' UTR ENST00000457162.1 GENCODE experimental pipeline ENST00000339024.4 FLJ16330 ENST00000460883.1 novel transcript ENST00000399928.1 FLJ31779, DKFZp565A247 ENST00000399925.1 AF129075.6-003 ENST00000470800.1 novel transcript ENST00000430001.1 GENCODE experimental pipeline ENST00000447125.1 novel transcript ENST00000420364.1 novel transcript ENST00000431661.1 novel transcript ENST00000399921.1 alternatively spliced in 5' UTR; shares CDS with AF124731.5-001 ENST00000399921.1 alternative 5' UTR ENST00000451655.1 alternative 5' UTR ENST00000447177.1 alternative 5' UTR ENST00000435072.1 alternative 5' UTR ENST00000450472.1 GENCODE experimental pipeline ENST00000504298.1 GENCODE experimental pipeline ENST00000449923.1 GENCODE experimental pipeline ENST00000436529.1 GENCODE experimental pipeline ENST00000429843.1 GENCODE experimental pipeline ENST00000327783.4 not organism-supported ENST00000399914.1 not organism-supported ENST00000389124.2 not organism-supported ENST00000455392.2 novel transcript ENST00000309331.4 novel transcript ENST00000423221.1 novel transcript ENST00000412579.1 novel transcript ENST00000413131.1 novel transcript ENST00000451410.1 GENCODE experimental pipeline ENST00000430538.1 GENCODE experimental pipeline ENST00000416044.1 GENCODE experimental pipeline ENST00000382835.2 GENCODE experimental pipeline ENST00000508999.1 KRTAP13B ENST00000418755.1 KRTAP13A ENST00000421795.1 KRTAP19A ENST00000445258.1 KRTAP19B ENST00000439851.1 KRTAP19C ENST00000382830.2 GENCODE experimental pipeline ENST00000382828.2 GENCODE experimental pipeline ENST00000382826.2 KRTAP19D ENST00000444335.1 GENCODE experimental pipeline ENST00000461148.1 non-submitted evidence ENST00000469412.1 FLJ36302 ENST00000455508.1 alternative 5' UTR ENST00000382822.2 GENCODE experimental pipeline ENST00000429033.1 GENCODE experimental pipeline ENST00000490865.1 GENCODE experimental pipeline ENST00000433071.1 GENCODE experimental pipeline ENST00000449339.1 GENCODE experimental pipeline ENST00000399804.1 DKFZp762G014, FLJ22095, KIAA1172 ENST00000467731.1 DKFZp434E098 ENST00000485790.1 FLJ25111 ENST00000445197.1 GENCODE experimental pipeline ENST00000458495.1 GENCODE experimental pipeline ENST00000437109.1 GENCODE experimental pipeline ENST00000414877.1 novel transcript ENST00000411605.1 novel transcript ENST00000290130.3 FLJ90800 ENST00000453549.1 GENCODE experimental pipeline ENST00000453549.1 non-canonical splicing between exons 2 and 3 ENST00000450936.1 GENCODE experimental pipeline ENST00000382751.3 KIAA0539 ENST00000534991.1 GENCODE experimental pipeline ENST00000469079.1 novel transcript ENST00000459833.1 novel transcript ENST00000435323.1 novel transcript ENST00000437338.1 novel transcript ENST00000457807.1 novel transcript ENST00000401402.3 GENCODE experimental pipeline ENST00000481638.1 novel transcript ENST00000464037.1 novel transcript FLJ43023 ENST00000496615.1 novel transcript ENST00000485488.1 novel transcript ENST00000448649.1 GENCODE experimental pipeline ENST00000334165.4 novel transcript FLJ10932 ENST00000300258.3 FLJ25349 ENST00000431599.1 novel transcript ENST00000382549.4 Non-canonical splicing between exons 1 and 2 ENST00000382549.4 FLJ30766 ENST00000290155.3 FLJ25711 ENST00000425336.1 novel transcript ENST00000300260.7 novel transcript FLJ20467 ENST00000483315.1 novel transcript FLJ37137 ENST00000435600.1 GENCODE experimental pipeline ENST00000411943.1 GENCODE experimental pipeline ENST00000382499.2 NP_982271.2 ENST00000433931.2 NP_003886.3 ENST00000458479.1 FLJ31822 ENST00000440052.1 GENCODE experimental pipeline ENST00000466846.1 novel transcript FLJ46670 ENST00000497873.1 novel transcript FLJ35972 ENST00000445049.1 GENCODE experimental pipeline ENST00000445049.1 novel transcript ENST00000421049.1 novel transcript ENST00000464256.1 novel transcript ENST00000382375.4 FLJ39282 ENST00000382377.3 novel transcript ENST00000453404.1 novel transcript ENST00000382378.1 alternative 5' UTR ENST00000491756.1 novel transcript ENST00000487113.1 alternative 5' UTR ENST00000479548.1 alternative 5' UTR ENST00000444036.1 GENCODE experimental pipeline ENST00000427911.1 GENCODE experimental pipeline ENST00000424837.1 GENCODE experimental pipeline ENST00000333337.3 FLJ34143 ENST00000453716.1 GENCODE experimental pipeline ENST00000382348.1 DKFZp547G055 ENST00000421051.1 GENCODE experimental pipeline ENST00000450830.1 GENCODE experimental pipeline ENST00000440586.1 non-submitted evidence ENST00000447980.1 alternative 5' UTR ENST00000411998.1 FLJ41728 ENST00000411998.1 GENCODE experimental pipeline ENST00000493295.1 FLJ42063 ENST00000451645.1 GENCODE experimental pipeline ENST00000420455.1 DKFZp686C2482 ENST00000441128.1 GENCODE experimental pipeline ENST00000414617.1 GENCODE experimental pipeline ENST00000450928.1 GENCODE experimental pipeline ENST00000492008.1 non-submitted evidence ENST00000381815.4 alternative 5' UTR ENST00000381831.3 DKFZp686F0640 ENST00000381839.3 alternative 5' UTR ENST00000430874.1 alternative 5' UTR ENST00000426819.1 alternative 5' UTR ENST00000438059.1 alternative 5' UTR ENST00000441403.1 alternative 5' UTR ENST00000448054.1 GENCODE experimental pipeline ENST00000381692.2 FLJ46057 ENST00000300278.4 KIAA1019 ENST00000439593.1 GENCODE experimental pipeline ENST00000303113.6 alternative 3' UTR ENST00000453626.1 GENCODE experimental pipeline ENST00000457359.1 not organism-supported ENST00000303071.5 FLJ90483 ENST00000381540.3 non canonical TEC ENST00000381540.3 non-canonical splicing between exons 11 and 12 ENST00000381540.3 FLJ10431 ENST00000452420.1 FLJ25342 ENST00000445393.1 GENCODE experimental pipeline ENST00000361534.2 DKFZp779H2066 ENST00000429827.1 DKFZp686B0193 ENST00000420072.1 GENCODE experimental pipeline ENST00000420072.1 FLJ33042 ENST00000381318.3 FLJ38485, FLJ90809, FLJ31542, FLJ90073 ENST00000491703.1 FLJ42193 ENST00000427447.1 GENCODE experimental pipeline ENST00000381181.1 GENCODE experimental pipeline ENST00000381181.1 FLJ46020 ENST00000482679.1 FLJ39055 ENST00000381151.3 FLJ34929, FLJ22516, FLJ21243 ENST00000362077.4 GENCODE experimental pipeline ENST00000415238.1 GENCODE experimental pipeline ENST00000428914.2 novel transcript ENST00000416145.1 novel transcript ENST00000430922.1 novel transcript FLJ35385 ENST00000419881.1 novel transcript ENST00000440403.1 GENCODE experimental pipeline ENST00000481710.1 novel transcript FLJ35374 ENST00000489469.1 novel transcript ENST00000495363.1 novel transcript ENST00000474455.1 novel transcript ENST00000399295.2 FLJ25151 ENST00000480922.1 non-submitted evidence ENST00000399286.2 alternative 5' UTR ENST00000416357.2 alternative 5' UTR ENST00000489175.1 FLJ38123 ENST00000487990.1 alternative 5' UTR ENST00000487990.1 NP_981962.1 ENST00000313806.4 FLJ34865 ENST00000481448.1 FLJ16823 ENST00000482533.1 NP_981962.1 ENST00000349499.2 FLJ35414 ENST00000430635.1 novel transcript ENST00000420877.1 FLJ22133 ENST00000475045.1 FLJ41039 ENST00000416754.1 alternative 5' UTR ENST00000494829.1 DKFZp686K0736 ENST00000455028.1 GENCODE experimental pipeline ENST00000421454.1 GENCODE experimental pipeline ENST00000431167.1 GENCODE experimental pipeline ENST00000412240.1 GENCODE experimental pipeline ENST00000434853.1 GENCODE experimental pipeline ENST00000440405.2 GENCODE experimental pipeline ENST00000457157.1 GENCODE experimental pipeline ENST00000453844.1 GENCODE experimental pipeline ENST00000399215.1 FLJ37896 ENST00000481477.1 novel transcript ENST00000332131.4 FLJ10798 ENST00000487297.1 FLJ44404 ENST00000469482.1 novel transcript ENST00000408914.2 GENCODE experimental pipeline ENST00000436303.1 GENCODE experimental pipeline ENST00000415147.1 GENCODE experimental pipeline ENST00000445464.1 GENCODE experimental pipeline ENST00000422473.1 evidence = AK094771 ENST00000452572.1 GENCODE experimental pipeline ENST00000453159.1 GENCODE experimental pipeline ENST00000419943.1 GENCODE experimental pipeline ENST00000270190.4 alternative 5' UTR ENST00000399151.3 KIAA0933, FLJ22825 ENST00000492760.1 novel transcript ENST00000463668.1 FLJ21442 ENST00000414001.1 non-submitted evidence ENST00000445834.1 non-submitted evidence ENST00000435949.1 non-submitted evidence ENST00000418642.1 non-submitted evidence ENST00000437106.1 GENCODE experimental pipeline ENST00000399149.2 GENCODE experimental pipeline ENST00000400485.1 KIAA0136, FLJ21674 ENST00000400485.1 GENCODE experimental pipeline ENST00000400485.1 AT-AC splicing between exons 4 and 5 ENST00000397184.2 GENCODE experimental pipeline ENST00000444161.1 GENCODE experimental pipeline ENST00000429588.1 GENCODE experimental pipeline ENST00000428667.1 GENCODE experimental pipeline ENST00000433951.1 GENCODE experimental pipeline ENST00000457669.1 GENCODE experimental pipeline ENST00000430607.1 GENCODE experimental pipeline ENST00000399120.1 alternative 5' UTR ENST00000448340.1 alternative 5' UTR ENST00000419461.1 alternative 5' UTR ENST00000427746.1 alternative 5' UTR ENST00000434195.1 GENCODE experimental pipeline ENST00000430068.1 GENCODE experimental pipeline ENST00000400819.2 GENCODE experimental pipeline ENST00000464265.1 FLJ22658 ENST00000433957.2 FLJ24003 ENST00000476848.1 FLJ16093 ENST00000485402.1 not organism-supported ENST00000438055.1 not organism-supported ENST00000399017.2 FLJ43484 ENST00000354749.2 DKFZp686M0150 ENST00000424733.1 GENCODE experimental pipeline ENST00000497493.1 FLJ44497 ENST00000399000.3 DKFZp686N0127 ENST00000440629.1 GENCODE experimental pipeline ENST00000398956.2 non-submitted evidence ENST00000435001.1 GENCODE experimental pipeline ENST00000417138.1 GENCODE experimental pipeline ENST00000495344.1 non canonical TEC ENST00000495344.1 non-canonical splicing between exons 2 and 3 ENST00000398925.1 alternative 5' UTR ENST00000398925.1 not organism-supported ENST00000398928.1 alternative 5' UTR ENST00000398928.1 not organism-supported ENST00000443341.1 alternative 5' UTR ENST00000443341.1 not organism-supported ENST00000417042.1 alternative 5' UTR ENST00000417042.1 not organism-supported ENST00000398938.2 alternative 5' UTR ENST00000398932.1 alternative 5' UTR ENST00000398932.1 not organism-supported ENST00000438657.1 alternative 5' UTR ENST00000398930.1 alternative 5' UTR ENST00000398930.1 not organism-supported ENST00000398927.1 alternative 5' UTR ENST00000444977.1 GENCODE experimental pipeline ENST00000423089.1 GENCODE experimental pipeline ENST00000414189.1 GENCODE experimental pipeline ENST00000398907.1 not organism-supported ENST00000398910.1 not organism-supported ENST00000453032.2 NP_001129627 ENST00000398919.2 alternative 5' UTR ENST00000442212.1 GENCODE experimental pipeline ENST00000426607.1 novel transcript ENST00000448579.1 novel transcript ENST00000411989.1 novel transcript ENST00000429621.1 novel transcript ENST00000442549.1 novel transcript ENST00000360214.3 FLJ39522 ENST00000360938.3 alternative 5' UTR ENST00000432278.1 alternative 5' UTR ENST00000456966.1 alternative 5' UTR ENST00000416842.1 GENCODE experimental pipeline ENST00000380931.2 FLJ45139 ENST00000415824.1 GENCODE experimental pipeline ENST00000434589.1 GENCODE experimental pipeline ENST00000451820.1 GENCODE experimental pipeline ENST00000440379.1 GENCODE experimental pipeline ENST00000433952.1 GENCODE experimental pipeline ENST00000417335.1 GENCODE experimental pipeline ENST00000419664.1 GENCODE experimental pipeline ENST00000440714.1 GENCODE experimental pipeline ENST00000467573.1 GENCODE experimental pipeline ENST00000437262.1 GENCODE experimental pipeline ENST00000331573.3 FLJ10593 ENST00000446924.1 FLJ43918 ENST00000419324.1 GENCODE experimental pipeline ENST00000435608.1 GENCODE experimental pipeline ENST00000438852.1 GENCODE experimental pipeline ENST00000423274.2 GENCODE experimental pipeline ENST00000380749.5 FLJ27265 ENST00000444889.1 GENCODE experimental pipeline ENST00000478273.1 GENCODE experimental pipeline ENST00000288350.3 DKFZp686P1839 ENST00000358268.2 Alternatively spliced 5' UTR, shares CDS with AF121781.16-001 ENST00000358268.2 alternative 5' UTR ENST00000484878.1 novel transcript ENST00000468009.1 non-canonical splicing between exons 3 and 4 ENST00000468009.1 novel transcript DKFZp686P2086 ENST00000485895.1 novel transcript ENST00000491625.1 novel transcript ENST00000490184.1 novel transcript ENST00000466954.1 novel transcript ENST00000450079.1 GENCODE experimental pipeline ENST00000431743.1 GENCODE experimental pipeline ENST00000411867.1 GENCODE experimental pipeline ENST00000380618.1 alternative 5' UTR ENST00000489821.1 novel transcript FLJ26079 ENST00000416555.1 GENCODE experimental pipeline ENST00000419826.2 LOC440782 ENST00000380588.4 FLJ35197 ENST00000455354.1 GENCODE experimental pipeline ENST00000441268.1 novel transcript FLJ37173 ENST00000435493.1 novel transcript ENST00000446910.1 novel transcript ENST00000440221.2 GENCODE experimental pipeline ENST00000433378.1 GENCODE experimental pipeline ENST00000357985.2 FLJ43540 ENST00000436410.1 alternative 5' UTR ENST00000435611.1 alternative 5' UTR ENST00000495892.1 FLJ44119 ENST00000416447.1 alternative 5' UTR ENST00000418103.1 alternative 5' UTR ENST00000482953.1 FLJ16669 ENST00000474368.1 FLJ42345 ENST00000398632.3 FLJ46001 ENST00000398600.2 FLJ39036 ENST00000413778.1 alternative 5' UTR ENST00000419044.1 alternative 5' UTR ENST00000398598.3 alternative 5' UTR ENST00000424365.1 alternative 5' UTR ENST00000417963.1 alternative 5' UTR ENST00000441677.1 alternative 5' UTR ENST00000427464.1 alternative 5' UTR ENST00000288383.6 non canonical TEC ENST00000288383.6 FLJ35689 ENST00000288383.6 non-canonical splicing between exons 2 and 3 ENST00000411427.1 GENCODE experimental pipeline ENST00000458356.1 alternative 5' UTR ENST00000454499.1 alternative 5' UTR ENST00000497881.1 non canonical TEC ENST00000497881.1 non-canonical splicing between exons 2 and 3 ENST00000455813.1 alternative 5' UTR ENST00000415820.1 novel transcript ENST00000418874.1 GENCODE experimental pipeline ENST00000413718.1 novel transcript ENST00000412102.1 FLJ32835 ENST00000432830.1 novel transcript ENST00000332512.3 FLJ14518 ENST00000423276.1 GENCODE experimental pipeline ENST00000458654.1 GENCODE experimental pipeline ENST00000432411.1 GENCODE experimental pipeline ENST00000449165.1 DKFZp586F0422 ENST00000329623.7 novel transcript DKFZp686G1128 ENST00000380486.3 FLJ43130 ENST00000482186.1 novel transcript ENST00000482084.1 novel transcript FLJ46709 ENST00000490479.1 novel transcript ENST00000310826.5 alternative 5' UTR ENST00000398499.1 DKFZp781N1974 ENST00000398511.3 KIAA1227 ENST00000398511.3 alternative 5' UTR ENST00000425521.1 alternative 5' UTR ENST00000449949.1 alternative 5' UTR ENST00000398497.2 alternative 5' UTR ENST00000412906.1 non-canonical splicing between exons 1 and 2 ENST00000412906.1 novel transcript ENST00000412906.1 non canonical polymorphism ENST00000455701.1 non-canonical splicing between exons 1 and 2 ENST00000455701.1 novel transcript ENST00000455701.1 non canonical polymorphism ENST00000429739.1 non-canonical splicing between exons 1 and 2 ENST00000429739.1 novel transcript ENST00000429739.1 non canonical polymorphism ENST00000408989.2 FLJ42229, FLJ36335 ENST00000400423.2 FLJ42229 ENST00000329015.2 FLJ33471 ENST00000398437.1 non canonical TEC ENST00000398437.1 non-canonical splicing between exons 2 and 3 ENST00000472587.1 FLJ35640 ENST00000496783.1 DKFZp686N10273 ENST00000518498.1 NP_003217.3 ENST00000493019.1 FLJ32753 ENST00000454800.1 GENCODE experimental pipeline ENST00000419522.1 alternative 5' UTR ENST00000398341.3 FLJ22340 ENST00000352133.2 alternative 5' UTR ENST00000398343.2 alternative 5' UTR ENST00000429903.1 GENCODE experimental pipeline ENST00000442605.1 GENCODE experimental pipeline ENST00000419628.1 GENCODE experimental pipeline ENST00000424890.1 GENCODE experimental pipeline ENST00000335512.4 FLJ10303, FLJ10445 ENST00000489319.1 FLJ45871 ENST00000420273.1 GENCODE experimental pipeline ENST00000431150.1 GENCODE experimental pipeline ENST00000330317.2 alternative 3' UTR ENST00000492742.1 FLJ31781 ENST00000460259.1 FLJ31479 ENST00000398158.1 alternative 5' UTR ENST00000398165.3 alternative 5' UTR ENST00000359624.3 alternative 3' UTR ENST00000441030.1 alternative 5' UTR ENST00000478282.1 FLJ40947 ENST00000459639.1 NP_478071.1 ENST00000496462.1 DKFZp313J1712 ENST00000450190.1 GENCODE experimental pipeline ENST00000424933.1 GENCODE experimental pipeline ENST00000482775.1 not organism-supported ENST00000450205.1 GENCODE experimental pipeline ENST00000442815.1 GENCODE experimental pipeline ENST00000435702.1 FLJ41733 ENST00000270162.6 FLJ00263 ENST00000448049.1 novel transcript FLJ38036 ENST00000342757.2 novel transcript FLJ46587 ENST00000426942.1 novel transcript ENST00000332440.3 novel transcript ENST00000413721.1 novel transcript ENST00000451543.1 novel transcript ENST00000418516.1 novel transcript ENST00000427188.1 novel transcript DKFZp686N10165 ENST00000436359.1 GENCODE experimental pipeline ENST00000398116.2 GENCODE experimental pipeline ENST00000340648.4 FLJ31701 ENST00000470886.1 FLJ42629 ENST00000327574.4 FLJ31940 ENST00000476313.1 novel transcript ENST00000343528.6 non canonical TEC ENST00000343528.6 non-canonical splice donor site between exons 1 and 2 ENST00000498150.1 non-submitted evidence ENST00000438837.1 GENCODE experimental pipeline ENST00000467112.1 DKFZp434C085 ENST00000400385.2 FLJ46757 ENST00000449877.1 GENCODE experimental pipeline ENST00000291572.8 DKFZp762M1415 ENST00000448287.1 alternative 5' UTR ENST00000398061.1 FLJ22482 ENST00000398061.1 alternative 5' UTR ENST00000327505.2 alternative 5' UTR ENST00000445582.1 alternative 5' UTR ENST00000398063.2 alternative 5' UTR ENST00000398058.1 alternative 5' UTR ENST00000457068.1 alternative 5' UTR ENST00000467358.1 FLJ43816 ENST00000291574.4 GENCODE experimental pipeline ENST00000459741.1 DKFZp667I0321 ENST00000486746.1 confirm experimentally ENST00000468864.1 FLJ37691 ENST00000416034.1 GENCODE experimental pipeline ENST00000291577.6 AT-AC splicing between exons 6 and 7 ENST00000291577.6 GENCODE experimental pipeline ENST00000495007.1 AT-AC splicing between exons 5 and 6 ENST00000495007.1 novel transcript ENST00000493883.1 novel transcript ENST00000480786.1 novel transcript ENST00000488392.1 novel transcript ENST00000419699.1 AT-AC splicing between exons 4 and 5 ENST00000470545.1 novel transcript ENST00000411694.1 GENCODE experimental pipeline ENST00000411956.1 GENCODE experimental pipeline ENST00000437557.1 GENCODE experimental pipeline ENST00000423967.1 GENCODE experimental pipeline ENST00000400379.3 KIAA0653 ENST00000400377.3 FLJ33173 ENST00000442785.1 GENCODE experimental pipeline ENST00000474114.1 DKFZp686G1648 ENST00000498841.1 DKFZp686L2097 ENST00000467315.1 FLJ30173 ENST00000460521.1 FLJ40909 ENST00000444409.1 GENCODE experimental pipeline ENST00000448927.1 GENCODE experimental pipeline ENST00000448927.1 FLJ00235 ENST00000426029.1 GENCODE experimental pipeline ENST00000300482.5 alternative 5' UTR ENST00000431901.1 alternative 5' UTR ENST00000300481.9 non canonical TEC ENST00000300481.9 non-canonical splice donor site between exons 11 and 12 ENST00000423310.1 GENCODE experimental pipeline ENST00000456880.1 FLJ32713 ENST00000426578.1 GENCODE experimental pipeline ENST00000443300.1 GENCODE experimental pipeline ENST00000443620.1 GENCODE experimental pipeline ENST00000445440.1 GENCODE experimental pipeline ENST00000449713.1 GENCODE experimental pipeline ENST00000451035.1 novel transcript ENST00000430181.1 novel transcript ENST00000465978.1 novel transcript ENST00000435590.1 GENCODE experimental pipeline ENST00000481546.1 FLJ16170, DKFZp586L2318, FLJ90662 ENST00000496395.2 not organism-supported ENST00000417820.1 GENCODE experimental pipeline ENST00000475170.1 FLJ39897 ENST00000355153.4 FLJ38673 ENST00000523663.1 not organism-supported ENST00000523663.1 alternative 5' UTR ENST00000522931.1 alternative 5' UTR ENST00000517563.1 alternative 5' UTR ENST00000524251.1 alternative 5' UTR ENST00000517819.1 alternative 5' UTR ENST00000521995.1 alternative 5' UTR ENST00000441379.1 GENCODE experimental pipeline ENST00000479127.1 novel transcript ENST00000485207.1 novel transcript ENST00000434081.1 GENCODE experimental pipeline ENST00000422199.1 novel transcript ENST00000429427.1 GENCODE experimental pipeline ENST00000449478.1 alternative 5' UTR ENST00000328344.2 novel transcript ENST00000331343.7 isoform A ENST00000334538.9 isoform B ENST00000349485.5 isoform C ENST00000433465.1 GENCODE experimental pipeline ENST00000441947.1 GENCODE experimental pipeline ENST00000441947.1 non-canonical splicing between exons 2 and 3 ENST00000441947.1 novel transcript ENST00000445242.1 GENCODE experimental pipeline ENST00000416722.1 novel transcript ENST00000429327.1 GENCODE experimental pipeline ENST00000456613.1 GENCODE experimental pipeline ENST00000355480.5 A GC-rich tandem repeat in exon 33 results in a polymorphism that accounts for the difference in lenghth between our translation and that of the Refseq NP_085059 ENST00000473212.1 FLJ40897 ENST00000446475.1 GENCODE experimental pipeline ENST00000485206.1 FLJ38752 ENST00000427839.1 alternative 5' UTR ENST00000443742.1 alternative 5' UTR ENST00000528477.1 alternative 5' UTR ENST00000424569.1 GENCODE experimental pipeline ENST00000400314.1 NP_065389.2 ENST00000400310.1 FLJ36982 ENST00000549265.1 alternative 5' UTR ENST00000423045.1 GENCODE experimental pipeline ENST00000380008.1 FLJ41858 ENST00000380008.1 GENCODE experimental pipeline ENST00000361866.3 NP_001839 ENST00000451618.1 GENCODE experimental pipeline ENST00000429512.1 GENCODE experimental pipeline ENST00000435738.1 GENCODE experimental pipeline ENST00000428242.1 GENCODE experimental pipeline ENST00000300527.4 NP_001840 ENST00000436769.1 alternative 5' UTR ENST00000397763.1 NP_478054 ENST00000498355.2 non-canonical splicing between exons 14 and 15 ENST00000498355.2 non canonical TEC ENST00000446649.1 GENCODE experimental pipeline ENST00000330205.6 NP_115637 ENST00000291672.5 NP_001136326 ENST00000491729.1 FLJ39450 ENST00000356396.3 alternative 3' UTR ENST00000474319.1 FLJ35015 ENST00000522411.1 NP_001138908 ENST00000418029.1 GENCODE experimental pipeline ENST00000414659.1 FLJ10508 ENST00000496607.1 FLJ45306 ENST00000486937.1 FLJ44336 ENST00000426537.1 alternative 5' UTR ENST00000444966.1 GENCODE experimental pipeline ENST00000430259.1 GENCODE experimental pipeline ENST00000430259.1 FLJ42499 ENST00000397701.4 FLJ46907 ENST00000397701.4 alternative 5' UTR ENST00000468924.1 novel transcript ENST00000397694.1 isoform C ENST00000329319.3 isoform A ENST00000339195.6 isoform B ENST00000397692.1 isoform D ENST00000492864.1 novel transcript ENST00000291691.7 FLJ31825 ENST00000397679.1 FLJ39322 ENST00000359568.5 FLJ36604 ENST00000490468.1 FLJ13947 ENST00000400274.1 NP_001139588 ENST00000400274.1 KIAA0184 ENST00000457905.3 NP_996772 ENST00000466639.1 NP_001139587 ENST00000435722.3 NP_996773 ENST00000417564.2 NP_055966 ENST00000494435.1 FLJ40917 ENST00000494435.1 novel transcript ENST00000480553.1 FLJ34471 ENST00000480553.1 novel transcript ENST00000472364.1 FLJ42741 ENST00000481883.1 novel transcript ENST00000478105.1 FLJ30245 ENST00000478105.1 novel transcript ENST00000442434.1 GENCODE experimental pipeline ENST00000397648.1 alternative 5' UTR ENST00000355680.3 FLJ41656 ENST00000397638.2 alternative 5' UTR ENST00000397637.1 FLJ41358 ENST00000397637.1 alternative 5' UTR ENST00000486520.1 FLJ43503, DKFZp686C1564 ENST00000419906.1 GENCODE experimental pipeline ENST00000427757.1 GENCODE experimental pipeline ENST00000424770.1 GENCODE experimental pipeline ENST00000398242.2 GENCODE experimental pipeline ENST00000447898.1 FLJ10674 ENST00000437781.1 FLJ12852 ENST00000413768.1 FLJ31573 ENST00000413768.1 non canonical polymorphism ENST00000456786.1 homeobox pseudogene ENST00000440946.1 KIAA0187 ENST00000453395.1 GENCODE experimental pipeline ENST00000417657.1 GENCODE experimental pipeline ENST00000417657.1 actin, beta (ACTB) pseudogene ENST00000343518.6 GENCODE experimental pipeline ENST00000422014.1 GENCODE experimental pipeline ENST00000438441.1 GENCODE experimental pipeline ENST00000428118.1 GENCODE experimental pipeline ENST00000456143.1 GENCODE experimental pipeline ENST00000417863.1 GENCODE experimental pipeline ENST00000444162.1 GENCODE experimental pipeline ENST00000443989.1 GENCODE experimental pipeline ENST00000427602.1 GENCODE experimental pipeline ENST00000422332.1 GENCODE experimental pipeline ENST00000493696.1 GENCODE experimental pipeline ENST00000430910.1 GENCODE experimental pipeline ENST00000426585.1 FLJ37713 ENST00000426585.1 GENCODE experimental pipeline ENST00000425038.1 GENCODE experimental pipeline ENST00000442797.1 GENCODE experimental pipeline ENST00000422608.1 GENCODE experimental pipeline ENST00000442403.1 GENCODE experimental pipeline ENST00000448961.1 GENCODE experimental pipeline ENST00000412238.1 GENCODE experimental pipeline ENST00000427470.1 GENCODE experimental pipeline ENST00000458718.1 GENCODE experimental pipeline ENST00000465611.1 FLJ32690 ENST00000441006.1 GENCODE experimental pipeline ENST00000441006.1 FLJ40726 ENST00000429106.1 GENCODE experimental pipeline ENST00000399875.1 FLJ38290 ENST00000477157.1 FLJ41652 ENST00000329743.3 GENCODE experimental pipeline ENST00000543038.1 alternative 5' UTR ENST00000489588.2 non-submitted evidence ENST00000366217.3 non-submitted evidence ENST00000428401.1 GENCODE experimental pipeline ENST00000344033.4 GENCODE experimental pipeline ENST00000428828.1 GENCODE experimental pipeline ENST00000453421.1 GENCODE experimental pipeline ENST00000453421.1 Cat eye syndrome critial region candidate gene number 9 (CECR9) partial sequence. PMID:11381032 ENST00000455617.1 GENCODE experimental pipeline ENST00000437347.1 GENCODE experimental pipeline ENST00000399813.1 alternative 5' UTR ENST00000467228.1 FLJ38387 ENST00000443935.1 GENCODE experimental pipeline ENST00000399796.2 NP_001034456.1 ENST00000399798.2 NP_001034455.1 ENST00000493680.1 alternative 5' UTR ENST00000342111.5 NMD exception ENST00000551952.1 alternative 5' UTR ENST00000252134.6 KIAA0819 ENST00000252134.6 GENCODE experimental pipeline ENST00000495076.1 FLJ45579 ENST00000414725.2 KIAA1364 ENST00000429618.1 GENCODE experimental pipeline ENST00000441167.1 non canonical TEC ENST00000441167.1 GENCODE experimental pipeline ENST00000411920.1 GENCODE experimental pipeline ENST00000426483.1 GENCODE experimental pipeline ENST00000329627.5 FLJ20695 ENST00000427227.2 GENCODE experimental pipeline ENST00000428850.1 GENCODE experimental pipeline ENST00000342005.4 GENCODE experimental pipeline ENST00000412938.1 GENCODE experimental pipeline ENST00000429300.1 FLJ33744 ENST00000263196.7 non canonical conserved ENST00000412461.1 GENCODE experimental pipeline ENST00000456035.1 GENCODE experimental pipeline ENST00000450724.1 GENCODE experimental pipeline ENST00000086933.2 NP_005306.1 ENST00000086933.2 PMID: 9441739 ENST00000086933.2 NM_005315.1 ENST00000353891.5 non canonical genome sequence error ENST00000263200.10 non canonical genome sequence error ENST00000442042.2 non canonical genome sequence error ENST00000536806.1 non canonical genome sequence error ENST00000413132.2 non canonical genome sequence error ENST00000505027.2 non canonical genome sequence error ENST00000433141.1 GENCODE experimental pipeline ENST00000446618.1 GENCODE experimental pipeline ENST00000431090.1 GENCODE experimental pipeline ENST00000466373.1 FLJ46241 ENST00000407835.1 GENCODE experimental pipeline ENST00000406028.1 alternative 5' UTR ENST00000403084.1 alternative 5' UTR ENST00000413119.2 NP_003268 ENST00000420012.1 GENCODE experimental pipeline ENST00000452326.1 GENCODE experimental pipeline ENST00000406172.2 not organism-supported ENST00000403325.1 alternative 5' UTR ENST00000424559.1 GENCODE experimental pipeline ENST00000328554.4 alternative 5' UTR ENST00000405640.1 alternative 5' UTR ENST00000400518.1 NMD exception ENST00000400521.1 NMD exception ENST00000400525.1 NMD exception ENST00000400525.1 not organism-supported ENST00000491939.1 DKFZp781E0833 ENST00000420617.1 GENCODE experimental pipeline ENST00000361682.6 alternative 5' UTR ENST00000403710.1 alternative 5' UTR ENST00000407537.1 alternative 5' UTR ENST00000412786.1 alternative 5' UTR ENST00000406522.1 non-organism_supported ENST00000406259.1 Non-organism_supported ENST00000432198.1 alternative 5' UTR ENST00000398042.2 alternative 5' UTR ENST00000434168.1 alternative 5' UTR ENST00000415503.1 GENCODE experimental pipeline ENST00000412713.1 GENCODE experimental pipeline ENST00000444256.1 not organism-supported ENST00000492988.1 non-organism_supported ENST00000439765.1 not best-in-genome evidence ENST00000439765.1 GENCODE experimental pipeline ENST00000454636.1 not best-in-genome evidence ENST00000458154.1 GENCODE experimental pipeline ENST00000429995.1 GENCODE experimental pipeline ENST00000404912.1 not best-in-genome evidence ENST00000426653.1 GENCODE experimental pipeline ENST00000424812.1 GENCODE experimental pipeline ENST00000355186.4 KIAA1666 protein ENST00000458527.1 GENCODE experimental pipeline ENST00000413504.1 GENCODE experimental pipeline ENST00000441723.2 not best-in-genome evidence ENST00000437275.1 alternative 5' UTR ENST00000444967.1 GENCODE experimental pipeline ENST00000458248.1 alternative 5' UTR ENST00000426448.1 GENCODE experimental pipeline ENST00000532431.1 ENST00000383946 ENST00000532431.1 Source:RFAM;Acc:RF00019 ENST00000436075.1 GENCODE experimental pipeline ENST00000420225.1 GENCODE experimental pipeline ENST00000443839.1 GENCODE experimental pipeline ENST00000447821.1 GENCODE experimental pipeline ENST00000411545.2 GENCODE experimental pipeline ENST00000412250.2 GENCODE experimental pipeline ENST00000450925.2 DKFZp434N035 ENST00000449120.1 alternative 5' UTR ENST00000444039.1 GENCODE experimental pipeline ENST00000399133.2 alternative 5' UTR ENST00000436079.1 GENCODE experimental pipeline ENST00000413302.2 NP_005437 ENST00000450652.1 GENCODE experimental pipeline ENST00000442047.1 GENCODE experimental pipeline ENST00000461808.1 FLJ42953 ENST00000398241.3 partial duplication of 3' end of BCR gene (chromosome 22 clone U07000.1) ENST00000420508.1 GENCODE experimental pipeline ENST00000329949.3 DKFZP434P211 ENST00000329949.3 GENCODE experimental pipeline ENST00000420708.1 GENCODE experimental pipeline ENST00000451257.1 GENCODE experimental pipeline ENST00000415376.1 Seems to be duplicated in KB-1183D5.13 ENST00000433014.1 1bp missing at donor splice site of exon 2 ENST00000417463.1 GENCODE experimental pipeline ENST00000405188.4 non canonical other ENST00000405188.4 not best-in-genome evidence ENST00000401924.1 non canonical other ENST00000401924.1 not best-in-genome evidence ENST00000441743.1 GENCODE experimental pipeline ENST00000447720.1 Seems to be duplicated in KB-1183D5.11 ENST00000447720.1 GENCODE experimental pipeline ENST00000434730.1 GENCODE experimental pipeline ENST00000416640.1 GENCODE experimental pipeline ENST00000422450.1 GENCODE experimental pipeline ENST00000357029.1 GENCODE experimental pipeline ENST00000407464.2 alternative 5' UTR ENST00000407598.2 alternative 5' UTR ENST00000456303.1 Possible duplication of TMEM191A ENST00000449424.1 GENCODE experimental pipeline ENST00000331505.5 GENCODE experimental pipeline ENST00000292779.3 There is a deletion in what would be the 3rd coding exon of the cDNAEm:AK093365.1, which means that it cannot be used as evidence. This would have supported the main SwissProt variant (SW:Q8IYX3.2) of 515 amino acids, so we just have this 613 amino acid variant ENST00000398831.3 alternative 3' UTR ENST00000406385.1 alternative 3' UTR ENST00000215832.6 GENCODE experimental pipeline ENST00000398822.3 Same CDS as variant one but alternative 3' UTR ENST00000435222.1 GENCODE experimental pipeline ENST00000398793.2 alternative 5' UTR ENST00000424393.1 alternative 5' UTR ENST00000437929.1 alternative 5' UTR ENST00000430142.1 alternative 5' UTR ENST00000456075.1 alternative 5' UTR ENST00000449704.1 alternative 5' UTR ENST00000442653.1 alternative 5' UTR ENST00000437103.1 alternative 5' UTR ENST00000434517.1 alternative 5' UTR ENST00000337471.4 GENCODE experimental pipeline ENST00000390282.2 IGLV4-69*01, V5-6 ENST00000411554.1 GENCODE experimental pipeline ENST00000390283.2 IGLV8-61*01, V3-4 ENST00000390284.2 IGLV4-60*02, V5-4 ENST00000442890.1 (C22:IGLV3-3.5K) ENST00000458366.1 GENCODE experimental pipeline ENST00000390285.2 IGLV6-57*01, V1-22 ENST00000390286.2 ORF due to 19nt V-SPACER ENST00000390286.2 IGLV11-55*01, V4-6 ENST00000390287.2 IGLV10-54*02, V11-20 ENST00000420768.1 GENCODE experimental pipeline ENST00000390289.2 IGLV5-52*01, V4-4 ENST00000390290.2 IGLV1-51*01, V1-19 ENST00000390291.2 This is an ORF, due to non-conserved OCTAMER sequence, non-conserved TATA_BOX and an unusual V-NONAMER sequence ENST00000427632.2 IGLV9-49*02, V5-2 ENST00000390293.1 ORF due to an unusual V-HEPTAMER sequence ENST00000390294.2 IGLV1-47*02,V1-17 ENST00000453999.1 GENCODE experimental pipeline ENST00000390295.2 IGLV7-46*02, V3-3 ENST00000390296.2 IGLV5-45*03, V4-2 ENST00000390297.2 IGLV1-44*01, V1-16 ENST00000390298.2 IGLV7-43*01, V3-2 ENST00000390299.2 IGLV1-40*01, V1-13 ENST00000390300.2 IGLV5-37*01. V4-1 ENST00000390301.2 IGLV1-36*01, V1-11 ENST00000451224.1 GENCODE experimental pipeline ENST00000405655.3 alternative 5' UTR ENST00000402697.1 alternative 5' UTR ENST00000439106.1 alternative 5' UTR ENST00000420709.1 alternative 5' UTR ENST00000406503.1 alternative 5' UTR ENST00000403441.1 alternative 5' UTR ENST00000407120.1 GENCODE experimental pipeline ENST00000390302.2 ORF due to unusual V-HEPTAMER sequence ENST00000390302.2 IGLV2-33*01,V1-9 (allele) ENST00000390303.2 IGLV3-32*01, V2-23P ENST00000390303.2 This is an ORF due to a non-canonical acceptor splice site and to a Tyrosine instead of the 2nd_CYS at position104 ENST00000402027.1 FLJ76724 ENST00000402027.1 GENCODE experimental pipeline ENST00000448514.1 not best-in-genome evidence ENST00000448514.1 non canonical polymorphism ENST00000390304.2 IGLV3-27*01, V2-19 ENST00000390305.2 IGLV3-25*02 allele ENST00000438185.1 GENCODE experimental pipeline ENST00000390306.2 IGLV2-23*03, V1-7 ENST00000390307.2 IGLV3-22*01, V2-15 ENST00000390308.2 IGLV3-21*02, V2-14 ENST00000390309.2 IGLV3-19*01, V2-13 ENST00000390309.2 The annotated V-heptamer (cacattg) is different to the accepted V-heptamer (cacagtg) in the IMGT database ENST00000390311.2 IGLV3-16*01, V2-11 ENST00000390312.2 IGLV2-14*01, V1-4 ENST00000390313.2 V-nonamer is different to what is on the IMGT database: ACAAAAACA ENST00000390313.2 IGLV3-12*02, V2-8 ENST00000390314.2 IGLV2-11*01, V1-3 ENST00000390315.2 IGLV3-10*01, V2-7 ENST00000390316.2 IGLV3-9*01, V2-6 ENST00000390316.2 This gene has an unusual V-heptamer seqeunce (cacagta instead of cacagtg) ENST00000390317.2 The V-nonamer is different than the IMGT database: ATCAAAACC ENST00000390317.2 IGLV2-8*01, V1-2 ENST00000390318.2 IGLV4-3*01,V5-1 ENST00000390318.2 This is one of the three functional genes on the IG:V4 subgroup, despite the presence of a stop codon at the 3' end of the V-region ENST00000390319.2 IGLV3-1*01, V2-1 ENST00000390320.2 IGLJ1*01 ENST00000390321.2 IGLC1*02 ENST00000390322.2 IGLJ2*01 ENST00000390323.2 IGLC2*02 ENST00000390324.2 IGLJ3*02 ENST00000390325.2 IGLC3*04 ENST00000390327.2 IGLJ5 has an ORFand a non-canonical donor-splice ENST00000390328.2 IGLJ6 has an ORF ENST00000410078.2 IGLC6*05 ENST00000415639.1 GENCODE experimental pipeline ENST00000440602.1 GENCODE experimental pipeline ENST00000450776.1 GENCODE experimental pipeline ENST00000255890.4 Novel transcript ENST00000433168.1 Novel Transcript ENST00000420968.1 Novel Transcript ENST00000420968.1 FLJ31568 ENST00000449711.1 GENCODE experimental pipeline ENST00000432249.2 GENCODE experimental pipeline ENST00000458318.1 GENCODE experimental pipeline ENST00000390329.2 GENCODE experimental pipeline ENST00000451837.1 non canonical genome sequence error ENST00000445682.1 non canonical genome sequence error ENST00000421064.1 non canonical genome sequence error ENST00000402217.3 CCDS13814.1 ENST00000460352.1 Due to degradation of EST last 100bp can not be assigned ENST00000344921.6 a/gc - cag/ splicing between exons 64115 - 66275 ENST00000407082.3 not organism-supported ENST00000406855.3 GENCODE experimental pipeline ENST00000476077.1 NP_940842.2 ENST00000398356.2 NP_110434.2 ENST00000467660.1 Known CDs but no stop codon; subject to no-stop decay ENST00000405340.2 not organism-supported ENST00000316185.8 NP_001020110.1 ENST00000421180.1 non-submitted evidence ENST00000447957.1 non-submitted evidence ENST00000433835.2 non-submitted evidence ENST00000502845.1 non-submitted evidence ENST00000406213.1 GENCODE experimental pipeline ENST00000439492.1 GENCODE experimental pipeline ENST00000423307.1 Sw:P30711.4 ENST00000215770.5 NP_001077862 ENST00000398344.4 alternative 5' UTR ENST00000421902.1 GENCODE experimental pipeline ENST00000445894.1 GENCODE experimental pipeline ENST00000447865.1 alternative 5' UTR ENST00000454754.1 alternative 5' UTR ENST00000263119.5 alternative 5' UTR ENST00000444093.1 GENCODE experimental pipeline ENST00000398292.3 NP_001093251 ENST00000396982.2 GENCODE experimental pipeline ENST00000421374.1 alternative 5' UTR ENST00000424232.1 alternative 5' UTR ENST00000444262.2 alternative 5' UTR ENST00000444262.2 not organism-supported ENST00000496258.1 alternative 5' UTR ENST00000436735.1 alternative 5' UTR ENST00000439591.1 alternative 5' UTR ENST00000326341.4 GENCODE experimental pipeline ENST00000326341.4 NMD exception ENST00000432032.1 GENCODE experimental pipeline ENST00000407973.2 alternative 5' UTR ENST00000404603.1 subject to nonsense-mediated decay ENST00000458544.1 subject to nonsense-mediated decay ENST00000439775.1 subject to nonsense-mediated decay ENST00000248923.4 alternative 5' UTR ENST00000456869.1 alternative 5' UTR ENST00000411974.1 alternative 5' UTR ENST00000412658.1 alternative 5' UTR ENST00000445029.1 alternative 5' UTR ENST00000419133.1 alternative 5' UTR ENST00000400382.1 alternative 5' UTR ENST00000438643.2 alternative 5' UTR ENST00000452551.1 alternative 5' UTR ENST00000412898.1 alternative 5' UTR ENST00000455483.1 alternative 5' UTR ENST00000430289.1 alternative 5' UTR ENST00000447416.1 alternative 5' UTR ENST00000432867.1 alternative 5' UTR ENST00000451366.1 alternative 5' UTR ENST00000428855.1 alternative 5' UTR ENST00000401885.1 alternative 5' UTR ENST00000404532.1 alternative 5' UTR ENST00000438893.2 GENCODE experimental pipeline ENST00000436994.1 GENCODE experimental pipeline ENST00000409926.2 GENCODE experimental pipeline ENST00000442565.1 GENCODE experimental pipeline ENST00000400358.4 NP_001091967 ENST00000407886.1 NP_001001663 ENST00000366110.3 GENCODE experimental pipeline ENST00000429003.1 GENCODE experimental pipeline ENST00000454253.1 GENCODE experimental pipeline ENST00000411511.1 GENCODE experimental pipeline ENST00000468442.1 alternative 5' UTR ENST00000509460.2 GENCODE experimental pipeline ENST00000412773.1 GENCODE experimental pipeline ENST00000455558.2 not organism-supported ENST00000413494.1 GENCODE experimental pipeline ENST00000418510.1 GENCODE experimental pipeline ENST00000536101.1 alternative 3' UTR ENST00000536101.1 non canonical conserved ENST00000335473.7 NP_115997.5 ENST00000335473.7 non canonical conserved ENST00000407587.2 non canonical conserved ENST00000539302.1 non canonical conserved ENST00000453457.1 GENCODE experimental pipeline ENST00000436423.1 GENCODE experimental pipeline ENST00000420391.1 GENCODE experimental pipeline ENST00000434510.1 GENCODE experimental pipeline ENST00000414989.2 GENCODE experimental pipeline ENST00000450463.1 GENCODE experimental pipeline ENST00000398145.2 alternative_5'_UTR NP_071364 ENST00000398145.2 alternative 5' UTR ENST00000402105.3 NP_690054 ENST00000407690.1 alternative 5' UTR ENST00000407431.1 alternative 5' UTR ENST00000407148.1 alternative 5' UTR ENST00000455080.1 alternative 5' UTR ENST00000418876.1 alternative 5' UTR ENST00000420242.1 alternative 5' UTR ENST00000440258.1 alternative 5' UTR ENST00000398110.2 alternative 5' UTR ENST00000403880.1 alternative 5' UTR ENST00000403880.1 not organism-supported ENST00000442495.1 alternative 5' UTR ENST00000454778.1 alternative 5' UTR ENST00000440953.1 alternative 5' UTR ENST00000453117.1 alternative 5' UTR ENST00000450022.1 alternative 5' UTR ENST00000395823.2 GENCODE experimental pipeline ENST00000425548.1 GENCODE experimental pipeline ENST00000421867.1 GENCODE experimental pipeline ENST00000382641.1 GENCODE experimental pipeline ENST00000437071.1 GENCODE experimental pipeline ENST00000434868.1 GENCODE experimental pipeline ENST00000422915.1 GENCODE experimental pipeline ENST00000438113.1 GENCODE experimental pipeline ENST00000453934.1 GENCODE experimental pipeline ENST00000430468.1 GENCODE experimental pipeline ENST00000427360.1 GENCODE experimental pipeline ENST00000444114.1 GENCODE experimental pipeline ENST00000449126.1 GENCODE experimental pipeline ENST00000454387.1 GENCODE experimental pipeline ENST00000426467.1 GENCODE experimental pipeline ENST00000413244.1 GENCODE experimental pipeline ENST00000440477.1 GENCODE experimental pipeline ENST00000415655.1 GENCODE experimental pipeline ENST00000440255.1 GENCODE experimental pipeline ENST00000422833.1 GENCODE experimental pipeline ENST00000417957.1 GENCODE experimental pipeline ENST00000454741.1 GENCODE experimental pipeline ENST00000458080.1 GENCODE experimental pipeline ENST00000447099.1 GENCODE experimental pipeline ENST00000402174.1 alternative 5' UTR ENST00000406323.3 alternative 5' UTR ENST00000412798.1 GENCODE experimental pipeline ENST00000407188.1 non canonical TEC ENST00000456740.1 GENCODE experimental pipeline ENST00000496342.1 GENCODE experimental pipeline ENST00000414672.1 alternative 5' UTR ENST00000406335.1 alternative 5' UTR ENST00000433125.1 GENCODE experimental pipeline ENST00000331029.7 not organism-supported ENST00000416823.1 alternative 5' UTR ENST00000428622.1 alternative 5' UTR ENST00000403764.1 alternative 5' UTR ENST00000471961.1 alternative 5' UTR ENST00000407854.1 alternative 5' UTR ENST00000401450.3 NP_001007280.1 ENST00000405198.1 NP_001118.2 ENST00000421126.1 alternative 5' UTR ENST00000461286.1 GENCODE experimental pipeline ENST00000354373.2 NP_066306 ENST00000419368.1 GENCODE experimental pipeline ENST00000358079.4 not organism-supported ENST00000397873.2 alternative 5' UTR ENST00000440771.1 alternative 5' UTR ENST00000428374.1 alternative 5' UTR ENST00000418021.1 alternative 5' UTR ENST00000411969.1 GENCODE experimental pipeline ENST00000334961.7 alternative 3' UTR ENST00000397789.3 alternative 3' UTR ENST00000361166.4 alternative 3' UTR ENST00000416352.1 GENCODE experimental pipeline ENST00000420180.1 GENCODE experimental pipeline ENST00000330029.6 NP_037519 ENST00000401406.3 NP_001003684 ENST00000397771.2 alternative 5' UTR ENST00000431535.1 alternative 5' UTR ENST00000445401.1 alternative 5' UTR ENST00000464734.1 non-submitted evidence ENST00000429350.1 GENCODE experimental pipeline ENST00000453616.1 GENCODE experimental pipeline ENST00000336726.6 alternative 5' UTR ENST00000491590.1 non-submitted evidence ENST00000423857.1 GENCODE experimental pipeline ENST00000451219.1 GENCODE experimental pipeline ENST00000432360.1 GENCODE experimental pipeline ENST00000447565.1 GENCODE experimental pipeline ENST00000440839.1 not organism-supported ENST00000415484.1 not organism-supported ENST00000492159.1 not organism-supported ENST00000444440.1 not organism-supported ENST00000447376.1 not organism-supported ENST00000405659.1 LOC550631 ENST00000445005.1 not organism-supported ENST00000332468.4 GENCODE experimental pipeline ENST00000478314.1 non-submitted evidence ENST00000469245.1 non-submitted evidence ENST00000469933.1 non-submitted evidence ENST00000459728.1 not organism-supported ENST00000426397.1 GENCODE experimental pipeline ENST00000435069.1 not organism-supported ENST00000453285.1 GENCODE experimental pipeline ENST00000442126.1 GENCODE experimental pipeline ENST00000402034.1 not best-in-genome evidence ENST00000402034.1 GENCODE experimental pipeline ENST00000448467.1 GENCODE experimental pipeline ENST00000406955.1 alternative 5' UTR ENST00000402321.1 alternative 5' UTR ENST00000402369.1 alternative 5' UTR ENST00000406361.1 alternative 5' UTR ENST00000441967.1 alternative 3' UTR ENST00000441967.1 not organism-supported ENST00000437282.1 alternative 5' UTR ENST00000423299.1 alternative 5' UTR ENST00000423371.1 alternative 5' UTR ENST00000428682.1 alternative 5' UTR ENST00000426220.1 alternative 5' UTR ENST00000447224.1 alternative 5' UTR ENST00000411821.1 alternative 5' UTR ENST00000402281.1 alternative 5' UTR ENST00000432130.1 GENCODE experimental pipeline ENST00000430175.1 alternative 3' UTR ENST00000404885.1 alternative 3' UTR ENST00000407308.1 non-organism_supported ENST00000407308.1 alternative 5' UTR ENST00000377087.3 not organism-supported ENST00000412865.1 alternative 3' UTR ENST00000412865.1 not organism-supported ENST00000342474.4 alternative 5' UTR ENST00000442752.1 alternative 5' UTR ENST00000424380.1 GENCODE experimental pipeline ENST00000422839.1 alternative 5' UTR ENST00000504335.1 GENCODE experimental pipeline ENST00000504335.1 Missing 1kb at 3' end ENST00000402395.1 alternative 5' UTR ENST00000420779.1 GENCODE experimental pipeline ENST00000405300.1 alternative 5' UTR ENST00000397595.2 GENCODE experimental pipeline ENST00000440456.1 GENCODE experimental pipeline ENST00000441289.1 GENCODE experimental pipeline ENST00000418321.1 GENCODE experimental pipeline ENST00000439588.1 GENCODE experimental pipeline ENST00000432498.1 NP_055590.2 ENST00000432498.1 GENCODE experimental pipeline ENST00000400288.2 NP_001007468.1 ENST00000524296.1 not organism-supported ENST00000450787.1 GENCODE experimental pipeline ENST00000486708.1 novel transcript ENST00000452250.1 novel transcript ENST00000467357.1 putative novel transcript ENST00000417682.2 GENCODE experimental pipeline ENST00000425671.1 novel transcript ENST00000488883.1 novel transcript ENST00000463436.1 putative novel transcript ENST00000495107.1 novel transcript ENST00000474741.1 novel transcript ENST00000476577.1 novel transcript ENST00000464333.1 novel transcript ENST00000357852.3 novel transcript ENST00000444403.1 GENCODE experimental pipeline ENST00000416920.1 GENCODE experimental pipeline ENST00000445477.1 GENCODE experimental pipeline ENST00000431684.1 novel transcript ENST00000492705.1 putative novel transcript ENST00000461722.1 novel transcript ENST00000412743.1 novel transcript ENST00000429025.1 GENCODE experimental pipeline ENST00000454534.1 GENCODE experimental pipeline ENST00000430449.1 GENCODE experimental pipeline ENST00000416995.1 GENCODE experimental pipeline ENST00000423610.1 GENCODE experimental pipeline ENST00000423412.1 GENCODE experimental pipeline ENST00000436294.1 GENCODE experimental pipeline ENST00000467813.1 novel transcript ENST00000426354.1 GENCODE experimental pipeline ENST00000434942.1 GENCODE experimental pipeline ENST00000397477.2 GENCODE experimental pipeline ENST00000452181.1 GENCODE experimental pipeline ENST00000446543.1 GENCODE experimental pipeline ENST00000420171.1 LOC339666 ENST00000444848.1 GENCODE experimental pipeline ENST00000397452.1 not organism-supported ENST00000428201.1 GENCODE experimental pipeline ENST00000444982.1 GENCODE experimental pipeline ENST00000382049.4 CDS switches different frame compared to variant -001 in final exon ENST00000446798.1 GENCODE experimental pipeline ENST00000447396.1 GENCODE experimental pipeline ENST00000452505.1 GENCODE experimental pipeline ENST00000434741.1 GENCODE experimental pipeline ENST00000430220.2 alternative 5' UTR ENST00000413114.1 alternative 5' UTR ENST00000434071.1 alternative 5' UTR ENST00000432776.1 alternative 5' UTR ENST00000423375.1 alternative 5' UTR ENST00000421232.1 GENCODE experimental pipeline ENST00000453924.1 GENCODE experimental pipeline ENST00000445391.1 GENCODE experimental pipeline ENST00000424291.1 GENCODE experimental pipeline ENST00000412218.1 GENCODE experimental pipeline ENST00000450365.1 GENCODE experimental pipeline ENST00000457251.1 GENCODE experimental pipeline ENST00000423712.1 GENCODE experimental pipeline ENST00000440858.1 GENCODE experimental pipeline ENST00000404699.1 alternative 5' UTR ENST00000423311.1 GENCODE experimental pipeline ENST00000414048.1 GENCODE experimental pipeline ENST00000420166.1 alternative 5' UTR ENST00000412893.1 alternative 5' UTR ENST00000406324.1 alternative 5' UTR ENST00000443033.1 alternative 5' UTR ENST00000419229.1 alternative 5' UTR ENST00000417782.1 GENCODE experimental pipeline ENST00000415961.1 GENCODE experimental pipeline ENST00000414461.2 Non-canonical donor splice site at exon 9 that is highly conserved in other species ENST00000414461.2 non canonical conserved ENST00000414461.2 NP_001076046.1 ENST00000449924.2 NP_001026865.1 ENST00000449924.2 non canonical conserved ENST00000449924.2 Non-canonical acceptro splice site at exon 9 that is very welll conserved in many other species ENST00000438146.2 Non-canonical splicing between exons 9 and 10, but this is very highly conserved in other species ENST00000438146.2 non canonical conserved ENST00000436210.1 GENCODE experimental pipeline ENST00000397287.2 alternative 5' UTR ENST00000425366.1 GENCODE experimental pipeline ENST00000437339.1 GENCODE experimental pipeline ENST00000414147.1 GENCODE experimental pipeline ENST00000454926.1 GENCODE experimental pipeline ENST00000439552.1 GENCODE experimental pipeline ENST00000426108.1 GENCODE experimental pipeline ENST00000479929.1 not organism-supported ENST00000429038.2 alternative 5' UTR ENST00000524531.1 not organism-supported ENST00000457630.2 alternative 5' UTR ENST00000419360.1 alternative 5' UTR ENST00000449084.1 alternative 5' UTR ENST00000436763.1 alternative 5' UTR ENST00000529194.1 alternative 5' UTR ENST00000216181.5 GENCODE experimental pipeline ENST00000424761.1 GENCODE experimental pipeline ENST00000413110.1 GENCODE experimental pipeline ENST00000442579.1 GENCODE experimental pipeline ENST00000416967.1 FLJ26677 ENST00000366463.3 FLJ33734 ENST00000433970.1 GENCODE experimental pipeline ENST00000430281.1 GENCODE experimental pipeline ENST00000430281.1 FLJ41638 ENST00000430701.1 alternative 5' UTR ENST00000417718.2 alternative 5' UTR ENST00000443735.1 alternative 5' UTR ENST00000417792.1 GENCODE experimental pipeline ENST00000330602.2 GENCODE experimental pipeline ENST00000400221.1 GENCODE experimental pipeline ENST00000400221.1 FLJ26869 ENST00000405091.2 alternative 5' UTR ENST00000405091.2 not organism-supported ENST00000403892.3 FLJ34555 ENST00000401419.3 alternative 5' UTR ENST00000404802.3 alternative 5' UTR ENST00000341116.3 alternative 5' UTR ENST00000397225.2 FLJ31171 ENST00000397225.2 alternative 5' UTR ENST00000414203.2 GENCODE experimental pipeline ENST00000414203.2 not organism-supported ENST00000447922.1 non-submitted evidence ENST00000453962.1 alternative 5' UTR ENST00000429622.1 alternative 5' UTR ENST00000445595.1 alternative 5' UTR ENST00000419128.1 GENCODE experimental pipeline ENST00000470655.1 FLJ46246 ENST00000402501.1 alternative 5' UTR ENST00000436709.1 GENCODE experimental pipeline ENST00000441619.1 alternative 5' UTR ENST00000457992.1 alternative 5' UTR ENST00000430883.1 FLJ30913 ENST00000452946.1 GENCODE experimental pipeline ENST00000445088.1 FLJ40468 ENST00000445088.1 GENCODE experimental pipeline ENST00000406271.3 FLJ90425 ENST00000251973.5 alternative 5' UTR ENST00000428838.1 GENCODE experimental pipeline ENST00000430687.1 alternative 5' UTR ENST00000415670.1 alternative 5' UTR ENST00000434728.1 alternative 5' UTR ENST00000416480.1 alternative 5' UTR ENST00000381756.5 non canonical TEC ENST00000381756.5 non-canonical splice donor between exon 3 and 4 ENST00000325180.8 NP_001001560.1 ENST00000406772.1 non-canonical splice donor between exon 1 and 2 ENST00000406772.1 FLJ16562 ENST00000475445.1 FLJ39951 ENST00000417536.1 FLJ42389 ENST00000469947.1 FLJ44592 ENST00000456099.1 GENCODE experimental pipeline ENST00000456099.1 FLJ40472 ENST00000403251.1 FLJ32703 ENST00000493862.1 alternative 5' UTR ENST00000455236.1 non canonical TEC ENST00000407319.2 NP_619538.2 ENST00000403663.2 isoform 1 ENST00000403663.2 NP_008963.3 ENST00000498417.1 FLJ45678 ENST00000249079.2 FLJ32787 ENST00000249079.2 alternative 5' UTR ENST00000418863.1 alternative 5' UTR ENST00000422191.1 alternative 5' UTR ENST00000396884.2 alternative 5' UTR ENST00000427770.1 alternative 5' UTR ENST00000470555.1 not organism-supported ENST00000445628.1 alternative 5' UTR ENST00000424694.1 alternative 5' UTR ENST00000356976.3 alternative 5' UTR ENST00000435166.1 alternative 5' UTR ENST00000445483.1 GENCODE experimental pipeline ENST00000427592.1 alternative 5' UTR ENST00000455341.2 alternative 5' UTR ENST00000417948.1 alternative 5' UTR ENST00000407965.1 alternative 5' UTR ENST00000361906.3 alternative 5' UTR ENST00000504337.1 GENCODE experimental pipeline ENST00000420172.1 GENCODE experimental pipeline ENST00000359867.3 alternative 5' UTR ENST00000402865.1 alternative 3' UTR ENST00000400206.2 alternative 5' UTR ENST00000366216.2 alternative 3' UTR ENST00000430335.1 alternative 5' UTR ENST00000454123.1 GENCODE experimental pipeline ENST00000433230.1 GENCODE experimental pipeline ENST00000396821.3 NP_001091974.1 ENST00000403230.1 NP_006377.2 ENST00000439567.1 alternative 5' UTR ENST00000415483.1 alternative 5' UTR ENST00000355830.6 GENCODE experimental pipeline ENST00000541689.1 not organism-supported ENST00000411557.1 alternative 5' UTR ENST00000396811.2 alternative 5' UTR ENST00000416285.1 alternative 5' UTR ENST00000423346.1 GENCODE experimental pipeline ENST00000431924.1 GENCODE experimental pipeline ENST00000427389.1 alternative 5' UTR ENST00000412832.1 alternative 5' UTR ENST00000417712.1 alternative 5' UTR ENST00000456626.1 alternative 5' UTR ENST00000488787.1 alternative 5' UTR ENST00000470836.1 alternative 5' UTR ENST00000418695.1 GENCODE experimental pipeline ENST00000420118.1 GENCODE experimental pipeline ENST00000406622.1 alternative 5' UTR ENST00000438058.1 alternative 5' UTR ENST00000456894.1 alternative 5' UTR ENST00000420859.1 alternative 5' UTR ENST00000452294.1 Upstream_ATG-35 ENST00000452294.1 alternative 5' UTR ENST00000433561.1 alternative 5' UTR ENST00000417332.1 alternative 5' UTR ENST00000439339.1 alternative 5' UTR ENST00000418803.1 GENCODE experimental pipeline ENST00000416406.1 GENCODE experimental pipeline ENST00000450216.1 GENCODE experimental pipeline ENST00000513758.2 GENCODE experimental pipeline ENST00000414780.1 GENCODE experimental pipeline ENST00000430647.1 GENCODE experimental pipeline ENST00000441207.1 GENCODE experimental pipeline ENST00000381551.4 NP_148937.1 ENST00000462277.1 supported by ENCODE pre-submission sequence ENST00000480990.1 supported by ENCODE pre-submission sequence ENST00000429402.1 alternative 5' UTR ENST00000432239.1 GENCODE experimental pipeline ENST00000404569.1 alternative 5' UTR ENST00000434364.1 alternative 5' UTR ENST00000337304.2 alternative 5' UTR ENST00000402142.3 GENCODE experimental pipeline ENST00000435169.1 GENCODE experimental pipeline ENST00000420971.1 alternative 5' UTR ENST00000407075.3 alternative 5' UTR ENST00000424496.1 GENCODE experimental pipeline ENST00000333407.5 NP_612444 ENST00000473717.1 Uporf in exon 1 ENST00000441751.1 alternative 5' UTR ENST00000449200.1 GENCODE experimental pipeline ENST00000414261.1 GENCODE experimental pipeline ENST00000407029.1 alternative 5' UTR ENST00000417123.1 GENCODE experimental pipeline ENST00000438116.1 GENCODE experimental pipeline ENST00000442317.2 GENCODE experimental pipeline ENST00000424746.1 GENCODE experimental pipeline ENST00000498684.1 non-submitted evidence ENST00000479286.1 non-submitted evidence ENST00000476644.1 non-submitted evidence ENST00000466988.1 non-submitted evidence ENST00000465561.1 non-submitted evidence ENST00000472203.1 non-submitted evidence ENST00000467617.1 FLJ33445 ENST00000418783.1 GENCODE experimental pipeline ENST00000423293.1 GENCODE experimental pipeline ENST00000415054.1 GENCODE experimental pipeline ENST00000452297.1 GENCODE experimental pipeline ENST00000481902.1 FLJ39733 ENST00000441316.1 GENCODE experimental pipeline ENST00000455425.1 GENCODE experimental pipeline ENST00000405486.1 alternative 5' UTR ENST00000405383.1 alternative 5' UTR ENST00000455915.2 alternative 5' UTR ENST00000434408.1 alternative 5' UTR ENST00000476443.1 non-submitted evidence ENST00000359308.4 alternative 5' UTR ENST00000402966.1 FLJ23584 ENST00000402966.1 GENCODE experimental pipeline ENST00000402966.1 NP_001136436.1 ENST00000401548.3 MGC40042 ENST00000401548.3 GENCODE experimental pipeline ENST00000448085.1 GENCODE experimental pipeline ENST00000255784.5 GENCODE experimental pipeline ENST00000429249.1 alternative 5' UTR ENST00000333487.2 GENCODE experimental pipeline ENST00000333487.2 FLJ39598 ENST00000491541.1 DKFZp434N1610 ENST00000381348.4 GENCODE experimental pipeline ENST00000396426.3 NP_663786 ENST00000396425.3 NP_061979 ENST00000424613.1 GENCODE experimental pipeline ENST00000412113.1 not organism-supported ENST00000329620.5 FLJ46259 ENST00000436265.1 FLJ26145 ENST00000450250.1 GENCODE experimental pipeline ENST00000481068.1 non-submitted evidence ENST00000396398.3 alternative 5' UTR ENST00000403363.1 alternative 5' UTR ENST00000419475.1 alternative 5' UTR ENST00000416037.1 GENCODE experimental pipeline ENST00000417327.1 last two exons can be placed identically in two positions; see variants 002 and 006 for other permutations ENST00000439129.1 last two exons can be placed identically in two positions; see variants 002 and 004 for other permutations ENST00000536447.1 last two exons can be placed identically in two positions; see variants 004 and 006 for other permutations ENST00000396387.2 GENCODE experimental pipeline ENST00000428786.1 GENCODE experimental pipeline ENST00000420096.1 GENCODE experimental pipeline ENST00000412060.1 GENCODE experimental pipeline ENST00000428765.1 GENCODE experimental pipeline ENST00000323013.6 CGI-96 protein ENST00000527167.1 non-canonical splice acceptor site between exon 8 and exon 9 but canonical in the mRNA ENST00000407614.4 non-canonical splice donor site between exon 2 and exon 3 ENST00000407614.4 non canonical TEC ENST00000357802.2 FLJ40882 ENST00000357802.2 GENCODE experimental pipeline ENST00000505920.1 GENCODE experimental pipeline ENST00000401850.1 alternative 5' UTR ENST00000381278.3 alternative 5' UTR ENST00000426545.1 GENCODE experimental pipeline ENST00000452960.1 non-submitted evidence ENST00000453941.1 non-submitted evidence ENST00000456251.1 non-submitted evidence ENST00000440262.1 non-submitted evidence ENST00000487119.1 non-submitted evidence ENST00000505238.1 non-submitted evidence ENST00000496919.1 non-submitted evidence ENST00000473715.1 non-submitted evidence ENST00000403744.3 alternative 5' UTR ENST00000402229.1 alternative 5' UTR ENST00000423154.1 GENCODE experimental pipeline ENST00000443063.1 GENCODE experimental pipeline ENST00000446663.1 GENCODE experimental pipeline ENST00000396265.2 NP_009295.2 ENST00000428336.1 alternative 5' UTR ENST00000329563.4 alternative 5' UTR ENST00000419643.1 GENCODE experimental pipeline ENST00000458463.1 GENCODE experimental pipeline ENST00000450750.1 GENCODE experimental pipeline ENST00000431327.1 GENCODE experimental pipeline ENST00000431327.1 FLJ33524 ENST00000468552.1 KIAA1672 ENST00000476875.1 GENCODE experimental pipeline ENST00000474323.1 FLJ39696 ENST00000494795.1 FLJ33963 ENST00000430869.1 GENCODE experimental pipeline ENST00000477795.1 GENCODE experimental pipeline ENST00000381176.4 GENCODE experimental pipeline ENST00000406912.1 GENCODE experimental pipeline ENST00000434327.1 GENCODE experimental pipeline ENST00000415702.1 GENCODE experimental pipeline ENST00000423587.1 GENCODE experimental pipeline ENST00000435622.1 GENCODE experimental pipeline ENST00000334566.5 GENCODE experimental pipeline ENST00000443783.1 GENCODE experimental pipeline ENST00000454525.1 GENCODE experimental pipeline ENST00000432186.1 alternative 5' UTR ENST00000006251.7 NP_056181.2 ENST00000336985.6 NP_851850.1 ENST00000457960.1 alternative 5' UTR ENST00000475850.1 FLJ32225 ENST00000389774.2 NP_001017526 ENST00000460809.1 FLJ12243 ENST00000396119.2 alternative 5' UTR ENST00000356099.6 NP_851852.2 ENST00000412433.1 alternative 5' UTR ENST00000313237.5 NP_612424.1 ENST00000456225.1 GENCODE experimental pipeline ENST00000426282.1 GENCODE experimental pipeline ENST00000407019.2 NP_705931 ENST00000424634.1 alternative 5' UTR ENST00000417702.1 alternative 5' UTR ENST00000445721.1 alternative 5' UTR ENST00000396096.2 NP_705931 alternative_5'_UTR ENST00000432340.1 alternative 5' UTR ENST00000336156.4 NP_001009880.1 ENST00000251993.7 NP_056079.1 ENST00000445867.1 GENCODE experimental pipeline ENST00000216214.3 NP_001098065 ENST00000441876.2 alternative 5' UTR ENST00000427777.1 alternative 5' UTR ENST00000357450.4 NP_683515.3 ENST00000454439.1 GENCODE experimental pipeline ENST00000262722.7 NP_001987.2 ENST00000327858.6 NP_006477 ENST00000442170.2 NP_006476.2 ENST00000422971.1 GENCODE experimental pipeline ENST00000493643.1 GENCODE experimental pipeline ENST00000438230.1 GENCODE experimental pipeline ENST00000451118.1 GENCODE experimental pipeline ENST00000549666.1 non-submitted evidence ENST00000421538.1 GENCODE experimental pipeline ENST00000443490.1 alternative 5' UTR ENST00000435439.1 FLJ13362 ENST00000360737.3 FLJ27365 ENST00000439423.1 GENCODE experimental pipeline ENST00000412643.1 GENCODE experimental pipeline ENST00000314567.3 GENCODE experimental pipeline ENST00000381031.3 FLJ20699 ENST00000381031.3 GENCODE experimental pipeline ENST00000454366.1 NP_057510.3 ENST00000447383.1 GENCODE experimental pipeline ENST00000426112.1 GENCODE experimental pipeline ENST00000426112.1 FLJ34883 ENST00000337137.4 FLJ20844 ENST00000441162.1 FLJ43717 ENST00000434707.1 GENCODE experimental pipeline ENST00000434707.1 non canonical polymorphism ENST00000405369.3 GENCODE experimental pipeline ENST00000380990.1 GENCODE experimental pipeline ENST00000423737.1 GENCODE experimental pipeline ENST00000423737.1 FLJ35788 ENST00000413815.1 GENCODE experimental pipeline ENST00000449941.1 GENCODE experimental pipeline ENST00000457518.1 GENCODE experimental pipeline ENST00000414483.1 GENCODE experimental pipeline ENST00000446364.1 GENCODE experimental pipeline ENST00000453866.1 GENCODE experimental pipeline ENST00000407505.3 GENCODE experimental pipeline ENST00000380981.2 GENCODE experimental pipeline ENST00000433284.1 GENCODE experimental pipeline ENST00000391625.2 GENCODE experimental pipeline ENST00000393264.2 GENCODE experimental pipeline ENST00000420902.1 GENCODE experimental pipeline ENST00000447372.1 GENCODE experimental pipeline ENST00000216267.8 alternative 5' UTR ENST00000444011.1 GENCODE experimental pipeline ENST00000422315.1 GENCODE experimental pipeline ENST00000389983.2 GENCODE experimental pipeline ENST00000433387.1 GENCODE experimental pipeline ENST00000395842.2 NP_443071 ENST00000432455.1 alternative 5' UTR ENST00000453835.1 GENCODE experimental pipeline ENST00000395744.3 NP_055493.2 ENST00000474879.2 NP_149977.2 ENST00000252785.3 alternative 5' UTR ENST00000395680.1 alternative 5' UTR ENST00000395678.3 alternative 5' UTR ENST00000401779.1 GENCODE experimental pipeline ENST00000428989.2 NP_001014440.2 ENST00000406915.3 GENCODE experimental pipeline ENST00000312108.7 KIAA1670 ENST00000417176.1 alternative 5' UTR ENST00000453634.1 subject to nonsense-mediated decay ENST00000380711.3 GENCODE experimental pipeline ENST00000356098.5 alternative 5' UTR ENST00000395621.3 alternative 5' UTR ENST00000453344.2 NP_001078897.1 ENST00000395619.3 alternative 5' UTR ENST00000449652.1 GENCODE experimental pipeline ENST00000395613.2 GENCODE experimental pipeline ENST00000423888.1 GENCODE experimental pipeline ENST00000423888.1 This was annotated as coding due to similarity with FAM41C (SW:Q9NPS7.1 + SW:P0C7U8.1). However, this gene has been removed from Entrez gene. There are no significant pfam A bit ENST00000427528.1 GENCODE experimental pipeline ENST00000413505.1 alternative 5' UTR ENST00000399012.1 FLJ11323 ENST00000430923.2 alternative 5' UTR ENST00000445062.1 alternative 5' UTR ENST00000381657.2 alternative 5' UTR ENST00000429181.1 alternative 5' UTR ENST00000443019.1 alternative 5' UTR ENST00000415337.1 alternative 5' UTR ENST00000447472.1 alternative 5' UTR ENST00000448477.1 alternative 5' UTR ENST00000485332.1 novel transcript ENST00000400701.3 pseudoautosomal GTP-binding protein-like (PGPL) ENST00000452144.1 fatty acid binding protein 5 (psoriasis-associated) (FABP5) pseudogene ENST00000431919.1 pseudogene similar to part of keratin 18 (KRT18) ENST00000436474.1 ribosomal protein L14 (RPL14) pseudogene ENST00000381529.3 colony stimulating factor 2 receptor alpha chain isoform a precursor ENST00000381524.3 colony stimulating factor 2 receptor alpha chain isoform a precursor ENST00000355805.2 colony stimulating factor 2 receptor alpha chain isoform e precursor ENST00000486791.1 colony stimulating factor 2 receptor alpha chain isoform d precursor ENST00000355432.3 colony stimulating factor 2 receptor alpha chain isoform b precursor ENST00000381500.1 colony stimulating factor 2 receptor alpha chain isoform c precursor ENST00000331035.4 interleukin 3 receptor, alpha (low affinity) (IL3R, CD123, IL3RX, IL3RY, IL3RAY, hIL-3Ra, MGC34174) ENST00000432757.1 interleukin 3 receptor, alpha (low affinity) (IL3R, CD123, IL3RX, IL3RY, IL3RAY, hIL-3Ra, MGC34174) ENST00000381401.5 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (ANT3, ANT3Y, MGC17525) ENST00000475167.1 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (ANT3, ANT3Y, MGC17525) ENST00000484026.1 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (ANT3, ANT3Y, MGC17525) ENST00000447786.1 alternatively spliced 5' UTR, shares CDS with bA261P4.2.1 (partial) ENST00000447786.1 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (ANT3, ANT3Y, MGC17525) ENST00000447786.1 alternative 5' UTR ENST00000430235.1 putative novel transcript ENST00000419737.1 novel protein (FLJ13330) ENST00000381333.4 acetylserotonin O-methyltransferase-like (ASTML, ASMTLX) ENST00000381317.3 acetylserotonin O-methyltransferase-like (ASTML, ASMTLX) ENST00000463763.1 acetylserotonin O-methyltransferase-like (ASTML, ASMTLX) ENST00000462195.1 acetylserotonin O-methyltransferase-like (ASTML, ASMTLX) ENST00000474865.1 acetylserotonin O-methyltransferase-like (ASTML, ASMTLX) ENST00000381297.4 novel protein (LOC286530) ENST00000460672.1 novel transcript ENST00000381241.3 acetylserotonin O-methyltransferase (ASMTY, HIOMT, HIOMTY) ENST00000381229.4 acetylserotonin O-methyltransferase (ASMTY, HIOMT, HIOMTY) ENST00000381233.3 acetylserotonin O-methyltransferase (ASMTY, HIOMT, HIOMTY) ENST00000432523.1 acetylserotonin O-methyltransferase (ASMTY, HIOMT, HIOMTY) ENST00000509780.1 putative novel transcript ENST00000427886.1 putative novel transcript ENST00000432272.1 putative novel transcript ENST00000453953.1 putative novel transcript ENST00000381222.2 Ac-like transposable element ENST00000381218.3 alternative 5' UTR ENST00000461691.1 alternative 5' UTR ENST00000430562.1 novel transcript ENST00000414513.2 novel transcript ENST00000445785.1 novel transcript ENST00000381192.3 CD99 antigen ENST00000381187.3 CD99 antigen ENST00000381184.1 CD99 antigen ENST00000381180.3 CD99 antigen ENST00000449611.1 CD99 antigen ENST00000482293.1 CD99 antigen ENST00000497752.1 CD99 antigen ENST00000381177.1 CD99 antigen ENST00000419513.2 NP_001135391 ENST00000520904.1 alternative 5' UTR ENST00000445107.1 novel transcript ENST00000381154.1 arylsulfatase D ENST00000458014.1 arylsulfatase D ENST00000495294.1 arylsulfatase D, variant ENST00000217890.6 arylsulfatase D ENST00000481340.1 arylsulfatase D ENST00000494870.1 arylsulfatase D ENST00000414053.1 novel transcript ENST00000381134.3 arylsulfatase E (chondrodysplasia punctata 1) ENST00000438544.1 arylsulfatase E (chondrodysplasia punctata 1) ENST00000438544.1 alternative 5' UTR ENST00000483425.1 arylsulfatase E (chondrodysplasia punctata 1) ENST00000496095.1 arylsulfatase E (chondrodysplasia punctata 1) ENST00000381127.1 arylsulfatase F ENST00000359361.2 arylsulfatase F ENST00000359361.2 alternative 5' UTR ENST00000443851.1 ribosomal protein S24 (RPS24) pseudogene ENST00000457435.1 novel protein ENST00000381114.1 adlican (DKFZp564I1922) ENST00000439462.1 argininosuccinate synthetase (ASS) pseudogene ENST00000262848.5 protein kinase, X-linked ENST00000462736.1 protein kinase, X-linked ENST00000496648.1 protein kinase, X-linked ENST00000425240.1 protein kinase, X-linked ENST00000414074.1 novel transcript ENST00000329806.4 ribosomal protein S27a (RPS27A) pseudogene ENST00000492160.1 novel transcript ENST00000483854.1 novel transcript ENST00000475317.1 novel transcript ENST00000469903.1 novel transcript ENST00000471090.1 novel transcript ENST00000486571.1 novel transcript ENST00000490920.1 novel transcript ENST00000424415.1 novel transcript ENST00000451781.1 novel transcript ENST00000420725.1 novel transcript ENST00000428247.1 NADH dehydrogenase 6 (MTND6) pseudogene ENST00000440559.1 cytochrome b (MTCYB) pseudogene ENST00000434972.1 hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit (HADHB)(HADH) pseudogene ENST00000422914.1 putative novel transcript ENST00000444185.1 putative novel transcript ENST00000456559.1 putative novel transcript ENST00000477079.1 neuroligin 4 (HLNX, HNLX, NLGN, KIAA1260, MGC22376) ENST00000381095.3 neuroligin 4 (HLNX, HNLX, NLGN, KIAA1260, MGC22376) ENST00000275857.6 neuroligin 4 (HLNX, HNLX, NLGN, KIAA1260, MGC22376) ENST00000381092.1 neuroligin 4 (HLNX, HNLX, NLGN, KIAA1260, MGC22376) ENST00000469740.1 neuroligin 4 (HLNX, HNLX, NLGN, KIAA1260, MGC22376) ENST00000483337.1 neuroligin 4 (HLNX, HNLX, NLGN, KIAA1260, MGC22376) ENST00000453006.1 novel pseudogene ENST00000430377.1 novel pseudogene ENST00000437297.1 ribosomal protein S5 (RPS5) pseudogene ENST00000381089.3 variable charge protein on X with eight repeats (VCX-8r) (VCX-A) ENST00000438499.1 novel transcript ENST00000463344.1 ribosomal protein S27a (RPS27A) pseudogene ENST00000381077.5 NP_036212 ENST00000424830.2 NP_001129037 ENST00000447553.1 ribosomal protein, large, P1 (RPLP1) pseudogene ENST00000217961.4 steroid sulfatase (microsomal), arylsulfatase C, isozyme S ENST00000381042.4 GS2 protein (DXS1283E) ENST00000442940.1 GS2 protein (DXS1283E) ENST00000422160.1 putative novel transcript ENST00000317103.4 variable charge protein on X with two repeats (VCX-2r) (VCXB) ENST00000262648.3 Kallmann syndrome 1 sequence ENST00000481896.1 Kallmann syndrome 1 sequence ENST00000488294.1 Kallmann syndrome 1 sequence ENST00000437611.1 novel pseudogene ENST00000381003.3 NP_777611 ENST00000381003.3 family with sequence similarity 9, member A ENST00000422795.1 novel pseudogene ENST00000440430.1 putative novel transcript ENST00000436419.1 nucleolar and coiled-body phosphoprotein 1 (NOLC1)(P130, NOPP130, NOPP140, KIAA0035) pseudogene ENST00000362066.3 family with sequence similarity 9, member B ENST00000461107.1 family with sequence similarity 9, member B ENST00000494744.1 family with sequence similarity 9, member B ENST00000434191.1 uncharacterized hematopoietic stem/progenitor cells protein MDS027 (MDS207) pseudogene ENST00000432442.1 novel transcript (LOC159036) ENST00000416620.1 chromodomain protein, Y chromosome-like (CDYL) pseudogene ENST00000441088.1 transducin (beta)-like 1X-linked (EBI, TBL1) ENST00000441088.1 alternative 5'UTR; shares CDS with Em:AC003036.1.2 and Em:AC003036.1.6 ENST00000441088.1 alternative 5' UTR ENST00000380961.1 transducin (beta)-like 1X-linked (EBI, TBL1) ENST00000380961.1 alternative 5'UTR; shares CDS with Em:AC003036.1.4 and Em:AC003036.1.5 ENST00000380961.1 alternative 5' UTR ENST00000415293.1 transducin (beta)-like 1X-linked (EBI, TBL1) ENST00000415293.1 alternative 5' UTR ENST00000415293.1 alternative 5'UTR; shares CDS with Em:AC003036.1.1 and Em:AC003036.1.5 ENST00000217964.7 transducin (beta)-like 1X-linked (EBI, TBL1) ENST00000217964.7 alternative 5'UTR; shares CDS with Em:AC003036.1.3 and Em:AC003036.1.6 ENST00000217964.7 alternative 5' UTR ENST00000422314.1 transducin (beta)-like 1X-linked (EBI, TBL1) ENST00000422314.1 alternative 5'UTR; shares CDS with Em:AC003036.1.1 and Em:AC003036.1.4 ENST00000422314.1 alternative 5' UTR ENST00000452824.1 transducin (beta)-like 1X-linked (EBI, TBL1) ENST00000452824.1 alternative 5'UTR; shares CDS with Em:AC003036.1.2 and Em:AC003036.1.3 ENST00000452824.1 alternative 5' UTR ENST00000497555.1 transducin (beta)-like 1X-linked (EBI, TBL1) ENST00000467482.1 ocular albinism 1 (Nettleship-Falls) ENST00000487206.1 ocular albinism 1 (Nettleship-Falls) ENST00000447366.1 ocular albinism 1 (Nettleship-Falls) ENST00000431126.1 ocular albinism 1 (Nettleship-Falls) ENST00000480178.1 ocular albinism 1 (Nettleship-Falls) ENST00000380913.3 apical protein-like (Xenopus laevis) ENST00000493668.1 apical protein-like (Xenopus laevis) ENST00000452575.1 apical protein-like (Xenopus laevis) (FLJ39277) ENST00000400019.2 eukaryotic translation initiation factor 5 (EIF5) pseudogene ENST00000432945.1 high-mobility group nucleosome binding domain 1 (HMGN1) pseudogene ENST00000380861.4 5' UTR ENST00000380861.4 novel protein (KIAA1280) (contains DKFZp761A1124, FLJ21030, FLJ34617) similar to KIBRA ENST00000466248.1 novel transcript ENST00000430057.1 putative novel transcript ENST00000380833.4 chloride channel 4 ENST00000380829.1 chloride channel 4 ENST00000454850.1 chloride channel 4 ENST00000454113.1 novel transcript ENST00000380785.1 midline 1 (Opitz/BBB syndrome) ENST00000380779.1 midline 1 (Opitz/BBB syndrome) ENST00000380779.1 alternatively spliced in 5' UTR, shares CDS with Em:AC117406.1.1 ENST00000380779.1 alternative 5' UTR ENST00000380787.1 midline 1 (Opitz/BBB syndrome) ENST00000380787.1 alternatively spliced in 5' UTR, shares CDS with Em:AC117406.1.1 ENST00000380787.1 alternative 5' UTR ENST00000380780.1 midline 1 (Opitz/BBB syndrome) ENST00000380780.1 alternatively spliced in 5' UTR, shares CDS with Em:AC117406.1.1 ENST00000380780.1 alternative 5' UTR ENST00000380782.1 midline 1 (Opitz/BBB syndrome) ENST00000380782.1 non-canonical splicing between exons 6 and 7 ENST00000479925.1 midline 1 (Opitz/BBB syndrome) ENST00000413894.1 midline 1 (Opitz/BBB syndrome) ENST00000423614.1 midline 1 (Opitz/BBB syndrome) ENST00000423614.1 alternatively spliced in 5' UTR, shares partial CDS with Em:AC117406.1.1 ENST00000423614.1 alternative 5' UTR ENST00000433747.1 novel transcript ENST00000321143.4 holocytochrome c synthase (cytochrome c heme-lyase) ENST00000380763.3 holocytochrome c synthase (cytochrome c heme-lyase) ENST00000380762.4 holocytochrome c synthase (cytochrome c heme-lyase) ENST00000380736.1 Rho GTPase activating protein 6 ENST00000303025.6 Rho GTPase activating protein 6 ENST00000337414.4 Rho GTPase activating protein 6 ENST00000380718.1 Rho GTPase activating protein 6 ENST00000491514.1 Rho GTPase activating protein 6 ENST00000446186.1 glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) (GOT2) pseudogene ENST00000422830.1 LIM domain kinase 2 (LIMK2) pseudogene ENST00000337339.2 NP_523352 ENST00000476743.1 alternative 5' UTR ENST00000380693.3 NP_006791 ENST00000380692.2 alternative 5' UTR ENST00000467141.1 male-specific lethal 3-like 1 (Drosophila) ENST00000380682.1 novel protein (KIAA0316) ENST00000425057.1 putative novel transcript ENST00000443728.1 ribosomal protein L17 (RPL17) pseudogene ENST00000457574.1 proteasome (prosome, macropain) subunit, alpha (PSMA6) pseudogene ENST00000453682.1 mitochondrial ribosomal protein L35 (MRPL35) pseudogene ENST00000380659.3 toll-like receptor 7 ENST00000484204.1 toll-like receptor 7 ENST00000451564.1 novel transcript ENST00000451311.2 alternative 5' UTR ENST00000380636.1 alternative 5' UTR ENST00000380633.1 alternative 5' UTR ENST00000380625.3 family with sequence similarity 9, member C ENST00000333995.3 alternative 3' UTR ENST00000438997.1 family with sequence similarity 9, member C ENST00000438997.1 alternative 3' UTR ENST00000412485.1 novel transcript ENST00000431486.1 novel transcript ENST00000458400.1 novel pseudogene ENST00000419566.1 novel transcript ENST00000456091.1 novel transcript ENST00000420403.1 putative novel transcript ENST00000446964.1 putative novel transcript ENST00000388829.3 glutathione peroxidase 1 (GPX1) pseudogene ENST00000361306.1 EGF-like-domain multiple 6 ENST00000380602.3 EGF-like-domain multiple 6 ENST00000473826.1 EGF-like-domain multiple 6 ENST00000457129.1 ribosomal protein L30 (RPL30) pseudogene ENST00000490617.1 novel transcript ENST00000380600.1 novel protein ENST00000467590.1 novel protein (FLJ39713) ENST00000463321.1 novel transcript ENST00000464506.1 RAB9A member RAS oncogene family ENST00000243325.5 RAB9A member RAS oncogene family ENST00000518847.1 alternative 5' UTR ENST00000340096.6 oral-facial-digital syndrome 1 ENST00000380567.1 oral-facial-digital syndrome 1 ENST00000485052.1 oral-facial-digital syndrome 1 ENST00000490265.1 oral-facial-digital syndrome 1 ENST00000466534.1 oral-facial-digital syndrome 1 ENST00000464463.1 oral-facial-digital syndrome 1 ENST00000474705.1 oral-facial-digital syndrome 1 ENST00000434674.1 putative novel transcript ENST00000316715.4 NP_001001995 ENST00000454189.2 NP_001001994 ENST00000355135.2 NP_001001996 ENST00000493085.1 alternative 5' UTR ENST00000468080.1 alternative 5' UTR ENST00000475307.1 alternative 5' UTR ENST00000448948.1 novel transcript ENST00000391359.2 novel transcript ENST00000380523.4 novel protein (FLJ20514) ENST00000398355.3 novel protein ENST00000332885.3 novel protein ENST00000460203.1 novel transcript ENST00000477386.1 novel transcript ENST00000411687.1 ubiquitin-conjugating enzyme E2E 3 (UBC4/5 homolog, yeast) (UBE2E3) pseudogene ENST00000218075.4 glycine receptor alpha 2 ENST00000355020.4 NP_001112358 ENST00000415367.1 glycine receptor alpha 2 ENST00000453156.1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1) pseudogene ENST00000324138.3 novel protein (FLJ34064) ENST00000452869.1 alternative 5' UTR ENST00000489126.1 novel transcript ENST00000380492.3 novel protein (MGC26706) ENST00000497603.1 novel transcript ENST00000482354.1 novel transcript ENST00000461777.1 novel transcript ENST00000495110.1 novel transcript ENST00000460386.1 novel transcript ENST00000448018.1 tumor protein, translationally-controlled 1 (TPT1) pseudogene ENST00000444401.1 ribosomal protein L35a (RPL35A) pseudogene ENST00000477346.1 ankyrin repeat and SOCS box-containing 9 ENST00000380483.3 ankyrin repeat and SOCS box-containing 9 ENST00000380485.3 ankyrin repeat and SOCS box-containing 9 ENST00000380488.4 ankyrin repeat and SOCS box-containing 9 ENST00000473862.1 ankyrin repeat and SOCS box-containing 9 ENST00000481384.1 ankyrin repeat and SOCS box-containing 9 ENST00000484017.1 ankyrin repeat and SOCS box-containing 9 ENST00000470015.1 ankyrin repeat and SOCS box-containing 9 ENST00000344384.4 NP_001012428 ENST00000333590.4 phosphatidylinositol glycan, class A (paroxysmal nocturnal hemoglobinuria) ENST00000482148.1 phosphatidylinositol glycan, class A (paroxysmal nocturnal hemoglobinuria) ENST00000475746.1 phosphatidylinositol glycan, class A (paroxysmal nocturnal hemoglobinuria) ENST00000463173.1 phosphatidylinositol glycan, class A (paroxysmal nocturnal hemoglobinuria) ENST00000474662.1 phosphatidylinositol glycan, class A (paroxysmal nocturnal hemoglobinuria) ENST00000297904.3 c-fos induced growth factor (vascular endothelial growth factor D) ENST00000488351.1 c-fos induced growth factor (vascular endothelial growth factor D) ENST00000380420.5 Pirin (PIR) ENST00000380421.3 Pirin (PIR) ENST00000380421.3 alternatively spliced 5'UTR, shared CDS with .1.1 ENST00000380421.3 alternative 5' UTR ENST00000492432.1 novel transcript ENST00000484433.1 novel transcript ENST00000476381.1 novel transcript ENST00000471725.1 novel transcript ENST00000357607.2 BMX non-receptor tyrosine kinase ENST00000348343.6 BMX non-receptor tyrosine kinase ENST00000348343.6 alternatively spliced 5' UTR, shares CDS with .2.1 ENST00000348343.6 alternative 5' UTR ENST00000466843.1 BMX non-receptor tyrosine kinase ENST00000463891.1 BMX non-receptor tyrosine kinase ENST00000463891.1 this variant and variant fragment .2.6 could be part of a single variant. ENST00000342014.6 BMX non-receptor tyrosine kinase ENST00000342014.6 alternatively spliced 5' UTR, shares CDS with .2.1 ENST00000342014.6 alternative 5' UTR ENST00000489983.1 BMX non-receptor tyrosine kinase ENST00000489983.1 this variant and variant fragment .2.5 could be part of a single variant. ENST00000252519.3 angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 ENST00000471548.1 angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 ENST00000473851.1 angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 ENST00000484756.1 angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 ENST00000421585.1 putative novel transcript ENST00000380342.3 kidney-specific membrane protein (NX17) ENST00000334569.3 novel pseudogene ENST00000498004.1 alternative 5' UTR ENST00000479740.1 alternative 5' UTR ENST00000307771.7 U2 small nuclear ribonucleoprotein auxiliary factor, small subunit 2 (U2AF1RS2) ENST00000380308.3 U2 small nuclear ribonucleoprotein auxiliary factor, small subunit 2 (U2AF1RS2) ENST00000468028.1 U2 small nuclear ribonucleoprotein auxiliary factor, small subunit 2 (U2AF1RS2) ENST00000329235.2 adaptor-related protein complex 1, sigma 2 subunit ENST00000452376.1 adaptor-related protein complex 1, sigma 2 subunit ENST00000380291.1 adaptor-related protein complex 1, sigma 2 subunit ENST00000479184.1 adaptor-related protein complex 1, sigma 2 subunit ENST00000450644.1 adaptor-related protein complex 1, sigma 2 subunit ENST00000412724.1 SET translocation (myeloid leukemia-associated) (SET) pseudogene ENST00000380289.2 gastrin-releasing peptide receptor ENST00000435789.1 novel transcript ENST00000422438.1 novel transcript ENST00000400003.1 expression from this locus is supported by Chomez et al. (2001) Cancer Res. 61(14):5544-51 ENST00000443382.1 ribosomal protein L6 (RPL6) pseudogene ENST00000447112.1 heat shock protein pseudogene ENST00000380241.3 CTP synthase II (FLJ14008, FLJ13487) ENST00000380241.3 FLJ14008, FLJ13487 ENST00000359276.4 CTP synthase II ENST00000483053.1 CTP synthase II (FLJ14008, FLJ13487) ENST00000380200.3 calbindin 3, (vitamin D-dependent calcium binding protein) ENST00000380122.5 FLJ11209 ENST00000441100.1 ribosomal protein L12 (RPL12) pseudogene ENST00000465244.1 FLJ45403 ENST00000426556.1 novel pseudogene ENST00000470686.1 FLJ32565 ENST00000453841.1 chromobox homolog 5 (HP1 alpha homolog, Drosophila) (CBX5) pseudogene ENST00000439415.1 chromobox homolog 5 (HP1 alpha homolog, Drosophila) (CBX5) pseudogene ENST00000398097.3 NP_001129496.1 ENST00000485305.1 putative novel transcript ENST00000433228.1 novel transcript ENST00000452788.1 putative novel transcript ENST00000427102.1 calcium binding protein P22 (CHP)pseudogene ENST00000380041.3 NP_001032629 ENST00000380043.3 NP_006737 ENST00000419185.1 alternative 5' UTR ENST00000331511.1 retinoic acid induced 2 ENST00000360011.1 retinoic acid induced 2 ENST00000360011.1 alternative 5' UTR ENST00000509491.1 novel transcript ENST00000418200.1 Mdm4, transformed 3T3 cell double minute 4, p53 binding protein (mouse)(MDM4) pseudogene ENST00000453902.1 novel transcript ENST00000380033.4 novel protein (MGC33653) ENST00000251900.4 sex comb on midleg-like 2 (Drosophila) ENST00000420857.1 sex comb on midleg-like 2 (Drosophila) ENST00000491988.1 sex comb on midleg-like 2 (Drosophila) ENST00000416049.1 thymosin, beta 10 (TMSB10) pseudogene ENST00000379996.3 cyclin-dependent kinase-like 5 ENST00000379989.3 continued from bA558P14.1.1 in Em:AL109798 ENST00000379989.3 cyclin-dependent kinase-like 5 ENST00000463994.1 cyclin-dependent kinase-like 5 ENST00000415117.1 gap junction protein, alpha 2, 38kDa (connexin 38) (GJA2) pseudogene ENST00000379984.3 retinoschisis (X-linked, juvenile) 1 ENST00000476595.1 retinoschisis (X-linked, juvenile) 1 ENST00000358001.4 pallidin homolog (mouse) (PLDN) pseudogene ENST00000439908.1 novel pseudogene ENST00000439295.1 novel transcript ENST00000452900.1 novel transcript ENST00000379942.4 phosphorylase kinase, alpha 2 (liver) ENST00000481718.1 phosphorylase kinase, alpha 2 (liver) ENST00000469485.1 phosphorylase kinase, alpha 2 (liver) ENST00000473597.1 phosphorylase kinase, alpha 2 (liver) ENST00000473739.1 phosphorylase kinase, alpha 2 (liver) ENST00000469645.1 phosphorylase kinase, alpha 2 (liver) ENST00000486231.1 phosphorylase kinase, alpha 2 (liver) ENST00000464455.1 phosphorylase kinase, alpha 2 (liver) ENST00000423505.1 pyruvate dehydrogenase (lipoamide) alpha 1 ENST00000417819.1 pyruvate dehydrogenase (lipoamide) alpha 1 ENST00000422285.2 pyruvate dehydrogenase (lipoamide) alpha 1 ENST00000492364.1 pyruvate dehydrogenase (lipoamide) alpha 1 ENST00000355808.5 pyruvate dehydrogenase (lipoamide) alpha 1 ENST00000379805.3 pyruvate dehydrogenase (lipoamide) alpha 1 ENST00000479146.1 pyruvate dehydrogenase (lipoamide) alpha 1 ENST00000481733.1 pyruvate dehydrogenase (lipoamide) alpha 1 ENST00000379804.1 pyruvate dehydrogenase (lipoamide) alpha 1 ENST00000478795.1 pyruvate dehydrogenase (lipoamide) alpha 1 ENST00000397821.3 SH3-domain kinase binding protein 1 (CIN85) ENST00000379716.1 SH3-domain kinase binding protein 1 (CIN85) ENST00000379698.4 SH3-domain kinase binding protein 1 (CIN85) ENST00000379726.3 SH3-domain kinase binding protein 1 (CIN85) ENST00000379697.3 SH3-domain kinase binding protein 1 (CIN85) ENST00000494961.1 SH3-domain kinase binding protein 1 (CIN85) ENST00000477102.1 SH3-domain kinase binding protein 1 (CIN85) ENST00000432234.1 SH3-domain kinase binding protein 1 (CIN85) ENST00000431164.1 SH3-domain kinase binding protein 1 (CIN85) ENST00000379687.3 novel protein (LOC256643) ENST00000379687.3 N-terminal of protein extended by 50 amino acids from match to mouse Em:AK044001.1 ENST00000472158.1 novel protein ENST00000466702.1 novel transcript ENST00000471203.1 novel transcript ENST00000340625.3 novel protein (FLH37342) ENST00000451208.1 novel transcript ENST00000456553.1 novel transcript ENST00000485173.1 non-canonical donor splice site at 10th exon ENST00000485173.1 non canonical TEC ENST00000485173.1 novel transcript ENST00000466145.1 novel transcript ENST00000379607.5 eukaryotic translation initiation factor 1A (EIF4C, EIF1AX, eIF-1A, eIF-4C) ENST00000379593.1 eukaryotic translation initiation factor 1A (EIF4C, EIF1AX, eIF-1A, eIF-4C) ENST00000424026.1 putative novel transcript ENST00000279451.4 connector enhancer of KSR2 (KIAA0902) ENST00000379510.3 connector enhancer of KSR2 (KIAA0902) ENST00000480138.1 connector enhancer of KSR2 (KIAA0902) ENST00000479158.1 this variant and variant fragment .1.4 could be part of a single variant ENST00000479158.1 connector enhancer of KSR2 (KIAA0902) ENST00000485012.1 this variant and variant fragment .1.3 could be part of a single variant ENST00000485012.1 connector enhancer of KSR2 (KIAA0902) ENST00000457739.1 retinoic acid receptor responder (tazarotene induced) 2 (RARRES2) (TIG2) pseudogene ENST00000379494.3 small muscle protein, X-linked ENST00000494525.1 small muscle protein, X-linked ENST00000465888.1 novel transcript ENST00000429584.2 novel protein FLJ34531 similar to YY1 transcription factor ENST00000449605.1 DKFZp547D1617 ENST00000424650.1 FLJ37866 ENST00000455399.1 novel transcript ENST00000456621.1 novel transcript ENST00000415522.1 MraW methylase family pseudogene ENST00000422934.1 ribosomal protein L26 (RPL26) pseudogene ENST00000442155.1 putative novel transcript ENST00000312214.5 family with sequence similarity 3, member C (FAM3C) pseudogene ENST00000419302.1 pseudogene similar to part of VIAF1 (IAP-associated factor VIAF1) ENST00000379361.4 FLJ30296 ENST00000445047.1 novel pseudogene ENST00000379349.1 peroxiredoxin 4 ENST00000379341.4 peroxiredoxin 4 ENST00000495599.1 peroxiredoxin 4 ENST00000439422.1 peroxiredoxin 4 ENST00000379303.5 NP_001032248 ENST00000366134.2 novel transcript ENST00000379270.4 spermidine/spermine N1-acetyltransferase ENST00000379253.3 spermidine/spermine N1-acetyltransferase ENST00000379251.3 spermidine/spermine N1-acetyltransferase ENST00000379254.1 spermidine/spermine N1-acetyltransferase ENST00000489394.1 spermidine/spermine N1-acetyltransferase ENST00000463236.1 spermidine/spermine N1-acetyltransferase ENST00000487713.1 spermidine/spermine N1-acetyltransferase ENST00000474223.1 spermidine/spermine N1-acetyltransferase ENST00000462639.1 spermidine/spermine N1-acetyltransferase ENST00000379226.4 novel protein (MGC4825) ENST00000476598.1 novel transcript ENST00000439528.1 novel protein (MGC4825) ENST00000439528.1 variant 4; alternatively spliced in 3' UTR ENST00000490078.1 novel protein ENST00000379211.3 novel protein (FLJ25444) ENST00000435707.1 novel protein ENST00000328046.8 novel protein (KIAA1677) ENST00000253039.4 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa ENST00000487075.1 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa ENST00000423068.1 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa ENST00000460032.1 eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa ENST00000457332.1 putative novel transcript ENST00000427551.1 novel transcript ENST00000497813.1 zinc finger protein, X-linked ENST00000428571.1 zinc finger protein, X-linked ENST00000419690.1 zinc finger protein, X-linked ENST00000379177.1 zinc finger protein, X-linked ENST00000304543.5 zinc finger protein, X-linked ENST00000459724.1 zinc finger protein, X-linked ENST00000480195.1 zinc finger protein, X-linked ENST00000338565.3 zinc finger protein, X-linked ENST00000474385.1 zinc finger protein, X-linked ENST00000486479.1 transcription factor (p38 interacting protein) (P38IP) pseudogene ENST00000436466.1 transcription factor (p38 interacting protein) (P38IP) pseudogene ENST00000419089.1 ribosomal protein S26 (RPS26) pseudogene ENST00000379162.4 pyruvate dehydrogenase kinase isoenzyme 3 ENST00000379162.4 pyruvate dehydrogenase kinase, isoenzyme 3 ENST00000441463.2 NP_001135858.1 ENST00000493226.1 pyruvate dehydrogenase kinase isoenzyme 3 ENST00000436794.1 small nuclear ribonucleoprotein polypeptide E (SNRPE) pseudogene ENST00000379145.1 phosphate cytidylyltransferase 1 choline beta isoform ENST00000379144.2 phosphate cytidylyltransferase 1 choline beta isoform ENST00000356768.4 phosphate cytidylyltransferase 1 choline beta isoform ENST00000492876.1 phosphate cytidylyltransferase 1 choline beta isoform ENST00000496020.1 phosphate cytidylyltransferase 1 choline beta isoform ENST00000458741.1 histone 1 H2bb (HIST1H2BB) pseudogene ENST00000432626.1 putative novel transcript ENST00000453977.1 ribosomal protein L23 (RPL23) pseudogene ENST00000379068.3 polymerase (DNA directed), alpha ENST00000379059.3 polymerase (DNA directed), alpha ENST00000493342.1 polymerase (DNA directed), alpha ENST00000480125.1 polymerase (DNA directed), alpha ENST00000494204.1 this variant and variant fragment Em:AC079375.1.3 could form part of one single variant ENST00000494204.1 polymerase (DNA directed), alpha ENST00000438281.1 platelet-activating factor acetylhydrolase, isoform Ib, beta subunit 30kDa (PAFAH1B2) pseudogene ENST00000433306.1 methyltransferase-like 1 (METTL1) pseudogene ENST00000426762.1 ribonuclease P1 (RNASEP1) pseudogene ENST00000496795.1 RAN binding protein 1 (RANBP1) pseudogene ENST00000423914.1 novel transcript ENST00000325250.1 novel protein (MGC33889) (FLJ32799) similar to melanoma antigen (MAGE) family B proteins ENST00000436203.1 pseudogene similar to melanoma antigen (MAGE) family B proteins ENST00000416929.1 melanoma antigen pseudogene ENST00000444765.1 pseudogene similar to part of melanoma antigen family B proteins ENST00000379034.1 melanoma antigen, family B, 6 (MAGEB6) (FLJ40442) ENST00000450430.1 pseudogene similar to part of melanoma antigen family B proteins ENST00000379029.1 melanoma antigen, family B, 5 (MAGEB5) ENST00000379029.1 possibly a pseudogene ENST00000446214.1 pseudogene similar to part of melanoma antigen family proteins ENST00000438690.1 MAWD binding protein (MAWBP) pseudogene ENST00000439323.1 formin 2 (FMN2) pseudogene ENST00000420915.1 VENT-like homeobox 2 pseudogene 1 (VENTX2P1) ENST00000420915.1 possible expressed pseudogene - mRNA Em:AF164963.1 is associated with this locus ENST00000431868.1 pseudogene similar to part of adaptor-related protein complex 3, sigma 1 subunit (AP3S1) ENST00000402913.2 ribosomal protein L7 (RPL7) pseudogene ENST00000415560.1 high mobility group AT-hook 1 (HMGA1) pseudogene ENST00000436019.1 novel transcript ENST00000422048.1 novel transcript ENST00000452559.1 novel pseudogene ENST00000420305.1 protein tyrosine phosphatase type IVA family pseudogene ENST00000412172.1 novel pseudogene ENST00000424882.1 pseudogene similar to part of radixin (RDX) ENST00000367074.3 pseudogene similar to part of radixin (RDX) ENST00000431122.1 putative novel transcript ENST00000451261.1 H326 pseudogene ENST00000356790.2 FLJ32965 ENST00000450488.1 MAGE family pseudogene ENST00000432774.1 MAGE family pseudogene ENST00000456549.1 pseudogene similar to part of adipose differentiation-related protein (ADFP) ENST00000457557.1 MAGE family pseudogene ENST00000421897.1 novel pseudogene ENST00000449607.1 pseudogene similar to part of origin recognition complex, subunit 1-like (yeast) (ORC1L) ENST00000456037.1 putative novel transcript ENST00000378993.1 interleukin 1 receptor accessory protein-like 1 ENST00000416765.1 H3 histone, family 3B (H3.3B) (H3F3B) pseudogene ENST00000424251.1 putative novel transcript ENST00000416609.1 pseudogene similar to part of transcription factor p38 interacting protein (P38IP) ENST00000441918.1 phosphatidylinositol glycan, class F (PIGF) pseudogene ENST00000378988.4 melanoma antigen, family B, 2 ENST00000378986.1 melanoma antigen, family B, 3 ENST00000378981.3 melanoma antigen, family B, 1 ENST00000378970.4 nuclear receptor subfamily 0, group B, member 1 ENST00000378963.1 nuclear receptor subfamily 0, group B, member 1 ENST00000378962.3 novel protein (FLJ11577) ENST00000378946.3 NP_976325 ENST00000441146.1 novel transcript ENST00000378933.1 novel protein (MGC45404) ENST00000467136.1 novel protein ENST00000378928.1 novel protein ENST00000445240.1 novel transcript ENST00000378723.3 NP_004007 ENST00000378677.2 NP_004000 ENST00000378702.4 NP_004006 ENST00000474231.1 NP_004012 ENST00000472266.1 dystrophin (muscular dystrophy, Duchenne and Becker types) ENST00000458237.1 nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1) pseudogene ENST00000439592.1 putative novel transcript ENST00000436520.1 tubulin-specific chaperone a (TBCA) pseudogene ENST00000399993.2 lysosomal-associated membrane protein 1 (LAMP1) pseudogene ENST00000439992.1 novel transcript ENST00000445233.1 novel transcript ENST00000482930.1 ferritin, heavy polypeptide-like 17 (FTHL17) pseudogene ENST00000412652.1 novel transcript ENST00000275954.3 brain cell membrane protein 1 (BCMP1) ENST00000445763.1 pseudogene similar to part of poly(A) polymerase alpha (PAPOLA) ENST00000427910.1 MAGE family pseudogene ENST00000479411.1 novel protein similar to seven in absentia homolog 1 (Drosophila) (SIAH1) ENST00000479411.1 possibly a pseudogene ENST00000434731.1 nuclear transcription factor Y, gamma (NFYC) pseudogene ENST00000399988.1 expression from this locus is supported by Chomez et al. (2001) Cancer Res. 61(14):5544-51 ENST00000399989.1 based on EGAG RT-PCR/RACE reactions sccd63205 and sccd64422 but contains a PCR artefact @ 3'end NB. these reads include mismatch that would result in premature stop codon ENST00000449698.1 novel protein (FLJ36601) ENST00000378660.1 novel protein (FLJ36601) ENST00000447155.1 High mobility group protein 1 (HMG-1)(LOC340573) pseudogene ENST00000378653.3 novel protein (LOC158730) ENST00000446478.1 novel protein (LOC158730) ENST00000455438.1 novel transcript ENST00000419621.1 ribosomal protein S15a (RPS15A) pseudogene ENST00000508758.1 H2A histone family B pseudogene ENST00000446060.1 chromosome 2 open reading frame 6 (C2orf6) pseudogene ENST00000466533.1 alternative 5' UTR ENST00000484460.1 alternative 5' UTR ENST00000449135.2 alternative 5' UTR ENST00000413104.1 ferritin, heavy polypeptide-like 17 (FTHL17) pseudogene ENST00000378533.3 coninued from Em:AL133494.1 in Em:AL133494; continues as Em:AL121578.1.1 in Em:AL121578 ENST00000378533.3 sushi-repeat-containing protein, X chromosome ENST00000479015.1 sushi-repeat-containing protein, X chromosome ENST00000461865.1 sushi-repeat-containing protein, X chromosome ENST00000423919.1 putative novel transcript ENST00000378505.2 NP_001030025 ENST00000039007.4 ornithine carbamoyltransferase ENST00000445734.1 teratocarcinoma-derived growth factor (TDGF) pseudogene ENST00000317902.7 Bcl2-associating athanogene (BAG1) pseudogene ENST00000446400.1 ferritin, light polypeptide (FTL) pseudogene ENST00000428234.1 upstream binding transcription factor, RNA polymerase I (UBTF) pseudogene ENST00000448597.1 FLJ36359 ENST00000438867.1 novel transcript ENST00000452570.1 glyceraldehyde-3-phosphate dehydrogenase (GAPD) pseudogene ENST00000442125.1 ribosomal protein S11 (RPS11) pseudogene. ENST00000447651.1 FLJ41764 ENST00000413905.1 BCL6 co-repressor ENST00000378463.1 BCL6 co-repressor ENST00000397354.3 BCL6 co-repressor ENST00000378444.4 BCL6 co-repressor ENST00000442018.1 BCL6 co-repressor ENST00000427012.1 BCL6 co-repressor ENST00000406200.2 BCL6 co-repressor ENST00000490976.1 BCL6 co-repressor ENST00000412952.1 BCL6 co-repressor ENST00000412952.1 alternative 5' UTR ENST00000418838.1 IMP (inosine monophosphate) dehydrogenase 1 (IMPDH1) pseudogene ENST00000441098.1 pseudogene similar to part of ribosomal protein S20 (RPS20) ENST00000378438.4 ATPase, H+ transporting, lysosomal interacting protein 2 ENST00000436783.1 ATPase, H+ transporting, lysosomal interacting protein 2 ENST00000486558.1 ATPase, H+ transporting, lysosomal interacting protein 2 ENST00000447485.1 ATPase, H+ transporting, lysosomal interacting protein 2 ENST00000423649.1 ATPase, H+ transporting, lysosomal interacting protein 2 ENST00000487051.1 ATPase, H+ transporting, lysosomal interacting protein 2 ENST00000479120.1 ATPase, H+ transporting, lysosomal interacting protein 2 ENST00000423387.1 Brain protein 44-like protein (BRP44L) pseudogene ENST00000378426.1 novel protein (MGC39350) ENST00000327877.5 novel protein (MGC39350) ENST00000378421.1 novel protein (MGC39350) ENST00000324817.1 cofactor required for Sp1 transcriptional activation, subunit 2 ENST00000416199.1 cofactor required for Sp1 transcriptional activation, subunit 2 ENST00000433003.1 cofactor required for Sp1 transcriptional activation, subunit 2 ENST00000472736.1 cofactor required for Sp1 transcriptional activation, subunit 2 ENST00000496531.1 cofactor required for Sp1 transcriptional activation, subunit 2 ENST00000482034.1 cofactor required for Sp1 transcriptional activation, subunit 2 ENST00000492219.1 cofactor required for Sp1 transcriptional activation, subunit 2 ENST00000495865.1 cofactor required for Sp1 transcriptional activation, subunit 2 ENST00000463072.1 cofactor required for Sp1 transcriptional activation, subunit 2 ENST00000416158.1 claudin-7 (CLDN7) pseudogene ENST00000424288.1 fetal liver LKB1-interacting protein (FLIP1) pseudogene ENST00000419629.1 syndecan binding protein 1 (syntenin) (SDCBP) pseudogene ENST00000342691.4 Ribosomal protein L32 (RPL32) pseudogene ENST00000397318.3 ribosomal protein S2 (RPS2) pseudogene ENST00000422221.1 chloride intracellular channel 4 (CLIC4) pseudogene ENST00000378308.2 NP_001034680 ENST00000324545.6 NP_001034679 ENST00000452501.1 putative novel transcript ENST00000395664.2 novel pseudogene ENST00000399959.2 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3 ENST00000478993.1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3 ENST00000480592.1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3 ENST00000342595.2 nyctalopin ENST00000378220.1 nyctalopin ENST00000378220.1 alternatively spliced 5' UTR, shares CDS with dJ169I5.2.1 ENST00000378220.1 alternative 5' UTR ENST00000486842.1 nyctalopin ENST00000451718.1 gem (nuclear organelle) associated protein 7 (GEMIN7) pseudogene ENST00000421587.2 calcium/calmodulin-dependent serine protein kinase (MAGUK family)(LIN2) ENST00000378163.1 calcium/calmodulin-dependent serine protein kinase (MAGUK family)(LIN2) ENST00000378179.3 calcium/calmodulin-dependent serine protein kinase (MAGUK family)(LIN2) ENST00000378168.2 calcium/calmodulin-dependent serine protein kinase (MAGUK family)(LIN2) ENST00000378158.1 calcium/calmodulin-dependent serine protein kinase (MAGUK family)(LIN2) ENST00000378166.4 calcium/calmodulin-dependent serine protein kinase (MAGUK family)(LIN2) ENST00000442742.2 NP_001119526.1 ENST00000472704.1 calcium/calmodulin-dependent serine protein kinase (MAGUK family)(LIN2) ENST00000378154.1 calcium/calmodulin-dependent serine protein kinase (MAGUK family)(LIN2) ENST00000469265.1 calcium/calmodulin-dependent serine protein kinase (MAGUK family)(LIN2) ENST00000486402.1 calcium/calmodulin-dependent serine protein kinase (MAGUK family)(LIN2) ENST00000468986.1 calcium/calmodulin-dependent serine protein kinase (MAGUK family)(LIN2) ENST00000468986.1 calcium/calmodulin-dependent serine protein kinase (MAGUK family) ENST00000477823.1 calcium/calmodulin-dependent serine protein kinase (MAGUK family)(LIN2) ENST00000451126.1 putative novel transcript ENST00000405276.2 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide (YWHAZ) pseudogene ENST00000378142.4 G protein-coupled receptor 34 (GPCR) ENST00000378138.5 G protein-coupled receptor 34 (GPCR) ENST00000302548.4 G protein-coupled receptor 82 ENST00000497180.1 G protein-coupled receptor 82 ENST00000451332.1 ribosomal protein S15a (RPS15A) pseudogene ENST00000437466.1 putative novel transcript ENST00000442175.1 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 1 (ATP5G1) pseudogene ENST00000411782.1 pseudogene similar to part of ribosomal protein S4, X-linked (RPS4X) ENST00000411879.1 novel transcript ENST00000440002.1 novel transcript ENST00000440955.1 novel transcript ENST00000445028.1 IMP (inosine monophosphate) dehydrogenase 1 (IMPDH1) pseudogene ENST00000453325.1 homeobox family pseudogene. ENST00000338702.3 monoamine oxidase A ENST00000497485.1 monoamine oxidase A ENST00000490604.1 monoamine oxidase A ENST00000378069.4 monoamine oxidase B ENST00000478012.1 monoamine oxidase B ENST00000487544.1 monoamine oxidase B ENST00000468431.1 monoamine oxidase B ENST00000378062.5 norrie disease (pseudoglioma) ENST00000470584.1 norrie disease (pseudoglioma) ENST00000435093.1 novel transcript ENST00000397254.2 RNA-binding region (RNP1, RRM) containing 2 (RNPC2) pseudogene ENST00000343571.3 novel protein ENST00000420999.1 novel protein (FLJ22843) ENST00000441230.1 novel protein ENST00000443767.1 KIAA0218 pseudogene ENST00000426279.1 ribonucleotide reductase M2 polypeptide (RRM2) pseudogene ENST00000430261.1 ubinuclein 1 (UBN1) pseudogene ENST00000378045.4 novel protein (MGC51029) ENST00000483115.1 novel transcript ENST00000415648.1 ribosomal protein L19 (RPL19) pseudogene ENST00000412542.1 laminin receptor 1 (ribosomal protein SA, 67kDa) (LAMR1) pseudogene ENST00000377967.4 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome ENST00000475233.1 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome ENST00000451692.1 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome ENST00000414389.1 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome ENST00000433797.1 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome ENST00000485072.1 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome ENST00000484732.1 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome ENST00000431196.1 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome ENST00000479423.1 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome ENST00000398000.2 novel protein (FLJ30628, FLJ36695, FLJ32168) ENST00000477281.1 novel protein (FLJ37558) ENST00000377934.4 novel protein (FLJ14103) ENST00000492138.1 novel transcript ENST00000450527.1 novel transcript ENST00000438181.1 novel transcript ENST00000450246.1 novel transcript ENST00000422979.1 transmembrane 4 superfamily member 11 (plasmolipin) (PMLP) pseudogene ENST00000422047.1 novel transcript ENST00000435394.1 novel transcript ENST00000414254.1 keratin 8 (K8, KO, CK8, CYK8, K2C8, CARD2) (KRT8) pseudogene ENST00000377927.3 novel pseudogene (GL004) ENST00000456532.1 novel transcript ENST00000414772.1 novel transcript ENST00000447169.1 pseudogene similar to part of splicing factor, arginine/serine-rich 6 (B52, SRP55) (SFRS6) ENST00000420585.1 putative novel transcript ENST00000433137.1 novel pseudogene ENST00000392293.2 pseudogene similar to part of keratin 18 (K18, CYK18) (KRT18) ENST00000397222.2 proliferating cell nuclear antigen (PCNA) pseudogene ENST00000417985.1 actin, beta (ACTB) pseudogene ENST00000446884.1 novel transcript ENST00000373465.2 catenin, beta like 1 (NAP, P14L, C20orf33, FLJ21108, NYD-SP19) (CTNNBL1) pseudogene ENST00000425487.2 glyceraldehyde-3-phosphate dehydrogenase (G3PD, GAPDH) (GAPD) pseudogene ENST00000377919.2 NP_001123371 ENST00000487081.1 alternative 3' UTR ENST00000424779.1 transmembrane protein vezatin pseudogene ENST00000523374.1 NP_001034980.1 ENST00000414387.2 NP_001139763 ENST00000421685.1 novel transcript ENST00000276055.3 carbohydrate (N-acetylglucosamine 6-O) ulfotransferase 7 (C6ST-2) ENST00000328306.4 solute carrier family 9 (sodium/hydrogen exchanger), isoform 7 (NHE7) ENST00000464933.1 solute carrier family 9 (sodium/hydrogen exchanger), isoform 7 (NHE7) ENST00000491894.1 solute carrier family 9 (sodium/hydrogen exchanger), isoform 7 (NHE7) ENST00000489574.1 solute carrier family 9 (sodium/hydrogen exchanger), isoform 7 (NHE7) ENST00000421881.1 pseudogene similar to part of germ cell specific Y-box binding protein (YBX2) ENST00000399931.2 novel pseudogene (HSPC177) ENST00000218340.3 retinitis pigmentosa 2 (X-linked recessive) ENST00000377879.3 novel protein ENST00000424392.1 alternative 5' UTR ENST00000218343.4 novel protein (KIAA0215) ENST00000352078.4 regucalcin (senescence marker protein-30) (RC, SMP30) ENST00000469346.1 regucalcin (senescence marker protein-30) (RC, SMP30) ENST00000336169.3 alternatively spliced 5' UTR, shares CDS with bK2522E6.1.1 ENST00000336169.3 regucalcin (senescence marker protein-30) (RC, SMP30) ENST00000336169.3 alternative 5' UTR ENST00000475448.1 regucalcin (senescence marker protein-30) (RC, SMP30) ENST00000377811.3 neuronal protein 17.3 (P17.3) ENST00000276062.8 neuronal protein 17.3 (P17.3) ENST00000377604.3 RNA binding motif protein 10 (MGC997, MGC1132, DXS8237E, KIAA0122) ENST00000468791.1 non-canonical donor splice site at 7th exon ENST00000468791.1 RNA binding motif protein 10 (MGC997, MGC1132, DXS8237E, KIAA0122) ENST00000345781.6 RNA binding motif protein 10 (MGC997, MGC1132, DXS8237E, KIAA0122) ENST00000496012.1 non-canonical acceptor splice site at final exon ENST00000496012.1 RNA binding motif protein 10 (MGC997, MGC1132, DXS8237E, KIAA0122) ENST00000478410.1 #RNA binding motif protein 10 (MGC997, MGC1132, DXS8237E, KIAA0122) ENST00000456427.1 inositol 1,3,4-triphosphate 5/6 kinase (ITPK1) pseudogene ENST00000377351.4 ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing) (A1S9, A1ST, GXP1, A1S9T, UBE1X, MGC4781) ENST00000377351.4 alternatively spliced 5' UTR, shares CDS with bK2522E6.5.1 ENST00000377351.4 alternative 5' UTR ENST00000412206.1 ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing) (A1S9, A1ST, GXP1, A1S9T, UBE1X, MGC4781) ENST00000412206.1 alternative 5' UTR ENST00000412206.1 alternatively spliced 5' UTR, shares CDS with bK2522E6.5.1 (partial) ENST00000427561.1 ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing) (A1S9, A1ST, GXP1, A1S9T, UBE1X, MGC4781) ENST00000442035.1 ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing) (A1S9, A1ST, GXP1, A1S9T, UBE1X, MGC4781) ENST00000457753.1 ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing) (A1S9, A1ST, GXP1, A1S9T, UBE1X, MGC4781) ENST00000335972.6 ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing) (A1S9, A1ST, GXP1, A1S9T, UBE1X, MGC4781) ENST00000451702.1 ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing) (A1S9, A1ST, GXP1, A1S9T, UBE1X, MGC4781) ENST00000490869.1 ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing) (A1S9, A1ST, GXP1, A1S9T, UBE1X, MGC4781) ENST00000377269.3 ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing) (A1S9, A1ST, GXP1, A1S9T, UBE1X, MGC4781) ENST00000457458.2 NP_148978.2 ENST00000522883.1 alternative 5' UTR ENST00000519758.1 alternative 5' UTR ENST00000520893.1 alternative 5' UTR ENST00000518391.1 alternative 5' UTR ENST00000518022.1 alternative 5' UTR ENST00000423038.1 nicolin 1 (NICN1) pseudogene ENST00000366224.2 putative novel transcript ENST00000377073.3 zinc finger protein 157 (HZF22) ENST00000442314.1 UBX domain containing 2 (UBXD2) pseudogene ENST00000448027.1 nucleophosmin (NPM1) (nucleolar phosphoprotein B23, numatrin) pseudogene ENST00000313116.7 zinc finger protein 41 ENST00000377065.4 zinc finger protein 41 ENST00000377065.4 alternative 5' UTR ENST00000432977.1 zinc finger protein 41 ENST00000465311.1 zinc finger protein 41 ENST00000446295.1 chromosome 6 open reading frame 68 pseudogene (LOC286402) ENST00000377045.4 v-raf murine sarcoma 3611 viral oncogene homolog 1 ENST00000377039.1 v-raf murine sarcoma 3611 viral oncogene homolog 1 ENST00000489496.1 v-raf murine sarcoma 3611 viral oncogene homolog 1 ENST00000469505.1 v-raf murine sarcoma 3611 viral oncogene homolog 1 ENST00000470206.1 v-raf murine sarcoma 3611 viral oncogene homolog 1 ENST00000295987.7 synapsin I ENST00000340666.4 synapsin I ENST00000218388.4 tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor) ENST00000456754.2 tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor) ENST00000377017.1 tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor) ENST00000441738.1 tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor) ENST00000445623.1 tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor) ENST00000247161.3 ELK1, member of ETS oncogene family ENST00000376983.3 ELK1, member of ETS oncogene family ENST00000376983.3 alternative 5' UTR ENST00000480157.1 ELK1, member of ETS oncogene family ENST00000468956.1 ELK1, member of ETS oncogene family ENST00000333119.3 ubiquitously-expressed transcript ENST00000460840.1 ubiquitously-expressed transcript ENST00000485641.1 ubiquitously-expressed transcript ENST00000335890.2 ubiquitously-expressed transcript ENST00000376964.3 ubiquitously-expressed transcript ENST00000483225.1 novel protein (LOC286403) ENST00000483225.1 FLJ36789 ENST00000436365.1 spermine synthase pseudogene ENST00000439330.1 C2H2 type zinc finger pseudogene ENST00000444248.1 WAS protein family member 2 (WASF2) pseudogene (LOC286404) ENST00000376954.1 zinc finger protein 81 (HFZ20) ENST00000423238.1 ribosomal protein L7 (RPL7) pseudogene ENST00000396965.1 FLJ16508 ENST00000276054.4 novel KRAB box containing C2H2 type zinc finger protein (FLJ20573) ENST00000428686.1 alternative 5' UTR ENST00000421903.1 alternative 5' UTR ENST00000376940.3 novel protein similar to lysozyme C (1,4-beta-N-acetylmuramidase) ENST00000436124.1 novel transcript ENST00000376932.2 synovial sarcoma, X breakpoint 6 ENST00000304270.5 novel protein similar to lysozyme C (1,4-beta-N-acetylmuramidase) ENST00000421152.1 zinc finger protein 21 (ZNF21) pseudogene ENST00000448031.1 ornithine aminotransferase (gyrate atrophy) (OAT) pseudogene ENST00000442971.1 synovial sarcoma, X breakpoint 2 (SSX2) pseudogene ENST00000440265.1 S100 calcium binding protein A11 (calgizzarin)(S100A11) pseudogene ENST00000311798.1 synovial sarcoma, X breakpoint 5 ENST00000376923.1 synovial sarcoma, X breakpoint 5 ENST00000403001.3 synovial sarcoma, X breakpoint 5 ENST00000437312.1 ornithine aminotransferase (gyrate atrophy)(OAT) pseudogene ENST00000433276.1 synovial sarcoma, X breakpoint 5 (SSX5) pseudogene ENST00000429428.1 S100 calcium binding protein A11 (calgizzarin) (S100A11) pseudogene ENST00000441060.1 ornithine aminotransferase (gyrate atrophy)(OAT) pseudogene ENST00000376919.3 synovial sarcoma, X breakpoint 1 ENST00000433189.1 S100 calcium binding protein A11 (calgizzarin) (S100A11) pseudogene ENST00000445444.1 ornithine aminotransferase (gyrate atrophy) pseudogene ENST00000376909.1 synovial sarcoma, X breakpoint 9 ENST00000453735.1 ornithine aminotransferase (gyrate atrophy) (OAT) pseudogene ENST00000422410.1 putative novel transcript ENST00000298396.2 synovial sarcoma, X breakpoint 3 ENST00000376895.1 synovial sarcoma, X breakpoint 3 ENST00000376893.3 synovial sarcoma, X breakpoint 3 ENST00000452266.1 ornithine aminotransferase (gyrate atrophy) (OAT) pseudogene ENST00000433136.1 pseudogene similar to part of ornithine aminotransferase (gyrate atrophy) (OAT) ENST00000413071.1 ornithine aminotransferase (gyrate atrophy) (OAT) pseudogene ENST00000375517.3 NP_783856 ENST00000415467.1 ornithine aminotransferase (gyrate atrophy) (OAT) pseudogene ENST00000423117.1 similar to part of the ornithine aminotransferase (OAT) pseudogene ENST00000441624.1 synovial sarcoma, X breakpoint (SSX) pseudogene ENST00000457562.1 ornithine aminotransferase (gyrate atrophy) (OAT) pseudogene ENST00000376876.3 solute carrier family 38, member 5 ENST00000376875.1 solute carrier family 38, member 5 ENST00000497336.1 solute carrier family 38, member 5 ENST00000462359.1 solute carrier family 38, member 5 ENST00000480105.1 solute carrier family 38, member 5 ENST00000494034.1 solute carrier family 38, member 5 ENST00000440085.1 solute carrier family 38, member 5 ENST00000441948.1 solute carrier family 38, member 5 ENST00000413668.1 solute carrier family 38, member 5 ENST00000416711.1 solute carrier family 38, member 5 ENST00000488083.1 solute carrier family 38, member 5 ENST00000429543.1 solute carrier family 38, member 5 ENST00000492562.1 FtsJ homolog 1 (E. coli) ENST00000019019.2 FtsJ homolog 1 (E. coli) ENST00000348411.2 FtsJ homolog 1 (E. coli) ENST00000485486.1 FtsJ homolog 1 (E. coli) ENST00000473235.1 FtsJ homolog 1 (E. coli) ENST00000487353.1 FtsJ homolog 1 (E. coli) ENST00000490202.1 FtsJ homolog 1 (E. coli) ENST00000496365.1 FtsJ homolog 1 (E. coli) ENST00000466371.1 FtsJ homolog 1 (E. coli) ENST00000467954.1 FtsJ homolog 1 (E. coli) ENST00000475806.1 FtsJ homolog 1 (E. coli) ENST00000489599.1 FtsJ homolog 1 (E. coli) ENST00000445586.1 novel transcript ENST00000489940.1 alternative 5' UTR ENST00000495186.1 emopamil binding protein (sterol isomerase) ENST00000276096.6 emopamil binding protein (sterol isomerase) ENST00000498425.1 emopamil binding protein (sterol isomerase) ENST00000446158.1 emopamil binding protein (sterol isomerase) ENST00000376771.4 ornithine aminotransferase-like 1 ENST00000481090.1 ornithine aminotransferase-like 1 ENST00000494495.1 ornithine aminotransferase-like 1 ENST00000476141.1 ornithine aminotransferase-like 1 ENST00000418627.1 ornithine aminotransferase-like 1 ENST00000472897.1 RNA binding motif protein 3 ENST00000488216.1 RNA binding motif protein 3 ENST00000466764.1 RNA binding motif protein 3 ENST00000490127.1 novel transcript ENST00000489344.1 RNA binding motif protein 3 ENST00000376759.3 RNA binding motif protein 3 ENST00000491240.1 RNA binding motif protein 3, variant 3, alternatively spliced ENST00000485213.1 RNA binding motif protein 3 ENST00000491236.1 RNA binding motif protein 3 ENST00000354480.2 RNA binding motif protein 3, variant 2, alternatively spliced in 5' UTR ENST00000453810.1 novel transcript ENST00000406301.1 mitochondrial ribosomal protein L32 (MRPL32) pseudogene ENST00000470124.1 WD repeat domain 13 ENST00000376729.5 WD repeat domain 13 ENST00000218056.5 WD repeat domain 13 ENST00000497756.1 WD repeat domain 13 ENST00000498631.1 WD repeat domain 13 ENST00000471334.1 WD repeat domain 13 ENST00000486125.1 WD repeat domain 13 ENST00000472440.1 WD repeat domain 13 ENST00000492715.1 WD repeat domain 13 ENST00000479279.1 WD repeat domain 13 ENST00000466962.1 WD repeat domain 13 ENST00000495575.1 WD repeat domain 13 ENST00000482760.1 WD repeat domain 13 ENST00000492873.1 WD repeat domain 13 ENST00000438988.1 vomeronasal receptor pseudogene ENST00000450772.1 Wiskott-Aldrich syndrome (eczema-thrombocytopenia), vaviant 3 ENST00000376701.4 Wiskott-Aldrich syndrome (eczema-thrombocytopenia), vaviant 1 ENST00000465982.1 Wiskott-Aldrich syndrome (eczema-thrombocytopenia), vaviant 7 ENST00000483750.1 Wiskott-Aldrich syndrome (eczema-thrombocytopenia), vaviant 4 ENST00000490627.1 Wiskott-Aldrich syndrome (eczema-thrombocytopenia), vaviant 5 ENST00000474174.1 Wiskott-Aldrich syndrome (eczema-thrombocytopenia), vaviant 6 ENST00000470107.1 Wiskott-Aldrich syndrome (eczema-thrombocytopenia) ENST00000376687.3 suppressor of variegation 3-9 (Drosophila) homolog 1 ENST00000482260.1 novel transcript ENST00000416061.1 novel transcript ENST00000463327.1 novel transcript ENST00000470676.1 novel transcript ENST00000445229.1 novel protein ENST00000419045.1 acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A thiolase) (ACAA2) pseudogene ENST00000376670.3 GATA-binding protein 1 (globin transcription factor 1) ENST00000376665.3 GATA-binding protein 1 (globin transcription factor 1) ENST00000447551.1 GATA-binding protein 1 (globin transcription factor 1) ENST00000423941.1 alternative 5' UTR ENST00000438518.1 alternative 5' UTR ENST00000376643.2 alternative 5' UTR ENST00000376610.2 alternative 5' UTR ENST00000376619.2 alternative 5' UTR ENST00000441703.1 alternative 5' UTR ENST00000426196.1 alternative 5' UTR ENST00000443563.1 alternative 5' UTR ENST00000440653.1 alternative 5' UTR ENST00000486227.1 FLJ45175 ENST00000488543.1 FLJ16239 ENST00000218230.5 Proprotein convertase subtilisin/kexin type1 inhibitor ENST00000476838.1 Proprotein convertase subtilisin/kexin type1 inhibitor ENST00000478242.1 Proprotein convertase subtilisin/kexin type1 inhibitor ENST00000376582.3 translocase of inner mitochondrial membrane 17 homolog B; inner mitochondrial membrane preprotein translocase ENST00000376582.3 translocase of inner mitochondrial membrane 17 homolog B (yeast), variante 1 ENST00000466995.1 translocase of inner mitochondrial membrane 17 homolog B (yeast) ENST00000466995.1 novel transcript ENST00000495490.1 translocase of inner mitochondrial membrane 17 homolog B (yeast) ENST00000495490.1 novel transcript ENST00000447146.2 polyglutamine binding protein 1 (nuclear protein containing WW domain 38 kD, NPW38) ENST00000473764.1 novel transcript, variant 8, alternatively spliced 3' UTR. Translation is Em:AF207550.2.1 ENST00000247140.4 polyglutamine binding protein 1 (nuclear protein containing WW domain 38 kD, NPW38) ENST00000472742.1 novel transcript ENST00000486150.1 novel transcript ENST00000477997.1 novel transcript, variant 5, alternatively spliced 5' UTR. Translation is Em:AF207550.2.1 ENST00000470062.1 novel transcript ENST00000474671.1 novel transcript, variant 6, alternatively spliced 5' UTR. Translation is Em:AF207550.2.1 ENST00000443648.1 polyglutamine binding protein 1 (nuclear protein containing WW domain 38 kD, NPW38) ENST00000456306.1 polyglutamine binding protein 1 (nuclear protein containing WW domain 38 kD, NPW38) ENST00000463529.1 polyglutamine binding protein 1 (nuclear protein containing WW domain 38 kD, NPW38) ENST00000470059.1 novel transcript, variant 4, alternatively spliced 3' UTR. translation is Em:AF207550.2.3 ENST00000465859.1 novel transcript, variant 7, C-terminal truncated ENST00000247138.5 solute carrier family 35 (UDP-galactose transporter), member 2 ENST00000376529.3 solute carrier family 35 (UDP-galactose transporter), member 2 ENST00000376521.1 solute carrier family 35 (UDP-galactose transporter), member 2 ENST00000445167.2 solute carrier family 35 (UDP-galactose transporter), member 2 ENST00000376515.3 solute carrier family 35 (UDP-galactose transporter), member 2 ENST00000446885.1 solute carrier family 35 (UDP-galactose transporter), member 2 ENST00000376512.1 solute carrier family 35 (UDP-galactose transporter), member 2 ENST00000376509.4 pim-2 oncogene ENST00000485431.1 pim-2 oncogene ENST00000442430.1 pim-2 oncogene ENST00000455452.1 novel OTU-like cysteine protease ENST00000156084.4 novel OTU-like cysteine protease ENST00000376488.3 novel OTU-like cysteine protease ENST00000428668.2 NP_001129631 ENST00000484499.1 novel transcript ENST00000481142.1 novel transcript ENST00000376477.1 potassium voltage-gated channel, Shal-related subfamily, member 1 ENST00000218176.3 potassium voltage-gated channel, Shal-related subfamily, member 1 ENST00000419374.1 potassium voltage-gated channel, Shal-related subfamily, member 1 ENST00000376396.3 JM11 protein ENST00000376396.3 alternative 5' UTR ENST00000482476.1 Putative variant 2 ENST00000482476.1 JM11 protein ENST00000496529.1 JM11 protein ENST00000496529.1 alternative 5' UTR ENST00000376390.3 JM4 protein (JM4) ENST00000491199.1 novel transcript ENST00000376386.3 JM4 protein (JM4) ENST00000470270.1 novel transcript ENST00000376368.2 alternative 5' UTR ENST00000465382.1 alternative 5' UTR ENST00000423215.2 alternative 5' UTR ENST00000156109.5 T54 protein, transcript variant 1 ENST00000376339.1 Novel PDZ domain containing protein (FLJ21687) ENST00000425661.2 NP_001093151.1 ENST00000458388.1 Novel PDZ domain containing protein (FLJ21687) ENST00000412696.2 NP_079135 ENST00000415364.1 Novel PDZ domain containing protein (FLJ21687) ENST00000376338.3 Novel PDZ domain containing protein (FLJ21687) ENST00000498742.1 novel transcript ENST00000425285.1 Novel PDZ domain containing protein (FLJ21687) ENST00000454342.1 Novel PDZ domain containing protein (FLJ21687) ENST00000376322.3 Proteolipid protein 2 (colonic epithelium-enriched), protein variant 2 ENST00000376327.5 Proteolipid protein 2 (colonic epithelium-enriched), protein variant 1n ENST00000376317.3 LIM domain only 6 ENST00000453382.1 LIM domain only 6 ENST00000432913.1 LIM domain only 6 ENST00000376310.3 LIM domain only 6 ENST00000417014.1 LIM domain only 6 ENST00000479808.1 alternative 3' UTR ENST00000433499.1 novel transcript ENST00000448722.1 heat shock 27kDa protein 1 (HSPB1) pseudogene ENST00000376227.3 JM1 protein (JM1) ENST00000496651.1 novel transcript ENST00000490300.1 novel transcript ENST00000492334.1 novel transcript ENST00000376207.4 forkhead box P3 ENST00000518685.1 NP_001107849.1 ENST00000376197.1 forkhead box P3 ENST00000466508.1 alternative 5' UTR ENST00000495799.1 alternative 5' UTR ENST00000407599.3 non-canonical splice acceptor site between exon 3 and exon 4 ENST00000442437.2 G antigen family protein similar to GAGE4 ENST00000381751.1 G antigen family protein ENST00000361446.5 G antigen family protein ENST00000420398.2 G antigen family protein similar to GAGE7B ENST00000405679.3 G antigen family protein similar to GAGE7B ENST00000381698.3 G antigen family protein similar to GAGE7B ENST00000440137.1 G antigen family protein similar to GAGE7B ENST00000445148.1 G antigen family protein similar to GAGE7B ENST00000381722.1 G antigen family protein similar to GAGE7B ENST00000362097.1 G antigen 2 ENST00000381709.2 NMD exception ENST00000423609.1 voltage-dependent anion channel 1 (VDAC1) pseudogene ENST00000438101.1 sal-like 1 (Drosophila) (SALL1) pseudogene ENST00000376141.1 G antigen family C 1 protein (Prostate-associated gene protein 4) (PAGE-4) (PAGE-1) (JM27) (GAGE-9) ENST00000218068.6 G antigen family C 1 protein (Prostate-associated gene protein 4) (PAGE-4) (PAGE-1) (JM27) (GAGE-9) ENST00000478785.1 G antigen family C 1 protein (Prostate-associated gene protein 4) (PAGE-4) (PAGE-1) (JM27) (GAGE-9) ENST00000474146.1 G antigen family C 1 protein (Prostate-associated gene protein 4) (PAGE-4) (PAGE-1) (JM27) (GAGE-9) ENST00000437322.1 novel transcript ENST00000491810.1 ubiquitin specific protease 27, X-linked (USP27X) pseudogene ENST00000402231.1 Pseudogene similar to part of the cleavage and polyadenylation specificity factor (CPSF 160 KDa subunit) ENST00000376088.3 NP_001121371.1 ENST00000376088.3 NP_001121370.1 ENST00000376091.3 alternative 5' UTR ENST00000482218.1 Novel transcript ENST00000376108.3 chloride channel 5 (nephrolithiasis 2, X-linked, Dent disease) ENST00000307367.2 chloride channel 5 (nephrolithiasis 2, X-linked, Dent disease) ENST00000358526.2 A kinase (PRKA) anchor protein 4 ENST00000376064.3 A kinase (PRKA) anchor protein 4 ENST00000481402.1 A kinase (PRKA) anchor protein 4 ENST00000448865.1 A kinase (PRKA) anchor protein 4 ENST00000437370.1 A kinase (PRKA) anchor protein 4 ENST00000480926.1 A kinase (PRKA) anchor protein 4 ENST00000493507.1 cyclin B3 ENST00000491907.1 cyclin B3 ENST00000376042.1 cyclin B3 ENST00000376038.1 cyclin B3 ENST00000476167.1 cyclin B3 ENST00000376025.2 suspected genomic sequencing error affecting CDS in exon 22 ENST00000289292.7 NP_065768 ENST00000289292.7 NMD exception ENST00000475267.1 H3 histone family 3B (H3F3B) pseudogene ENST00000252677.3 bone morphogenetic protein 15 ENST00000453854.1 high-mobility group box 1 (HMGB1) pseudogene ENST00000439389.1 melanoma antigen pseudogene ENST00000447309.1 pseudogene similar to part of SAH (SA hypertension-associated homolog (rat)) ENST00000442994.1 novel transcript ENST00000428996.1 melanoma antigen pseudogene ENST00000376006.3 alternatively spliced 5' UTR; shares CDS with bA348F1.4.2 ENST00000376006.3 nudix (nucleoside diphosphate linked moiety X)-type motif 10 ENST00000376006.3 alternative 5' UTR ENST00000356450.2 alternatively spliced 5' UTR; shares CDS with bA348F1.4.2 ENST00000356450.2 nudix (nucleoside diphosphate linked moiety X)-type motif 10 ENST00000356450.2 alternative 5' UTR ENST00000425150.1 putative novel transcript ENST00000455931.1 putative novel transcript ENST00000418775.1 putative novel transcript ENST00000375992.3 nudix (nucleoside diphosphate linked moiety X)-type motif 11 ENST00000448761.1 putative novel transcript ENST00000417339.1 pseudogene similar to part of p30 (nuclear protein p30) ENST00000491883.1 pseudogene similar to part of p30 (nuclear protein p30) ENST00000480752.1 pseudogene similar to part of p30 (nuclear protein p30) ENST00000375772.3 alternative 5' UTR; shares CDS with bA234P3.1.1 and bA234P3.1.5 ENST00000375772.3 melanoma antigen, family D, 1 ENST00000375772.3 alternative 5' UTR ENST00000375722.1 alternative 5' UTR; shares CDS with bA234P3.1.1 and bA234P3.1.2 ENST00000375722.1 melanoma antigen, family D, 1 ENST00000375722.1 alternative 5' UTR ENST00000326587.7 alternative 5' UTR; shares CDS with bA234P3.1.2 and bA234P3.1.5 ENST00000326587.7 melanoma antigen, family D, 1 ENST00000326587.7 alternative 5' UTR ENST00000375695.2 melanoma antigen, family D, 1 ENST00000486579.1 melanoma antigen, family D, 1 ENST00000470461.1 melanoma antigen, family D, 1 ENST00000494718.1 melanoma antigen, family D, 1 ENST00000485420.1 melanoma antigen, family D, 1 ENST00000482188.1 melanoma antigen, family D, 1 ENST00000482599.1 melanoma antigen, family D, 1 ENST00000473931.1 melanoma antigen, family D, 1 ENST00000422654.1 zinc finger protein pseudogene ENST00000428250.1 pseudogene similar to part of PFKFB1 (6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1) ENST00000442031.1 pseudogene similar to part of IPO7 (importin 7) ENST00000451170.1 ubiquinol-cytochrome c reductase complex (7.2 kD) (HSPC051) pseudogene ENST00000411928.1 thiopurine S-methyltransferase (TMPT) pseudogene ENST00000375644.3 novel protein (LOC349420,LOC256106) ENST00000497164.1 alternative 5' UTR ENST00000471932.1 novel transcript ENST00000459685.1 novel transcript ENST00000488430.1 novel transcript, variant 6 (FLJ25964) ENST00000375626.3 melanoma antigen, family D, 4 (MAGED4) ENST00000477634.1 novel transcript ENST00000498483.1 novel transcript ENST00000467526.1 this variant and one of variant fragments .1.7, .1.10 or .1.11 could be part of a single variant ENST00000467526.1 novel transcript ENST00000474812.1 this variant and one of variant fragments .1.7, .1.10 or .1.11 could be part of a single variant ENST00000474812.1 novel transcript ENST00000479281.1 this variant and one of variant fragments .1.8 and .1.9 could be part of a single variant ENST00000479281.1 novel transcript, variant 7 (FLJ37222) ENST00000497416.1 this variant and one of variant fragments .1.8 and .1.9 could be part of a single variant ENST00000497416.1 novel transcript ENST00000497348.1 this variant and one of variant fragments .1.8 and .1.9 could be part of a single variant ENST00000497348.1 novel transcript ENST00000375625.3 novel protein (LOC349420) (FLJ39060) ENST00000438584.1 GAGE family member pseudogene ENST00000456973.1 pseudogene similar to part of the GAGE family of proteins ENST00000515651.1 GAGE family member pseudogene ENST00000457210.1 novel pseudogene ENST00000518075.1 alternative 5' UTR ENST00000375616.1 isoform 1b ENST00000375613.3 isoform 1d ENST00000421321.1 novel pseudogene ENST00000375602.1 translation is the same as bA485B17.5.1 in Em:BX088602 ENST00000375602.1 probable duplication of the GAGED2 gene ENST00000375602.1 antigen G family member ENST00000415263.1 novel pseudogene ENST00000413031.1 pseudogene similar to part of GAGE family of proteins ENST00000440881.1 GAGE family member pseudogene ENST00000412941.1 GAGE family member pseudogene ENST00000456052.1 GAGE family member pseudogene ENST00000440734.1 GAGE family member pseudogene ENST00000440546.1 novel pseudogene ENST00000438586.1 novel pseudogene ENST00000478767.1 EST evidence align in multiple positions and hit with 100% identity other loci in clone BX088602.5 on chromosome X (according to UCSC and BLAT) ENST00000375570.1 probable duplication of the GAGED2 gene ENST00000375570.1 same translation as bA485B17.5.1 in Em:BX088602 ENST00000375570.1 antigen G family member ENST00000442891.1 novel pseudogene ENST00000417920.1 GAGE family member pseudogene ENST00000422168.1 GAGE family member pseudogene ENST00000453640.1 synovial sarcoma, X breakpoint 3 (SSX3) pseudogene ENST00000453276.1 ornithine aminotransferase (gyrate atrophy) (OAT) pseudogene ENST00000298181.5 synovial sarcoma, X breakpoint 7 ENST00000450868.1 ornithine aminotransferase (gyrate atrophy) (OAT) pseudogene ENST00000443473.1 synovial sarcoma, X breakpoint 4 (SSX4) pseudogene ENST00000440592.1 S100 calcium binding protein A11 (calgizzarin) (S100A11) pseudogene ENST00000336777.5 synovial sarcoma, X breakpoint 2 ENST00000337502.5 synovial sarcoma, X breakpoint 2 ENST00000476392.1 synovial sarcoma, X breakpoint 2 ENST00000435089.1 ornithine aminotransferase (gyrate atrophy) (OAT) pseudogene ENST00000454598.1 pseuodgene similar to part of ornithine aminotransferase (gyrate atrophy) (OAT) ENST00000443639.1 pseudogene similar to part of ornithine aminotransferase (gyrate atrophy) (OAT) ENST00000453703.1 ornithine aminotransferase (gyrate atrophy) (OAT) pseudogene ENST00000375515.3 probably a duplication of the SSX2 gene ENST00000375515.3 same translation as bA552J9.2.2 in Em:AL450023 ENST00000375515.3 novel protein similar to synovial sarcoma X breakpoint 2 (SSX2) ENST00000375515.3 probable duplication of the SSX2 gene ENST00000276049.6 probably a duplication of the SSX2 gene ENST00000276049.6 novel protein similar to synovial sarcoma X breakpoint 2 (SSX2) ENST00000276049.6 probable duplication of the SSX2 gene ENST00000276049.6 same translation as bA552J9.2.1 in Em:AL450023 ENST00000288839.5 novel transcript ENST00000416264.1 S100 calcium binding protein A11 (calgizzarin) pseudogene ENST00000434905.1 SSX family pseudogene ENST00000452829.1 pseudogene similar to part of G antigen protein ENST00000502642.1 GAGE family pseudogene ENST00000458691.1 eukaryotic translation initiation factor 4A (EIF4A2) pseudogene ENST00000375491.3 alternativey spliced in the 5' UTR, shares CDS with bB77O11.1.1 ENST00000375491.3 placenta-specific 6 (XAGE-3, pp9012) ENST00000375491.3 alternative 5' UTR ENST00000346279.3 placenta-specific 6 (XAGE-3, pp9012) ENST00000452154.2 alternative 5' UTR ENST00000430150.2 alternative 5' UTR ENST00000452021.2 alternative 5' UTR ENST00000416841.2 alternative 5' UTR ENST00000509613.1 alternative 5' UTR ENST00000316310.4 alternative 5' UTR ENST00000356333.4 alternative 5' UTR ENST00000512364.1 alternative 5' UTR ENST00000414076.2 alternative 5' UTR ENST00000438003.2 alternative 5' UTR ENST00000411516.2 alternative 5' UTR ENST00000503775.1 alternative 5' UTR ENST00000375473.2 alternative 5' UTR ENST00000451084.2 alternative 5' UTR ENST00000447562.1 alternative 5' UTR ENST00000510517.1 alternative 5' UTR ENST00000416923.1 alternative 5' UTR ENST00000505988.1 alternative 5' UTR ENST00000375466.2 alternative 5' UTR ENST00000553557.1 non canonical other ENST00000433646.1 putative novel transcript ENST00000366185.2 novel transcript ENST00000433923.1 ribosomal protein L27 (RPL27) pseudogene ENST00000428275.1 actin, beta (ACTB) pseudogene ENST00000421137.1 pseudogene similar to part of suppressor of variegation 3-9 homolog 2 (SUV39H2) ENST00000412242.1 putative novel transcript ENST00000396435.3 NP_001104595.1 ENST00000396435.3 novel protein (KIAA0522) ENST00000375365.2 novel protein (KIAA0522) ENST00000485377.1 novel transcript ENST00000462054.1 novel transcript ENST00000498281.1 novel transcript ENST00000432596.1 laminin receptor 1 (ribosomal protein SA, 67kDa) (LAMR1) pseudogene ENST00000448956.1 ribosomal protein S13 (RPS13) pseudogene ENST00000454989.1 novel pseudogene ENST00000470241.1 SMC1 structural maintenance of chromosomes 1-like 1 (yeast) ENST00000469129.1 SMC1 structural maintenance of chromosomes 1-like 1 (yeast) ENST00000463684.1 SMC1 structural maintenance of chromosomes 1-like 1 (yeast) ENST00000428014.1 SMC1 structural maintenance of chromosomes 1-like 1 (yeast) ENST00000329209.5 novel RIB43A domain containing protein. variant 3 ENST00000457095.1 novel RIB43A domain containing protein (FLJ32783) ENST00000375327.3 novel RIB43A domain containing protein ENST00000490702.1 putative novel transcript ENST00000168216.6 hydroxyacyl-Coenzyme A dehydrogenase, type II ENST00000375304.5 hydroxyacyl-Coenzyme A dehydrogenase, type II ENST00000477706.1 hydroxyacyl-Coenzyme A dehydrogenase, type II ENST00000375298.4 hydroxyacyl-Coenzyme A dehydrogenase, type II ENST00000495986.1 hydroxyacyl-Coenzyme A dehydrogenase, type II ENST00000418049.1 putative novel transcript ENST00000425348.1 novel pseudogene (FLJ20516) ENST00000342160.3 upstream regulatory element binding protein 1 (UREB1) ENST00000427052.1 upstream regulatory element binding protein 1 (UREB1) ENST00000426907.1 upstream regulatory element binding protein 1 (UREB1) ENST00000488459.1 upstream regulatory element binding protein 1 (UREB1) ENST00000474971.1 upstream regulatory element binding protein 1 (UREB1) ENST00000480438.1 upstream regulatory element binding protein 1 (UREB1) ENST00000463852.1 upstream regulatory element binding protein 1 (UREB1) ENST00000468322.1 upstream regulatory element binding protein 1 (UREB1) ENST00000474288.1 upstream regulatory element binding protein 1 (UREB1) ENST00000218328.8 upstream regulatory element binding protein 1 (UREB1) ENST00000489876.1 upstream regulatory element binding protein 1 (UREB1) ENST00000424562.1 upstream regulatory element binding protein 1 (UREB1) ENST00000471676.1 upstream regulatory element binding protein 1 (UREB1) ENST00000446750.1 upstream regulatory element binding protein 1 (UREB1) ENST00000432417.1 pseudogene similar to part of 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 (PFKFB1) ENST00000458382.1 pseudogene similar to part of ribosomal protein S13 (RPS13) ENST00000428215.1 mitochondrial ribosomal protein L32 (MRPL32) pseudogene ENST00000455300.1 mitochondrial ribosomal protein S18C (MRPS18C) pseudogene ENST00000357988.5 KIAA1111 ENST00000425862.1 alternative 5' UTR ENST00000437224.1 alternative 5' UTR ENST00000415025.1 alternative 5' UTR ENST00000453905.1 alternative 5' UTR ENST00000445025.1 alternative 5' UTR ENST00000433120.1 alternative 5' UTR ENST00000426602.1 ribosomal protein L37 (RPL37) pseudogene ENST00000458404.1 alternative 5' UTR ENST00000451120.1 ribosomal protein L7A (RPL7A) pseudogene ENST00000375151.4 novel protein ENST00000375135.3 faciogenital dysplasia (Aarskog-Scott syndrome) protein ENST00000336470.4 FLJ10613 ENST00000426407.2 pseudogenephosphoglycerate mutase (PGAM) pseudogene ENST00000498398.1 putative novel transcript ENST00000375068.1 melanoma antigen, family D2 ENST00000347546.3 melanoma antigen, family D2 ENST00000463787.1 melanoma antigen, family D2 ENST00000375058.1 melanoma antigen, family D2 ENST00000375060.1 melanoma antigen, family D2 ENST00000485483.1 melanoma antigen, family D2 ENST00000497484.1 melanoma antigen, family D2 ENST00000487482.1 melanoma antigen, family D2 ENST00000487463.1 melanoma antigen, family D2 ENST00000452830.1 trophinin ENST00000430420.1 alternative 5' UTR ENST00000442098.1 alternative 5' UTR ENST00000173898.7 trophinin ENST00000445561.1 trophinin ENST00000375029.3 trophinin ENST00000474933.1 splice donor between exon 3 and 4 is non-canonical ENST00000440759.1 alternative 5' UTR ENST00000449980.1 alternative 5' UTR ENST00000416704.1 alternative 5' UTR ENST00000427099.1 trophinin ENST00000427099.1 alternative 5' UTR ENST00000492142.1 trophinin ENST00000492706.1 trophinin ENST00000475183.1 trophinin ENST00000375006.3 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 ENST00000374987.3 APEX nuclease (apurinic/apyrimidinic endonuclease) 2 ENST00000471758.1 APEX nuclease (apurinic/apyrimidinic endonuclease) 2 ENST00000463868.1 aminolevulinate, delta-, synthase 2 (sideroblastic/hypochromic anemia) ENST00000413370.1 likely ortholog of mouse hepatoma-derived growth factor related protein 3 pseudogene (HDGFRP3) ENST00000449097.1 alternative 5' UTR ENST00000334118.6 G antigen, family D pseudogene ENST00000433928.1 cytochrome c oxidase I (MTCO1) pseudogene ENST00000453434.1 NADH dehydrogenase 2 (MTND2) pseudogene ENST00000441241.1 NADH dehydrogenase 1 (MTND1) pseudogene ENST00000289619.5 PAGE-5 protein (PAGE-5) ENST00000374955.3 PAGE-5 protein (PAGE-5) ENST00000374952.1 PAGE-5 protein (PAGE-5) ENST00000519203.1 alternative 5' UTR ENST00000440645.1 novel transcript ENST00000448334.1 proteasome (prosome, macropain) subunit alpha, type 5 (PSMA5) pseudogene ENST00000374941.4 Ras-related GTP binding B ENST00000414239.1 Ras-related GTP binding B ENST00000262850.7 Ras-related GTP binding B ENST00000498762.1 Ras-related GTP binding B ENST00000474757.1 Ras-related GTP binding B ENST00000475061.1 Ras-related GTP binding B ENST00000452532.1 novel transcript ENST00000398901.2 glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2) (GOT2) pseudogene ENST00000358094.5 Kruppel-like factor 8 ENST00000434984.1 ribosomal protein L23a (RPL23A) pseudogene ENST00000446028.1 putative novel transcript ENST00000374922.4 novel transcript ENST00000437625.1 putative novel transcript ENST00000423617.1 novel transcript ENST00000451583.1 novel transcript ENST00000430456.1 putative novel transcript ENST00000475785.1 novel protein similar to spindlin ENST00000475785.1 alternative 5' UTR; shares CDS with bA445O16.1.2 ENST00000475785.1 alternative 5' UTR ENST00000478405.1 novel protein similar to spindlin ENST00000478405.1 alternative 5' UTR; shares CDS with bA445O16.1.1 ENST00000478405.1 alternative 5' UTR ENST00000374919.3 novel protein similar to spindlin ENST00000404529.2 spindlin-like protein 2 (SPIN2) pseudogne ENST00000460948.1 novel transcript ENST00000275988.5 spindlin-like protein 2 (SPIN2) ENST00000374912.5 spindlin-like protein 2 (SPIN2) ENST00000374910.3 spindlin-like protein 2 (SPIN2) ENST00000434397.1 spindlin-like protein 2 (SPIN2) ENST00000439622.1 putative novel transcript ENST00000374908.1 novel protien similar to SPIN2 ENST00000374906.3 novel protien similar to SPIN2 ENST00000423543.1 protein phosphatase 1, regulatory (inhibitor) subunit 11 (PPP1R11) pseudogene ENST00000374900.4 novel protein (FLJ31204) ENST00000491179.1 putative novel transcript ENST00000465623.1 novel transcript ENST00000413059.1 methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase (MTHFD1) pseudogene ENST00000434992.1 neuronal apoptosis inhibitor protein 2 (NALP2) pseudogene ENST00000416450.1 malate dehydrogenase 1, NAD (soluble) (MDH1) pseudogene ENST00000449268.1 v-myc myelocytomatosis viral oncogene homolog 1, lung carcinoma derived (avian) (MYCL1) pseudogene ENST00000453110.1 keratin 8 (KRT8) pseudogene ENST00000455793.1 Sjogren syndrome antigen B (autoantigen La) (SSB) pseudogene ENST00000449206.1 NADH dehydrogenase 1 (MTND1) pseudogene ENST00000449028.1 NADH dehydrogenase 2 (MTND2) pseudogene ENST00000457579.1 zinc finger protein (ZFP) pseudogene ENST00000433061.1 novel transcript ENST00000253401.6 Cdc42 guanine nucleotide exchange factor (GEF) 9 ENST00000374878.1 Cdc42 guanine nucleotide exchange factor (GEF) 9 ENST00000495564.1 Cdc42 guanine nucleotide exchange factor (GEF) 9 ENST00000374872.1 Cdc42 guanine nucleotide exchange factor (GEF) 9 ENST00000498761.1 variant 4Cdc42 guanine nucleotide exchange factor (GEF) 9 ENST00000466925.1 Cdc42 guanine nucleotide exchange factor (GEF) 9 ENST00000420917.1 novel transcript ENST00000414577.1 basic transcription factor 3 (BTF3) pseudogene ENST00000439535.1 ribonucleoprotein pseudogene ENST00000374869.3 FLJ39827 ENST00000374852.3 myotubularin related protein 8 ENST00000442913.1 myotubularin related protein 8 ENST00000478487.1 myotubularin related protein 8 ENST00000462447.1 myotubularin related protein 8 ENST00000461403.1 myotubularin related protein 8 ENST00000396110.2 karyopherin alpha 4 (importin alpha 3) (KPNA4) pseudogene ENST00000425230.1 SHC (Src homology 2 domain containing) transforming protein 1 (SHC1) pseudogene ENST00000436906.1 YWHA tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein pseudogene ENST00000447301.1 keratin 8 (KRT8) pseudogene ENST00000421856.1 GrpE-like 2, mitochondrial (E. coli) pseudogene ENST00000428431.1 novel pseudogene ENST00000374839.3 hepatocellular carcinoma-associated antigen 127 (HCA127), variant 1 (FLJ12856) ENST00000337990.2 hepatocellular carcinoma-associated antigen 127 (HCA127), variant 2 (FLJ12745) ENST00000488608.1 hepatocellular carcinoma-associated antigen 127 (HCA127), variant 3 (KIAA1166) ENST00000488406.1 hepatocellular carcinoma-associated antigen 127 (HCA127) ENST00000492653.1 hepatocellular carcinoma-associated antigen 127 (HCA127) ENST00000488831.1 hepatocellular carcinoma-associated antigen 127 (HCA127) ENST00000476032.1 hepatocellular carcinoma-associated antigen 127 (HCA127) ENST00000451184.1 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) (KPNA2) pseudogene ENST00000233836.5 chaperonin containing TCP1, subunit 4 (delta) (CCT4) pseudogene ENST00000433352.1 mortality factor 4 like 1 (MORF4L1) pseudogene ENST00000454528.1 novel pseudogene ENST00000422965.1 pseudogene similar to part of TLE family ( transducin-like enhancer of split (E(sp1) homolog, Drosophila)) ENST00000433173.1 adaptor-related protein complex 1 (AP1M2) pseudogene ENST00000338957.4 NP_001010888.3 ENST00000374807.5 novel protein (FLJ12525) ENST00000374811.3 novel protein (FLJ12525) ENST00000374804.5 novel protein (FLJ12525), variant 3 (FLJ40064) ENST00000484069.1 novel transcript, variant 3 (FLJ30255, FLJ00158) ENST00000469091.1 novel transcript ENST00000440433.1 novel pseudogene ENST00000439474.1 novel transcript ENST00000429601.1 novel transcript ENST00000447323.1 novel transcript ENST00000360270.5 moesin ENST00000486030.1 moesin ENST00000439890.1 homeobox transcription factor nanog pseudogene ENST00000430422.1 eukaryotic translation termination factor 1 (ETF1) pseudogene ENST00000426799.1 cyclin fold protein 1 (CFP1) pseudogene ENST00000456392.1 heterogenous nuclear ribonucleoprotein G pseudogene ENST00000424241.1 putative novel transcript ENST00000427538.1 novel protein ENST00000374737.4 Ig superfamily protein (Z39IG) ENST00000412866.2 NP_001093901.1 ENST00000412866.2 novel protein ENST00000423830.1 novel protein ENST00000311910.6 novel pseudogene ENST00000438308.1 eukaryotic translation initiation factor 4B (EIF4B) pseudogene ENST00000519389.1 NP_620074.3 ENST00000336279.5 NP_055614.1 ENST00000458621.1 alternative 5' UTR ENST00000343002.2 NP_620074.2 ENST00000343002.2 alternative 5' UTR ENST00000425114.1 hephaestin ENST00000415190.1 likely ortholog of chicken chondrocyte protein with a poly-proline region (CHPPR) pseudogene ENST00000422490.1 novel pseudogene ENST00000412159.1 pyruvate kinase muscle (PKM2) pseudogene ENST00000253392.5 ectodysplasin A2 isoform receptor (XEDAR) ENST00000374719.3 ectodysplasin A2 isoform receptor (XEDAR) ENST00000441055.1 zinc finger protein pseudogene ENST00000449099.1 poly(A) binding protein, nuclear 1 (PABPN1) pseudogene ENST00000445879.1 B lymphoma Mo-MLV insertion region (mouse) (BMI1) pseudogene ENST00000355520.5 oligophrenin 1 (OPN1) ENST00000484842.1 oligophrenin 1 (OPN1) ENST00000467444.1 oligophrenin 1 (OPN1) ENST00000486068.1 oligophrenin 1 (OPN1) ENST00000491714.1 oligophrenin 1 (OPN1) ENST00000426382.2 phosphoglycerate kinase 1 (PGK1) pseudogene ENST00000440655.1 novel pseudogene ENST00000450604.1 nudE nuclear distribution gene E homolog like 1 (A. nidulans)(NDEL1) pseudogene ENST00000462683.1 novel protein (MGC21416) ENST00000451537.1 novel protein ENST00000470730.1 novel transcript ENST00000374643.3 novel transcript ENST00000462972.1 novel transcript ENST00000496576.1 novel transcript ENST00000422565.1 ribosomal protein L31 (RPL31) pseudogene ENST00000446748.1 cytochrome c oxidase subunit VIc (COX6C) pseudogene ENST00000488088.1 START domain containing 8 ENST00000523864.1 START domain containing 8 ENST00000374599.3 NP_001135975.1 ENST00000374597.3 START domain containing 8 ENST00000439585.1 actin-related protein 3 (yeast) (ACTR3) pseudogene ENST00000396021.2 novel pseudogene ENST00000204961.4 ephrin-B1 ENST00000471141.1 praja 1 ENST00000374584.3 praja 1 ENST00000361478.1 praja 1 ENST00000477231.1 praja 1 ENST00000303758.7 high-mobility group nucleosome binding domain 1 (HMGN1) pseudogene ENST00000438233.1 cytochrome c, somatic (CYCS) pseudogene ENST00000454131.1 putative novel transcript ENST00000525810.1 NP_001005615 ENST00000502251.1 NMD likely if extended ENST00000429006.1 CCR4-NOT transcription complex, subunit 7 (CNOT7) pseudogene ENST00000438855.1 cytochrome B family pseudogene ENST00000425607.1 NADH dehydrogenase 5 (MTND5) pseudogene ENST00000342206.6 immunoglobulin (CD79A) binding protein 1 ENST00000356413.4 immunoglobulin (CD79A) binding protein 1 ENST00000403371.2 putative novel transcript ENST00000366397.3 novel transcript ENST00000333026.3 novel protein similar to diacylglycerol O-acyltransferase homolog 2 (mouse)(DGAT2) ENST00000333026.3 novel protein similar to diacylglycerol O-acyltransferase homolog 2 (mouse) (DGAT2) ENST00000480702.1 novel transcript ENST00000477379.1 arrestin 3, retinal (X-arrestin) ENST00000276066.4 NP_001027898 ENST00000239666.4 novel protein (FLJ21093) ENST00000374454.1 novel protein ENST00000473667.1 novel transcript ENST00000486461.1 novel transcript ENST00000374403.3 kinesin family member 4A ENST00000485406.1 kinesin family member 4A ENST00000412817.1 novel pseudogene ENST00000374382.3 novel protein ENST00000472623.1 novel transcript ENST00000424211.1 novel transcript ENST00000431103.1 novel transcript ENST00000396055.2 novel pseudogene ENST00000374299.3 solute carrier family 7 (cationic amino acid transporter, y+ system) member 3 ENST00000298085.4 solute carrier family 7 (cationic amino acid transporter, y+ system) member 3 ENST00000429775.1 40S ribosomal protein S23 (RPS23) pseudogene ENST00000453086.1 nuclear transport factor 2 (NUTF2) pseudogene ENST00000454743.1 suppressor of cytokine signaling 5 (SOCS5) pseudogene ENST00000483560.1 sorting nexin 12 ENST00000374274.3 sorting nexin 12 ENST00000490561.1 sorting nexin 12 ENST00000465030.1 sorting nexin 12 ENST00000276105.3 sorting nexin 12 ENST00000374259.3 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7 (AFX1) ENST00000466874.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7 (AFX1) ENST00000341558.3 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7 (AFX1) ENST00000464598.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7 (AFX1) ENST00000469736.1 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7 (AFX1) ENST00000374251.4 novel protein (LOC158830) ENST00000485951.1 novel protein ENST00000466160.1 putative novel transcript ENST00000438526.1 novel protein ENST00000483257.1 novel transcript ENST00000374102.1 trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit) (HOPA, OPA1, CAGH45, TRAP230, KIAA0192) ENST00000374080.3 trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit) (HOPA, OPA1, CAGH45, TRAP230, KIAA0192) ENST00000430072.1 trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit) (HOPA, OPA1, CAGH45, TRAP230, KIAA0192) ENST00000471663.1 trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit) (HOPA, OPA1, CAGH45, TRAP230, KIAA0192) ENST00000462984.1 trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit) (HOPA, OPA1, CAGH45, TRAP230, KIAA0192) ENST00000489199.1 trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit) (HOPA, OPA1, CAGH45, TRAP230, KIAA0192) ENST00000460771.1 trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit) (HOPA, OPA1, CAGH45, TRAP230, KIAA0192) ENST00000439750.1 trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit) (HOPA, OPA1, CAGH45, TRAP230, KIAA0192) ENST00000478889.1 trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit) (HOPA, OPA1, CAGH45, TRAP230, KIAA0192) ENST00000444034.1 trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit) (HOPA, OPA1, CAGH45, TRAP230, KIAA0192) ENST00000374051.3 neuroligin 3 (HNL3, KIAA1480) ENST00000395855.2 neuroligin 3 (HNL3, KIAA1480) ENST00000358741.3 neuroligin 3 (HNL3, KIAA1480) ENST00000476589.1 neuroligin 3 (HNL3, KIAA1480) ENST00000450860.1 putative novel transcript ENST00000374029.1 gap junction protein, beta 1, 32kDa (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)(CMTX, CX32, CMTX1) ENST00000374029.1 alternative 5' UTR; shares CDS with Em:AL590762.2.1, Em:AL590762.2.2 and Em:AL590762.2.4 ENST00000374029.1 alternative 5' UTR ENST00000374022.3 gap junction protein, beta 1, 32kDa (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)(CMTX, CX32, CMTX1) ENST00000374022.3 alternative 5' UTR; shares CDS with Em:AL590762.2.2, Em:AL590762.2.3 and Em:AL590762.2.4 ENST00000374022.3 alternative 5' UTR ENST00000447581.1 gap junction protein, beta 1, 32kDa (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)(CMTX, CX32, CMTX1) ENST00000447581.1 alternative 5' UTR; shares CDS with Em:AL590762.2.1, Em:AL590762.2.2 and Em:AL590762.2.3 ENST00000447581.1 alternative 5' UTR ENST00000361726.6 gap junction protein, beta 1, 32kDa (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)(CMTX, CX32, CMTX1) ENST00000361726.6 alternative 5' UTR; shares CDS with Em:AL590762.2.1, Em:AL590762.2.3 and Em:AL590762.2.4 ENST00000361726.6 alternative 5' UTR ENST00000314425.5 zinc finger protein 261 (MYM, XFIM, DXS6673E, KIAA0385, ZNF198L2) ENST00000373998.1 zinc finger protein 261 (MYM, XFIM, DXS6673E, KIAA0385, ZNF198L2) ENST00000489332.1 zinc finger protein 261 (MYM, XFIM, DXS6673E, KIAA0385, ZNF198L2) ENST00000373984.3 zinc finger protein 261 (MYM, XFIM, DXS6673E, KIAA0385, ZNF198L2) ENST00000373988.1 zinc finger protein 261 (MYM, XFIM, DXS6673E, KIAA0385, ZNF198L2) ENST00000470832.1 zinc finger protein 261 (MYM, XFIM, DXS6673E, KIAA0385, ZNF198L2) ENST00000460139.1 zinc finger protein 261 (MYM, XFIM, DXS6673E, KIAA0385, ZNF198L2) ENST00000373982.1 zinc finger protein 261 (MYM, XFIM, DXS6673E, KIAA0385, ZNF198L2) ENST00000373981.1 zinc finger protein 261 (MYM, XFIM, DXS6673E, KIAA0385, ZNF198L2) ENST00000373978.1 zinc finger protein 261 (MYM, XFIM, DXS6673E, KIAA0385, ZNF198L2) ENST00000276079.8 non-POU domain containing, octamer-binding protein (P54, NMT55, NRB54, P54NRB) ENST00000373856.3 non-POU domain containing, octamer-binding protein (P54, NMT55, NRB54, P54NRB) ENST00000373841.1 non-POU domain containing, octamer-binding protein (P54, NMT55, NRB54, P54NRB) ENST00000474431.1 non-POU domain containing, octamer-binding protein (P54, NMT55, NRB54, P54NRB) ENST00000420903.1 non-POU domain containing, octamer-binding protein (P54, NMT55, NRB54, P54NRB) ENST00000472185.1 non-POU domain containing, octamer-binding protein (P54, NMT55, NRB54, P54NRB) ENST00000413858.1 non-POU domain containing, octamer-binding protein (P54, NMT55, NRB54, P54NRB) ENST00000486613.1 non-POU domain containing, octamer-binding protein (P54, NMT55, NRB54, P54NRB) ENST00000450092.1 non-POU domain containing, octamer-binding protein (P54, NMT55, NRB54, P54NRB) ENST00000454976.1 non-POU domain containing, octamer-binding protein (P54, NMT55, NRB54, P54NRB) ENST00000418921.1 non-POU domain containing, octamer-binding protein (P54, NMT55, NRB54, P54NRB) ENST00000471419.1 non-POU domain containing, octamer-binding protein (P54, NMT55, NRB54, P54NRB) ENST00000490044.1 non-POU domain containing, octamer-binding protein (P54, NMT55, NRB54, P54NRB) ENST00000471907.1 non-POU domain containing, octamer-binding protein (P54, NMT55, NRB54, P54NRB) ENST00000481755.1 non-POU domain containing, octamer-binding protein (P54, NMT55, NRB54, P54NRB) ENST00000473525.1 non-POU domain containing, octamer-binding protein (P54, NMT55, NRB54, P54NRB) ENST00000373829.3 integrin beta 1 binding protein (melusin) 2 (ITGB1BP, MELUSIN, MSTP015) ENST00000483897.1 integrin beta 1 binding protein (melusin) 2 (ITGB1BP, MELUSIN, MSTP015) ENST00000465388.1 integrin beta 1 binding protein (melusin) 2 (ITGB1BP, MELUSIN, MSTP015) ENST00000475413.1 integrin beta 1 binding protein (melusin) 2 (ITGB1BP, MELUSIN, MSTP015) ENST00000436372.1 MADP-1 protein (MADP-1) pseudogene ENST00000395798.2 ras homolog gene family, member G (rho G) (ARHG) pseudogene ENST00000461157.1 TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa (OF, BA2R, CCG1, CCGS, P250, NSCL2, TAF2A, TAFII250) ENST00000425885.1 pseudogene similar to part of ras-related C3 botulinum toxin substrate ENST00000391782.2 pseudogene similar to part of poly(A) binding protein, nuclear 1 (PABPN1) ENST00000462638.1 O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase) (HRNT1, FLJ23071, MGC22921, O-GLCNAC) ENST00000466181.1 O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase) (HRNT1, FLJ23071, MGC22921, O-GLCNAC) ENST00000373695.1 alternative 5' UTR ENST00000422194.1 novel transcript ENST00000433410.1 putative novel transcript ENST00000452056.1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa (NDUFA4) pseudogene ENST00000452468.1 novel transcript ENST00000457716.1 putative novel transcript ENST00000430476.1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa (NDUFA4) pseudogene ENST00000455722.1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa (NDUFA4) pseudogene ENST00000439926.1 putative novel transcript ENST00000440412.1 novel transcript ENST00000427368.1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa (NDUFA4) pseudogene ENST00000424182.1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4, 9kDa (NDUFA4) pseudogene ENST00000479991.1 KIAA2001 ENST00000432517.1 apoptosis inhibitor (FKSG2) pseudogene ENST00000373669.2 NP_006214 ENST00000373657.1 FLJ20105 ENST00000334463.3 NP_060139.2 ENST00000470671.1 ribosomal protein S4, X-linked (CCG2, SCAR, SCR10, DXS306) ENST00000492695.1 ribosomal protein S4, X-linked (CCG2, SCAR, SCR10, DXS306) ENST00000316084.6 ribosomal protein S4, X-linked (CCG2, SCAR, SCR10, DXS306) ENST00000486733.1 ribosomal protein S4, X-linked (CCG2, SCAR, SCR10, DXS306) ENST00000373626.3 ribosomal protein S4, X-linked (CCG2, SCAR, SCR10, DXS306) ENST00000453707.2 NP_001138357 ENST00000429794.1 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 (MSG1) ENST00000246139.5 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 (MSG1) ENST00000246139.5 alternative 5' UTR; shares CDS with Em:AL135749.4.1, Em:AL135749.4.3, Em:AL135749.4.4, Em:AL135749.4.5, Em:AL135749.4.6 and Em:AL135749.4.7 ENST00000246139.5 alternative 5' UTR ENST00000417400.1 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1 (MSG1) ENST00000417400.1 alternative 5' UTR; shares CDS with Em:AL135749.4.1, Em:AL135749.4.2, Em:AL135749.4.3, Em:AL135749.4.4, Em:AL135749.4.5 and Em:AL135749.4.6 ENST00000417400.1 alternative 5' UTR ENST00000427412.1 alternative 5' UTR ENST00000450875.1 alternative 5' UTR ENST00000454225.1 alternative 5' UTR ENST00000439122.2 FLJ23746 ENST00000373542.4 phosphorylase kinase, alpha 1 (muscle) ENST00000373545.3 phosphorylase kinase, alpha 1 (muscle) ENST00000373539.3 phosphorylase kinase, alpha 1 (muscle) ENST00000417774.1 matrin 3 (MATR3) pseudogene ENST00000420998.1 novel transcript ENST00000395709.2 capping protein (actin filament) muscle Z-line, alpha 1 (CAPZA1) pseudogene ENST00000472595.1 DMRT-like family C1 ENST00000373533.1 DMRT-like family C1 ENST00000438696.1 DMRT-like family C1 ENST00000416989.1 novel transcript ENST00000373519.1 novel protein similar to poly(A)binding protein, cytoplasmic 1 (LOC340530) ENST00000373518.1 novel protein similar to nucleosome assemblu protein 1-like 2; brain specific gene BPX (LOC286486) ENST00000373517.3 nucleosome assembly protein 1-like 2 ENST00000427861.1 translocase of outer mitochondrial membrane 20 (yeast) homolog (TOMM20) pseudogene ENST00000421810.1 leucine rich repeat (in FLII) interacting protein 2 (LRRFIP2) pseudogene ENST00000436935.1 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein (zeta polypeptide)(YWHAZ) pseudogene ENST00000418771.1 mortality factor 4 like 1 (MORF4L1) pseudogene ENST00000438453.1 mitogen-activated protein kinase kinase 4(LOC139201, MAP2K4) pseudogene ENST00000421245.1 ribosomal protein L7 (RPL7) pseudogene ENST00000373502.5 novel protein similar to Chic1 (LOC349423) ENST00000498407.1 novel protein similar to Chic1 (LOC349423) ENST00000498318.1 novel protein similar to Chic1 ENST00000446112.1 selenophosphate synthetase (SPS) pseudogene ENST00000429829.1 X (inactive)-specific transcript ENST00000416330.1 X (inactive)-specific transcript ENST00000421322.1 X (inactive)-specific transcript ENST00000445814.1 X (inactive)-specific transcript ENST00000453317.1 novel transcript ENST00000415215.1 novel transcript ENST00000429143.1 laminin receptor 1 (ribosomal protein SA, 67 KDa, LAMR1) pseudogene ENST00000366220.2 scotin (SCOTIN) pseudogene ENST00000413508.1 novel alanyl-tRNA synthetase protein pseudogene ENST00000431339.1 Np95-like ring finger protein (NIRF) pseudogene ENST00000418231.1 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide pseudogene ENST00000445263.1 makorin, ring finger protein, 1 (MKRN1) pseudogene ENST00000414251.2 probable pseudogene ENST00000414251.2 novel protein similar to BMP-2 inducible kinase (BIKE) (fragment) ENST00000438337.1 Rab coupling protein (RCP) pseudogene ENST00000430772.1 novel transcript ENST00000429124.1 novel transcript ENST00000418855.1 novel transcript ENST00000455395.1 novel transcript ENST00000423992.1 novel transcript ENST00000441858.1 ribosomal protein L39 (RPL39) pseudogene ENST00000393214.2 ribosomal protein S6 (RPS6) pseudogene ENST00000398672.2 protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor) (PRKRIR) pseudogene ENST00000426405.1 ribosomal protein S7 (RPS7) pseudogene ENST00000422644.1 heterogeneous nuclear ribonucleoprotein A1 (HNRPA1) pseudogene ENST00000469174.1 poly(A) binding protein, cytoplasmic (PABPC) pseudogene ENST00000332687.6 ring finger protein 12 ENST00000349225.2 ring finger protein 12 ENST00000373468.1 KIAA2022 ENST00000339447.4 Genbank:CAD97847 ENST00000529949.1 Genbank:BAG57829 ENST00000490858.1 novel transcript ENST00000449374.1 endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2 (EDG2) pseudogene ENST00000373383.4 novel protein ENST00000373379.1 FLJ31792 ENST00000462237.1 novel transcript ENST00000474175.1 novel transcript ENST00000432946.1 telomeric repeat binding factor (NIMA-interacting) (TERF1) pseudogene ENST00000373367.3 FLJ31812 ENST00000482827.1 novel transcript ENST00000453468.1 ribosomal protein L21 (RPL21) pseudogene ENST00000414817.1 PEST-containing nuclear protein (PCNP) pseudogene ENST00000445336.1 v-raf murine sarcoma viral oncogene homolog B1 (BRAF) pseudogene ENST00000399586.2 tetratricopeptide repeat domain 3 (TTC3) pseudogene ENST00000431331.1 novel transcript ENST00000450005.1 chromosome 14 open reading frame 116 (C14orf116) pseudogene ENST00000413763.1 novel transcript ENST00000451247.1 ADP-ribosylation factor-like 5 (ARL5) pseudogene ENST00000373358.3 novel protein (MGC874) ENST00000373357.3 novel protein (MGC874) ENST00000423224.1 novel pseudogene ENST00000456969.2 lactate dehydrogenase B pseudogene ENST00000373344.4 alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) ENST00000395603.3 alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) ENST00000480283.1 alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) ENST00000479487.1 alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) ENST00000400866.2 alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) ENST00000460639.1 alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) ENST00000493470.1 alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) ENST00000373341.1 alpha thalassemia/mental retardation syndrome X-linked (RAD54 homolog, S. cerevisiae) ENST00000453566.1 fatty acid binding protein 9, testis (FABP9) pseudogene ENST00000358075.6 NP_115497.4 ENST00000481445.1 cytochrome c oxidase subunit VIIb ENST00000373335.3 cytochrome c oxidase subunit VIIb ENST00000475465.1 cytochrome c oxidase subunit VIIb ENST00000341514.6 ATPase, Cu++ transporting, alpha polypeptide (Menkes syndrome) ENST00000506043.1 novel pseudogene ENST00000477335.1 phosphoglycerate kinase 1 ENST00000491291.1 phosphoglycerate kinase 1 ENST00000373316.4 phosphoglycerate kinase 1 ENST00000474281.1 phosphoglycerate kinase 1 ENST00000476531.1 phosphoglycerate kinase 1 ENST00000341864.5 TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor 31kDa ENST00000480681.1 TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor 31kDa ENST00000420795.2 novel pseudogene ENST00000420795.2 not organism-supported ENST00000373304.3 cysteinyl leukotriene receptor 1 ENST00000493254.1 cysteinyl leukotriene receptor 1 ENST00000413023.1 high-mobility group nucleosome binding domain 1 (HGMN1) pseudogene ENST00000446395.1 ubiquitin-conjugating enzyme E2 (UBE2V1) pseudogene ENST00000321110.1 zinc finger, CCHC domain containing 5 ENST00000373301.2 G protein-coupled receptor 23 ENST00000514744.1 novel transcript ENST00000438336.1 60S ribosomal protein L7 (RPL7) pseudogene ENST00000171757.2 purinergic receptor P2Y G-protein coupled 10 ENST00000475374.1 purinergic receptor P2Y G-protein coupled 10 ENST00000461541.1 purinergic receptor P2Y G-protein coupled 10 ENST00000416730.1 purinergic receptor P2Y G-protein coupled 10 (P2RY10) pseudogene ENST00000276077.1 putative purinergic receptor (FKSG79) ENST00000422742.1 kinesin family member 4A (KIF4A) pseudogene ENST00000373298.2 integral membrane protein 2A ENST00000469541.1 integral membrane protein 2A ENST00000482194.1 integral membrane protein 2A ENST00000462038.1 integral membrane protein 2A ENST00000461357.1 integral membrane protein 2A ENST00000373296.3 T-box 22 ENST00000476373.1 T-box 22 ENST00000373294.5 T-box 22 ENST00000373291.1 T-box 22 ENST00000399581.3 novel pseudogene ENST00000308293.5 novel protein (MGC26999) ENST00000431935.1 heterogeneous nuclear ribonucleoprotein H3 (2H9) (HNRPH3) pseudogene ENST00000445455.1 WW domain binding protein 11 (WBP11) pseudogene ENST00000447818.2 hexokinase 2 (HK2) pseudogene ENST00000373275.4 novel WD repeat domain protein ENST00000473691.1 novel WD repeat domain protein ENST00000497335.1 putative novel transcript ENST00000487313.1 novel transcript ENST00000478415.1 novel WD repeat domain protein ENST00000415494.1 proteasome (prosome, macropain) subunit, alpha type, 1 (PSMA1) pseudogene ENST00000439229.1 voltage-dependent anion channel 1-like pseudogene ENST00000358130.2 nucleosomal binding protein 1 ENST00000447319.1 nucleosomal binding protein 1 ENST00000373250.3 nucleosomal binding protein 1 ENST00000430960.1 nucleosomal binding protein 1 ENST00000491275.1 nucleosomal binding protein 1 ENST00000436386.1 nucleosomal binding protein 1 ENST00000451455.1 nucleosomal binding protein 1 ENST00000373212.5 SH3 domain binding glutamic acid-rich protein like ENST00000481106.1 SH3 domain binding glutamic acid-rich protein like ENST00000463546.1 SH3 domain binding glutamic acid-rich protein like ENST00000474113.1 SH3 domain binding glutamic acid-rich protein like ENST00000415786.1 novel pseudogene ENST00000412589.1 pseudogene similar to part of SLC9A2 (solute carrier family 9 (sodium/hydrogen exchanger), isoform 2) ENST00000440833.1 pyruvate dehydrogenase kinase, isoenzyme 1 (PDK1) pseudogene ENST00000448435.1 eukaryotic translation initiation factor 3 subunit 1 alpha 35kDa (EIF3S1) pseudogene ENST00000395439.2 ribosomal protein L22 (RPL22) pseudogene ENST00000415528.1 dendritic cell protein (GA17) pseudogene ENST00000416893.1 AUT-like 2, cysteine endopeptidase (S. cerevisiae) (AUTL2) pseudogene ENST00000422893.1 novel pseudogene ENST00000399580.2 telomeric repeat binding factor (NIMA-interacting) 1 (TERF1) pseudogene ENST00000329312.4 cylicin, basic protein of sperm head cytoskeleton 1 ENST00000262752.2 ribosomal protein S6 kinase, 90kD, polypeptide 6 ENST00000495332.1 ribosomal protein S6 kinase, 90kD, polypeptide 6 ENST00000460730.1 ribosomal protein S6 kinase, 90kD, polypeptide 6 ENST00000506585.1 alternative 5' UTR ENST00000449553.2 alternative 5' UTR ENST00000455717.1 SET translocation (myeloid leukemia-associated) (SET) pseudogene ENST00000442533.1 novel transcript ENST00000451386.1 novel transcript ENST00000474922.1 ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast) (UBE2D2) pseudogene ENST00000373173.2 NP_940852.3 ENST00000373173.2 novel protein ENST00000443247.1 novel transcript ENST00000373165.3 NP_068838.3 ENST00000276123.3 alternative 5' UTR ENST00000262753.4 premature ovarian failure 1B (POF1B) ENST00000490301.1 premature ovarian failure 1B (POF1B) ENST00000373145.3 premature ovarian failure 1B (POF1B) ENST00000421841.1 novel pseudogene similar to RIKEN cDNA 6330577E15Rik ENST00000437961.1 pseudogene similar to ring finger protein 34 (RNF34) ENST00000357749.2 choroideremia (Rab escort protein 1) ENST00000467744.1 choroideremia (Rab escort protein 1) ENST00000358786.4 choroideremia (Rab escort protein 1) ENST00000487515.1 choroideremia (Rab escort protein 1) ENST00000483950.1 choroideremia (Rab escort protein 1) ENST00000452914.1 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex (NDUFA5) pseudogene ENST00000394563.3 stress-induced-phosphoprotein 1 (STIP1) pseudogene ENST00000450749.1 thiopurine S-methyltransferase (TPMT) pseudogene ENST00000508860.1 NP_001132987 ENST00000416082.1 eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) pseudogene ENST00000445417.1 novel pseudogene similar to FLJ20514 ENST00000412546.1 chromosome 14 open reading frame 111 (C14orf111) pseudogene ENST00000440037.1 ribosomal protein L7 (RPL7) pseudogene ENST00000373119.4 kelch-like 4 (Drosophila) ENST00000373114.4 kelch-like 4 (Drosophila) ENST00000448168.1 laminin receptor-like protein pseudogene (LAMRL5) ENST00000433554.1 novel pseudogene ENST00000449217.1 capping protein (actin filament) muscle Z-line, alpha 2 (CAPZA2) pseudogene ENST00000276127.4 CPX chromosome region, candidate 1 ENST00000373111.1 CPX chromosome region, candidate 1 ENST00000440519.1 ubiquitin-conjugating enzyme E2D 2 (UBC4/5 homolog, yeast) (UBE2D2) pseudogene ENST00000428470.1 pseudogene similar to part of SRI (sorcin) ENST00000435867.1 novel transcript ENST00000420327.1 novel transcript ENST00000561129.1 alternative 5' UTR ENST00000453704.1 staufen RNA binding protein homolog 2 (Drosophila) (STAU2) pseudogene ENST00000432383.1 ubiquitin specific protease 1 (USP1) pseudogene ENST00000414760.1 ubiquitin-conjugating enzyme E2 variant 1 (UBE2V1) pseudogene ENST00000418369.1 putative novel transcript ENST00000456187.1 novel transcript ENST00000426065.1 delta sleep inducing peptide, immunoreactor (DSIPI) pseudogene ENST00000446711.1 novel pseudogene ENST00000434069.1 voltage-dependent anion channel 1 (VDAC1) pseudogene ENST00000428832.1 eukaryotic translation initiation factor 4A, isoform 1 (EIF4A1) pseudogene ENST00000435214.1 keratin 18 (KRT18) pseudogene ENST00000414887.1 pseudogene similar to part of SNX3 (sorting nexin 3) ENST00000443413.1 ribosomal protein L26 (RPL26) pseudogene ENST00000441503.1 discs, large homolog 7 (Drosophila) (DLG7) pseudogene ENST00000441188.1 adaptor-related protein complex 2, beta 1 subunit (AP2B1) pseudogene ENST00000456632.1 suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein) (ST13) pseudogene ENST00000414840.1 5'-nucleotidase, cytosolic II-like 1 (NT5C2L1) pseudogene ENST00000450522.1 ribosomal protein L7 (RPL7) pseudogene ENST00000373079.3 nucleosome assembly protein 1-like 3 ENST00000475430.1 nucleosome assembly protein 1-like 3 ENST00000485425.1 nucleosome assembly protein 1-like 3 ENST00000332647.4 novel protein (FLJ37659) ENST00000420303.1 tubulin beta polypeptide pseudogene ENST00000419829.1 phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase (PAICS) pseudogene ENST00000454702.1 novel pseudogene ENST00000442082.1 calmodulin 2 (phosphorylase kinase, delta) (CALM2) pseudogene ENST00000413955.1 ribosomal protein S7 (RPS7) pseudogene ENST00000444292.1 MYST histone acetyltransferase 2 (MYST2) pseudogene ENST00000340681.3 zinc finger protein 265 (ZNF265) pseudogene ENST00000446439.1 ribosomal protein S29 (RPS29) pseudogene ENST00000441783.1 S-phase kinase-associated protein 2 (p45) (SKP2) pseudogene ENST00000373049.4 diaphanous (Drosophila, homolog) 2 ENST00000373049.4 diaphanous homolog 2 (Drosophila) ENST00000373049.4 contains U12 dependent splicing (AT-AC) ENST00000324765.8 diaphanous (Drosophila, homolog) 2 ENST00000324765.8 diaphanous homolog 2 (Drosophila) ENST00000324765.8 contains U12 dependent splicing (AT-AC) ENST00000398690.2 NADH dehydrogenase pseudogene ENST00000445414.1 novel transcript (EPAG) ENST00000439759.1 novel transcript (EPAG) ENST00000448218.1 pseuodgene similar to part of NCK-associated protein 1 (NCKAP1) ENST00000442570.1 karyopherin (importin) beta 1 (KPNB1) pseudogene ENST00000414863.1 ribosomal protein L6 (RPL6) pseudogene ENST00000395772.2 eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) pseudogene ENST00000425971.1 high-mobility group box 1 (HMGB1) pseudogene ENST00000435236.1 thyroid autoantigen 70kDa (Ku antigen) (G22P1) pseudogene ENST00000434960.1 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 (B3GNT1) pseudogene ENST00000412509.1 novel pseudogene ENST00000429844.1 laminin receptor 1 (ribosomal protein SA,67kDa) (LAMR1) pseudogene ENST00000420881.2 NP_065817.2 ENST00000373031.4 tenomodulin protein (TNMD) ENST00000485971.1 tenomodulin protein (TNMD) ENST00000373020.4 transmembrane 4 superfamily member 6 ENST00000496771.1 transmembrane 4 superfamily member 6 ENST00000494424.1 transmembrane 4 superfamily member 6 ENST00000373004.3 sushi-repeat protein (SRPUL) ENST00000481988.1 novel transcript ENST00000372989.1 synaptotagmin-like 4 (granuphilin-a) ENST00000491602.1 synaptotagmin-like 4 (granuphilin-a) ENST00000263033.5 synaptotagmin-like 4 (granuphilin-a) ENST00000263033.5 alternative 5' UTR ENST00000372981.1 synaptotagmin-like 4 (granuphilin-a) ENST00000491326.1 synaptotagmin-like 4 (granuphilin-a) ENST00000446082.1 peptidylprolyl isomerase A (cyclophilin A) (PPIA) pseudogene ENST00000414579.1 RAD21 homolog (S. pombe) (LOC139319) pseudogene ENST00000372972.2 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa ENST00000486615.1 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa ENST00000475126.1 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa ENST00000413437.1 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa ENST00000372966.3 NADPH oxidase 1 ENST00000372964.1 NADPH oxidase 1 ENST00000427768.1 NADPH oxidase 1 ENST00000217885.5 NADPH oxidase 1 ENST00000457695.1 heterogeneous nuclear ribonucleoprotein A1 (HNRPA1)(LOC158661) pseudogene ENST00000412087.1 heterogeneous nuclear ribonucleoprotein A1 (HNRPA1)(LOC158661) pseudogene ENST00000447373.1 TGF beta-inducible nuclear protein 1 (TINP1) pseudogene ENST00000332270.5 chondroitin beta1,4 N-acetylgalactosaminyltransferase (ChGn) pseudogene ENST00000456301.1 novel transcript ENST00000490509.1 novel protein (FLJ12687) ENST00000372939.1 novel protein ENST00000372935.1 novel protein ENST00000372936.3 novel protein ENST00000478422.1 novel transcript ENST00000488615.1 novel transcript ENST00000443801.1 putative novel transcript ENST00000372930.4 novel protein (FLJ14084) ENST00000478351.1 novel transcript ENST00000403304.2 FSH primary response (LRPR1 homolog, rat) 1 ENST00000435570.1 FSH primary response (LRPR1 homolog, rat) 1 ENST00000372926.1 FSH primary response (LRPR1 homolog, rat) 1 ENST00000372927.1 FSH primary response (LRPR1 homolog, rat) 1 ENST00000490943.1 pseudogene similar to part of tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein ENST00000402866.1 alternative 5' UTR ENST00000372907.3 TAF7-like RNA polymerase II, 50kDa TATA box binding protein (TBP)-associated factor ENST00000324762.6 TAF7-like RNA polymerase II, 50kDa TATA box binding protein (TBP)-associated factor, variant 1 (FLJ23157) ENST00000356784.1 TAF7-like RNA polymerase II, 50kDa TATA box binding protein (TBP)-associated factor ENST00000356784.1 alternatively spliced 5' UTR, shares CDS with dJ738A13.1.1 ENST00000356784.1 alternative 5' UTR ENST00000331267.5 ribosomal protein L21 (RPL21) pseudogene ENST00000372902.3 translocase of inner mitochondrial membrane 8 homolog A (yeast) ENST00000480575.1 translocase of inner mitochondrial membrane 8 homolog A (yeast) ENST00000372880.1 Bruton agammaglobulinemia tyrosine kinase ENST00000308731.7 Bruton agammaglobulinemia tyrosine kinase ENST00000470069.1 Bruton agammaglobulinemia tyrosine kinase ENST00000470069.1 this variant and one or more of variant fragments .4.4 through .4.7 could be part of a single variant ENST00000488970.1 Bruton agammaglobulinemia tyrosine kinase ENST00000478995.1 Bruton agammaglobulinemia tyrosine kinase ENST00000478995.1 this variant and one or more of variant fragments .4.3, .4.6 and .4.7 could be part of a single variant ENST00000470329.1 Bruton agammaglobulinemia tyrosine kinase ENST00000470329.1 this variant and one or more of variant fragments .4.3, .4.6 and .4.7 could be part of a single variant ENST00000464006.1 Bruton agammaglobulinemia tyrosine kinase ENST00000464006.1 this variant and one or more of variant fragments .4.3, .4.4, .4.5 and .4.7 could be part of a single variant ENST00000464567.1 this variant and one or more of variant fragments .4.3 through .4.6 could be part of a single variant ENST00000464567.1 Bruton agammaglobulinemia tyrosine kinase ENST00000493905.1 galactosidase, alpha ENST00000218516.3 galactosidase, alpha ENST00000466414.1 galactosidase, alpha ENST00000468823.1 galactosidase, alpha ENST00000480513.1 galactosidase, alpha ENST00000486121.1 galactosidase, alpha ENST00000479445.1 galactosidase, alpha ENST00000392722.2 protein kinase C, iota (PRKCI) pseudogene ENST00000372828.2 this is a duplication of the 3' end of the ARMCX6 gene further downstream ENST00000361910.4 FLJ20811 ENST00000497931.1 novel transcript ENST00000462302.1 novel transcript ENST00000467089.1 novel transcript ENST00000495964.1 novel transcript ENST00000494624.1 novel transcript ENST00000454228.1 putative novel transcript ENST00000479298.1 novel transcript ENST00000477980.1 novel transcript ENST00000341189.3 ALEX3 protein (ALEX3) ENST00000471229.1 novel transcript ENST00000467808.1 novel transcript ENST00000491568.1 novel transcript ENST00000328766.5 alternative 5' UTR; CDS shared with cV602D8.1.2, cV602D8.1.3, cV602D8.1.5, cV602D8.1.6, cV602D8.1.7, cV602D8.1.9 and cV602D8.1.10 ENST00000328766.5 armadillo repeat protein ALEX2 (ALEX2) ENST00000328766.5 alternative 5' UTR ENST00000330154.2 alternative 5' UTR; CDS shared with cV602D8.1.1, cV602D8.1.2, cV602D8.1.5, cV602D8.1.6, cV602D8.1.7, cV602D8.1.9 and cV602D8.1.10 ENST00000330154.2 armadillo repeat protein ALEX2 (ALEX2) ENST00000330154.2 alternative 5' UTR ENST00000356824.4 alternative 5' UTR; CDS shared with cV602D8.1.1, cV602D8.1.3, cV602D8.1.5, cV602D8.1.6, cV602D8.1.7, cV602D8.1.9 and cV602D8.1.10 ENST00000356824.4 armadillo repeat protein ALEX2 (ALEX2) ENST00000356824.4 alternative 5' UTR ENST00000413506.1 armadillo repeat protein ALEX2 (ALEX2) ENST00000413506.1 alternative 5' UTR; CDS shared with cV602D8.1.1, cV602D8.1.2, cV602D8.1.3, cV602D8.1.5, cV602D8.1.7, cV602D8.1.9 and cV602D8.1.10 ENST00000413506.1 alternative 5' UTR ENST00000433318.1 alternative 5' UTR; CDS shared with cV602D8.1.1, cV602D8.1.2, cV602D8.1.3, cV602D8.1.5, cV602D8.1.6, cV602D8.1.7 and cV602D8.1.9 ENST00000433318.1 armadillo repeat protein ALEX2 (ALEX2) ENST00000433318.1 alternative 5' UTR ENST00000440675.1 armadillo repeat protein ALEX2 (ALEX2) ENST00000440675.1 alternative 5' UTR ENST00000440675.1 alternative 5' UTR; CDS shared with cV602D8.1.1, cV602D8.1.2, cV602D8.1.3, cV602D8.1.6, cV602D8.1.7, cV602D8.1.9 and cV602D8.1.10 ENST00000458024.1 alternative 5' UTR; CDS shared with cV602D8.1.1, cV602D8.1.2, cV602D8.1.3, cV602D8.1.5, cV602D8.1.6, cV602D8.1.9 and cV602D8.1.10 ENST00000458024.1 armadillo repeat protein ALEX2 (ALEX2) ENST00000458024.1 alternative 5' UTR ENST00000467416.1 putative novel transcript ENST00000431597.1 alternative 5' UTR; CDS shared with cV602D8.1.1, cV602D8.1.2, cV602D8.1.3, cV602D8.1.5, cV602D8.1.6, cV602D8.1.7 and cV602D8.1.10 ENST00000431597.1 armadillo repeat protein ALEX2 (ALEX2) ENST00000431597.1 alternative 5' UTR ENST00000479333.1 novel transcript ENST00000496581.1 novel transcript ENST00000488982.1 putative novel transcript ENST00000475854.1 putative novel transcript ENST00000454247.1 novel pseudogene ENST00000423552.1 novel zinc finger protein pseudogene ENST00000328462.6 glycerol kinase (GK) pseudogene ENST00000473265.2 NP_116564.2 ENST00000372782.3 novel protein (KIAA1789) ENST00000494068.1 novel transcript ENST00000488347.1 novel transcript ENST00000490757.1 novel transcript ENST00000429048.1 zinc finger protein pseudogene ENST00000445127.1 histone H2B family pseudogene ENST00000436830.1 novel pseudogene ENST00000443510.1 NADH dehydrogenase 6 (MTND6) pseudogene ENST00000476749.1 novel transcript ENST00000329035.2 my048 protein ENST00000372774.3 novel protein similar to my048 protein (my048) ENST00000372773.1 novel protein similar to my048 protein (my048) ENST00000333643.3 novel protein (LOC340542) ENST00000484837.1 novel transcript ENST00000372763.1 nuclear RNA export factor 2 ENST00000372758.1 nuclear RNA export factor 2 ENST00000372757.1 nuclear RNA export factor 2 ENST00000472029.1 nuclear RNA export factor 2 ENST00000372749.1 novel protein similar to nuclear RNA export factor 2 (NXF2) ENST00000372750.1 novel protein similar to nuclear RNA export factor 2 (NXF2) ENST00000489531.1 novel transcript ENST00000325117.7 checkpoint suppressor 1 (CHES1) pseudogene ENST00000416098.1 nuclear RNA export factor (NXF) family pseudogene ENST00000246174.2 novel protein, variant 1 (FLJ39373) ENST00000473968.1 novel transcript ENST00000465548.1 novel transcript ENST00000477663.1 novel transcript ENST00000460026.1 novel transcript ENST00000466616.1 novel transcript ENST00000475738.1 novel transcript ENST00000476910.1 novel transcript ENST00000486740.1 novel transcript ENST00000479502.1 novel transcript ENST00000460793.1 novel transcript ENST00000372742.1 novel protein, variant 2 (FLJ12969) ENST00000372742.1 alternative 5' UTR ENST00000372742.1 alternatively spliced 5' UTR, shares CDS with .3.1 ENST00000446931.1 histone 3, H3 (HIST3H3) pseudogene ENST00000361600.4 G protein-coupled receptor-associated sorting protein ENST00000466098.1 G protein-coupled receptor-associated sorting protein ENST00000422058.1 novel pseudogene ENST00000483720.1 novel transcript ENST00000486814.1 novel transcript ENST00000465228.1 novel transcript ENST00000483294.1 novel transcript ENST00000361229.4 novel protein (KIAA1701) ENST00000486988.1 novel transcript ENST00000372735.1 novel protein (KIAA1701) ENST00000440496.1 novel transcript ENST00000420471.1 this variant and variant fragment .11.2 could be part of one single variant ENST00000420471.1 novel transcript ENST00000435966.1 novel transcript ENST00000431616.1 novel transcript ENST00000416381.1 this variant and variant fragment .11.3 could be part of one single variant ENST00000416381.1 novel transcript ENST00000433043.1 mitochodrial NADH dehydrogenase 1 (MTND1) pseudogene ENST00000434633.1 mitochondrial NADH dehydrogenase 2 (MTND2) pseudogene ENST00000443487.1 pseudogene similar to part of cytochrome c oxidase I (MTCO1) ENST00000427513.1 mitochondrial cytochrome C oxidase II (MTCO2) pseudogene ENST00000413797.1 mitochondrial ATP synthase 6 (MTATP6) pseudogene ENST00000415864.1 pseudogene similar to part of cytochrome c oxidase II (MTCO2) ENST00000437189.1 mitochondrial NADH dehydrogenase 4 (MTND4) pseudogene ENST00000426018.1 mitochondrial NADH dehydrogenase 5 (MTND5) pseudogene ENST00000457611.1 mitochondrial NADH dehydrogenase 6 (MTND6) pseudogene ENST00000427945.1 mitochondrial cytochrome B (MTCYB) pseudogene ENST00000426528.1 novel transcript ENST00000429932.1 novel transcript ENST00000413528.1 putative novel transcript ENST00000372728.3 brain expressed, X-linked 1 ENST00000395065.3 nuclear RNA export factor 3 ENST00000497850.1 nuclear RNA export factor 3 ENST00000468528.1 nuclear RNA export factor 3 ENST00000470724.1 nuclear RNA export factor 3 ENST00000427570.1 nuclear RNA export factor 3 ENST00000494300.1 nuclear RNA export factor 3 ENST00000497215.1 nuclear RNA export factor 3 ENST00000460791.1 nuclear RNA export factor 3 ENST00000440243.1 novel pseudogene ENST00000421048.1 laminin receptor 1 (ribosomal protein SA, 67kDa)(LAMR1) pseudogene ENST00000372695.5 novel Brain expressed X-linked like family protein (FLJ10097) ENST00000372691.3 novel Brain expressed X-linked like family protein (FLJ10097) ENST00000360000.4 alternative 5' UTR; shares CDS with cU177E8.3.1 ENST00000360000.4 novel protein (MGC45400) ENST00000360000.4 alternative 5' UTR ENST00000372685.3 novel protein (MGC45400) ENST00000372685.3 alternative 5' UTR; shares CDS with cU177E8.3.2 ENST00000372685.3 alternative 5' UTR ENST00000451678.1 novel protein (MGC45400) ENST00000413929.1 guanosine monophosphate reductase (GMPR) pseudogene ENST00000372680.1 novel protein ENST00000372677.3 X-linked protein ENST00000372677.3 alternative 5' UTR; shares CDS with dJ79P11.1.2 and dJ79P11.1.3 ENST00000372677.3 alternative 5' UTR ENST00000372674.1 X-linked protein ENST00000372674.1 alternative 5' UTR; shares CDS with dJ79P11.1.1 and dJ79P11.1.3 ENST00000372674.1 alternative 5' UTR ENST00000449185.1 X-linked protein ENST00000449185.1 alternative 5' UTR ENST00000449185.1 alternative 5' UTR; shares CDS with dJ79P11.1.1 and dJ79P11.1.2 ENST00000332431.4 novel protein (MGC23947) ENST00000372666.1 novel protein ENST00000456203.1 nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1) pseudogene ENST00000372661.3 pp21 homolog (LOC51186) ENST00000372661.3 alternative 5' UTR; shares CDS with cU105G4.2.2 ENST00000372661.3 alternative 5' UTR ENST00000372656.3 pp21 homolog (LOC51186) ENST00000372656.3 alternative 5' UTR; shares CDS with cU105G4.2.1 ENST00000372656.3 alternative 5' UTR ENST00000361298.4 alternatively spliced 5' UTR; shares CDS with bB349O20.1.4 ENST00000361298.4 nerve growth factor receptor (TNFRSF16) associated protein 1 ENST00000361298.4 alternative 5' UTR ENST00000372645.3 nerve growth factor receptor (TNFRSF16) associated protein 1 ENST00000372645.3 alternatively spliced 5' UTR; shares CDS with bB349O20.1.3 ENST00000372645.3 alternative 5' UTR ENST00000372635.1 nerve growth factor receptor (TNFRSF16) associated protein 1 ENST00000372635.1 alternatively spliced 5' UTR; shares CDS with bB349O20.1.1 ENST00000372635.1 alternative 5' UTR ENST00000372634.1 alternatively spliced 5' UTR; shares CDS with bB349O20.1.2 ENST00000372634.1 nerve growth factor receptor (TNFRSF16) associated protein 1 ENST00000372634.1 alternative 5' UTR ENST00000445990.1 novel transcript ENST00000412375.1 novel transcript ENST00000372633.1 RAB40A, member RAS oncogene family ENST00000304236.1 RAB40A, member RAS oncogene family ENST00000468024.1 alternative 5' UTR ENST00000472484.1 alternative 5' UTR ENST00000415568.2 alternative 5' UTR ENST00000490644.1 alternative 5' UTR ENST00000459722.1 alternative 5' UTR ENST00000494801.1 alternative 5' UTR ENST00000434216.2 alternative 5' UTR ENST00000425011.1 alternative 5' UTR ENST00000469586.1 alternative 5' UTR ENST00000372628.1 novel protein (MGC15737) ENST00000372627.5 novel protein (MGC15737) ENST00000477014.1 novel transcript ENST00000424887.1 novel transcript ENST00000372626.3 transcription elongation factor A (SII)-like 1 ENST00000372625.3 transcription elongation factor A (SII)-like 1 ENST00000469820.1 transcription elongation factor A (SII)-like 1 ENST00000372624.3 transcription elongation factor A (SII)-like 1 ENST00000423374.1 novel pseudogene (LOC139779) ENST00000360458.1 mortality factor 4 like 2 ENST00000372620.1 mortality factor 4 like 2 ENST00000441076.2 mortality factor 4 like 2 ENST00000434230.1 mortality factor 4 like 2 ENST00000418819.1 mortality factor 4 like 2 ENST00000442614.1 mortality factor 4 like 2 ENST00000492116.1 mortality factor 4 like 2 ENST00000422355.1 mortality factor 4 like 2 ENST00000474653.1 mortality factor 4 like 2 ENST00000498064.1 mortality factor 4 like 2 ENST00000467755.1 mortality factor 4 like 2 ENST00000488331.1 mortality factor 4 like 2 ENST00000435306.1 novel transcript ENST00000372617.4 novel protein (possible ortholog of mouse glycine receptor, alpha 4 subunit (GLRA4)) ENST00000480725.1 This variant maybe coding as suggested by the polyA features in Bos taurus cDNA Em:BC142201.1 ENST00000319560.6 novel protein (MGC39655) ENST00000303958.2 ) ENST00000243298.2 RAB9B, member RAS oncogene family ENST00000461229.1 histone H2B pseudogene ENST00000417646.1 E74-like factor 2 (ELF2) pseudogene ENST00000447281.1 novel transcript ENST00000419165.1 novel transcript ENST00000436583.1 novel transcript ENST00000455723.1 novel transcript ENST00000451950.1 solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21 (SLC25A21) pseudogene ENST00000448050.1 developmental pluripotency associated 3 (DPPA3) pseudogene ENST00000422550.1 histone H2B pseudogene ENST00000441761.1 histone H2B pseudogene ENST00000357421.4 novel protein (LOC170242) ENST00000467290.1 novel transcript ENST00000422784.1 novel transcript ENST00000423478.1 novel transcript ENST00000493442.1 novel protein (LOC139231) ENST00000299906.5 novel transcript ENST00000372582.1 interleukin 1 receptor accessory protein-like 2 ENST00000485671.1 interleukin 1 receptor accessory protein-like 2 ENST00000416467.1 prohibitin (PHB) pseudogene ENST00000417685.1 ribosomal protein L18a (RPL18A) pseudogene ENST00000372578.3 testis expressed sequence 13A ENST00000372575.1 testis expressed sequence 13A ENST00000243300.9 non canonical other ENST00000243300.9 It seems this protein is expressed during the late stages of embryogenesis but not in adult tissues. See Nakano et. al PMID: 10801798 ENST00000243300.9 DKFZp686A17109 ENST00000243300.9 non-canonical acceptor splice site between exons 24 and 25 ENST00000327674.4 serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7 ENST00000372563.1 serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7 ENST00000487487.1 serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7 ENST00000434586.1 novel pseudogene ENST00000357175.2 novel protein ENST00000372552.1 novel protein (FLJ31916) ENST00000425958.1 nucleosome assembly protein 1 pseudogene ENST00000443077.1 serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin) member 7 (SERPINA7) pseudogene ENST00000372548.4 novel protein ENST00000461251.1 novel protein (FLJ10178) ENST00000421550.1 novel protein (FLJ10178) ENST00000478395.1 novel transcript ENST00000497124.1 novel transcript ENST00000418562.1 ring finger protein 128 ENST00000324342.3 ring finger protein 128 ENST00000255499.2 ring finger protein 128 ENST00000310452.2 NP_942582 ENST00000276173.4 novel protein (LOC92129) ENST00000276173.4 NP_612391 ENST00000411805.1 novel protein ENST00000336803.1 claudin 2 ENST00000355610.4 FLJ11565 ENST00000255495.7 NP_001078823 ENST00000412883.1 eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) pseudogene ENST00000372487.1 novel protein (FLJ11016) ENST00000495517.1 novel protein ENST00000474499.1 novel transcript ENST00000372479.3 novel protein ENST00000434854.1 novel protein ENST00000475556.1 novel transcript ENST00000485676.1 novel transcript ENST00000471079.1 novel transcript ENST00000372466.4 novel protein (FLJ20130) ENST00000484614.1 novel protein ENST00000432145.1 novel protein ENST00000421752.1 novel protein ENST00000399148.2 novel pseudogene ENST00000372453.3 novel protein (MGC35261) ENST00000336387.4 novel protein (MGC35261) ENST00000399417.2 DnaJ (Hsp40) homolog, subfamily A, member 1 (HDJ2, HSDJ, HSJ2, HSPF4) (DNAJA1) pseudogene ENST00000427083.1 pseudogene similar to part of keratin 18 (K18, CYK18) (KRT18) ENST00000415252.1 putative novel transcript ENST00000439554.1 includes KIAA1817 ENST00000372435.4 phosphoribosyl pyrophosphate synthetase 1 (PRSI) ENST00000372419.3 phosphoribosyl pyrophosphate synthetase 1 (PRSI) ENST00000372418.1 phosphoribosyl pyrophosphate synthetase 1 (PRSI) ENST00000372390.4 NP_001015881 ENST00000315660.4 alternative 5' UTR ENST00000372384.2 alternative 5' UTR ENST00000506081.1 alternative 5' UTR ENST00000486554.1 alternative 5' UTR ENST00000514897.1 alternative 5' UTR ENST00000510887.1 alternative 5' UTR ENST00000502650.1 alternative 5' UTR ENST00000506724.1 alternative 5' UTR ENST00000505965.1 alternative 5' UTR ENST00000502961.1 alternative 5' UTR ENST00000509000.1 putative novel transcript ENST00000372379.1 novel protein similar to nuclear cap binding protein subunit 2 (NCBP2) ENST00000372379.1 possible pseudogene ENST00000262843.6 NP_036348.2 ENST00000443968.2 NP_438112.2 ENST00000430140.1 novel transcript ENST00000451535.1 novel pseudogene ENST00000302917.1 testis expressed sequence 13B ENST00000217958.3 proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 (p28) ENST00000372296.1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 (p28) ENST00000372295.1 proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 (p28) ENST00000361815.5 proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 (p28) ENST00000340200.5 proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 (p28) ENST00000338548.4 proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 (p28) ENST00000343524.5 FLJ30365 ENST00000372216.4 Collagen, type IV, alpha 6 ENST00000372216.4 NP_001838 ENST00000334504.7 NP_378667 ENST00000334504.7 Collagen, type IV, alpha 6 ENST00000477085.1 Collagen, type IV, alpha 6 ENST00000436013.1 novel transcript ENST00000399414.2 glyceraldehyde-3-phosphate dehydrogenase (GAPD) pseudogene ENST00000218006.2 guanylate cyclase 2F retinal ENST00000218004.1 nuclear transport factor 2-like export factor 2 ENST00000372107.1 nuclear transport factor 2-like export factor 2 ENST00000372106.1 nuclear transport factor 2-like export factor 2 ENST00000372103.1 nuclear transport factor 2-like export factor 2 ENST00000440201.1 mitofusin 1 (MFN1) pseudogene ENST00000439581.1 novel transcript ENST00000505855.1 alternative 5' UTR ENST00000502391.1 alternative 5' UTR ENST00000508092.1 alternative 5' UTR ENST00000504980.1 alternative 5' UTR ENST00000469857.1 alternative 5' UTR ENST00000456664.1 ribosomal protein S5 (RPS5) pseudogene ENST00000497754.1 this variant and variant fragment .1.6 could be part of a single variant ENST00000497754.1 novel transcript ENST00000471255.1 novel transcript ENST00000372073.1 novel protein ENST00000288381.4 novel protein (FLJ22679) ENST00000461715.1 this variant and variant fragment .1.5 could be part of a single variant ENST00000461715.1 novel transcript ENST00000464177.1 novel transcript ENST00000372057.1 GenBank: BAG52359.1 ENST00000473662.1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 ENST00000496695.1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region, gene 1 ENST00000418848.1 putative novel transcript ENST00000372054.1 novel protein similar to guanine nucleotide binding protein (G protein), gamma 5 (GNG5) ENST00000520821.1 alternative 5' UTR ENST00000493351.1 teratocarcinoma-derived growth factor 3 (TDGF3) pseudogene ENST00000436086.1 mannose-6-phosphate receptor (cation dependent) (M6PR) pseudogene ENST00000372045.1 likely ortholog of mouse neuralin 1 (NRLN1) ENST00000394797.4 NP_660277.2 ENST00000372042.1 NP_001137453.1 ENST00000372042.1 likely ortholog of mouse neuralin 1 (NRLN1) ENST00000444321.2 NP_001137454.1 ENST00000484442.1 p21 (CDKN1A)-activated kinase 3 ENST00000372010.1 p21 (CDKN1A)-activated kinase 3 ENST00000519681.1 NP_001121644 ENST00000372007.4 p21 (CDKN1A)-activated kinase 3 ENST00000518291.1 NP_001121640 ENST00000429193.1 p21 (CDKN1A)-activated kinase 3 ENST00000487802.1 p21 (CDKN1A)-activated kinase 3 ENST00000448326.1 pseudogene similar to part of chromosome 14 open reading frame 111 (C14orf111) ENST00000420997.1 glutamate dehydrogenase 1 (GLUD1) pseudogene ENST00000324068.1 calpain 6 ENST00000358070.4 doublecortex; lissencephaly, X-linked (doublecortin) ENST00000356220.3 doublecortex; lissencephaly, X-linked (doublecortin) ENST00000488120.1 doublecortex; lissencephaly, X-linked (doublecortin) ENST00000496551.1 doublecortex; lissencephaly, X-linked (doublecortin) ENST00000438594.1 high-mobility group (nonhistone chromosomal) pseudogene ENST00000448271.1 novel pseudogene (PRO1843) ENST00000432307.1 eukaryotic translation initiation factor 4B (EIF4B) pseudogene ENST00000430258.1 60S ribosomal protein 18A (RPL18A) pseudogene ENST00000482374.1 novel transcript ENST00000492038.1 novel transcript ENST00000489033.1 novel transcript ENST00000471924.1 novel transcript ENST00000468657.1 novel transcript ENST00000482742.1 novel transcript ENST00000436609.1 FLJ23018 ENST00000470971.1 novel transcript ENST00000262839.2 transient receptor potential cation channel, subfamily C, member 5 ENST00000371970.2 novel transcript ENST00000371968.3 lipoma HMGIC fusion-partner-like (LOC340596) ENST00000478229.1 lipoma HMGIC fusion-partner-like (LOC340596) ENST00000457863.1 high-mobility group box 3 (HMGB3) pseudogene ENST00000304758.1 angiomotin ENST00000524145.1 NP_001106962.1 ENST00000462114.1 angiomotin ENST00000441559.1 novel pseudogene similar to PRO2831. ENST00000457667.1 novel pseudogene ENST00000403700.2 peptidyl-prolyl isomerase G (cyclophilin G) (PPIG) pseudogene ENST00000468762.1 novel transcript ENST00000449911.1 novel pseudogene ENST00000371951.1 5-hydroxytryptamine (serotonin) receptor 2C ENST00000276198.1 5-hydroxytryptamine (serotonin) receptor 2C ENST00000371950.3 5-hydroxytryptamine (serotonin) receptor 2C ENST00000432891.1 ribosomal protein L36a (RPL36A) pseudogene ENST00000435767.1 novel transcript ENST00000443628.1 heat shock 70kDa protein 8 (HSPA8) pseudogene ENST00000371936.1 interleukin 13 receptor alpha 2 ENST00000468224.1 interleukin 13 receptor alpha 2 ENST00000418638.1 zinc finger protein 33a (ZNF33A) pseudogene ENST00000455104.1 yes-associated protein 1 65kDa (YAP1) pseudogene ENST00000317135.8 NP_065922 ENST00000419316.1 ribosomal protein L36 (RPL36) pseudogene ENST00000371921.1 HOM-TES-85 tumor antigen (HOM-TES-85) ENST00000371920.3 HOM-TES-85 tumor antigen (HOM-TES-85) ENST00000450104.1 alpha tubulin pseudogene ENST00000489283.1 plastin 3 (T isoform) ENST00000355899.3 plastin 3 (T isoform) ENST00000289290.3 GenBank: BAG57725.1 ENST00000498113.1 plastin 3 (T isoform) ENST00000435496.1 argininosuccinate synthetase pseudogene 5 ENST00000434365.1 Elongation factor 1-gamma (LOC136337) pseudogene ENST00000449327.1 novel protein similar to SMT3 suppressor of mif two 3 homolog 2 (LOC158997) ENST00000430756.1 novel transcript ENST00000418396.1 aldo-keto reductase family 1, member B1 (aldose reductase) (AKR1B1) pseudogene ENST00000424316.1 apoptosis inhibitor 5 (API5) pseudogene ENST00000371906.4 angiotensin II receptor, type 2 ENST00000371900.4 solute carrier family 6 (neurotransmitter transporter), member 14 ENST00000463626.1 solute carrier family 6 (neurotransmitter transporter), member 14 ENST00000371894.4 novel protein (LOC203413) ENST00000428194.1 pseudogene similar to part of solute carrier family 6 (neurotransmitter transporter), member 14 (SLC6A14) ENST00000424402.1 pseudogene similar to part of solute carrier family 6 (neurotransmitter transporter), member 14 (SLC6A14) ENST00000446495.1 putative novel transcript ENST00000435341.1 SET translocation (myeloid leukemia-associated) (SET) pseudogene ENST00000438228.1 novel pseudogene ENST00000447458.1 pseudogene similar to part of TCERG1 (transcription elongation regulator 1 (CA150)) ENST00000371882.1 alternative 5' UTR ENST00000371876.1 alternative 5' UTR ENST00000371878.1 upstream_ATG-9 and upstream_ATG-46 ENST00000371878.1 alternative 5' UTR ENST00000447671.2 alternative 5' UTR ENST00000469946.1 upstream_ATG-53 and upstream_ATG-54 ENST00000469946.1 alternative 5' UTR ENST00000453826.1 alternative 5' UTR ENST00000436163.1 novel pseudogene ENST00000254029.3 novel protein similar to rab11-binding protein (DKFZp686L20145) ENST00000371825.3 novel protein similar to rab11-binding protein ENST00000493448.1 novel transcript ENST00000371848.3 novel protein similar to rab11-binding protein ENST00000276204.6 novel protein similar to zizimin1 (FLJ32122) ENST00000276202.7 NP_653259.3 ENST00000498252.1 novel transcript ENST00000449447.1 retinoblastoma binding protein 8 (RBBP8) pseugdogene ENST00000371666.3 interleukin 13 receptor, alpha 1 (NR4, IL-13RA, IL-13Ra) ENST00000371642.1 interleukin 13 receptor, alpha 1 (NR4, IL-13RA, IL-13Ra) ENST00000481868.1 interleukin 13 receptor, alpha 1 (NR4, IL-13RA, IL-13Ra) ENST00000506969.1 novel pseudogene ENST00000310164.2 novel protein (LOC170261) ENST00000412422.1 novel transcript ENST00000445747.1 aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) (AKR7A2) pseudogene ENST00000443421.1 pseudogene similar to part of KIAA0633 protein (COBL) ENST00000481285.1 ring finger protein 127, variant 3 (FLJ34458) ENST00000439603.1 ring finger protein 127, variant 2 (FLJ22612) ENST00000472173.1 ring finger protein 127, variant 4 (FLJ40322) ENST00000418991.1 ADP-ribosylation factor-like 5 (ARL5) pseudogene ENST00000424481.1 heterogeneous nuclear ribonucleoprotein A1 (HNRPA1) pseudogene ENST00000217971.7 progesterone receptor membrane component 1 ENST00000431706.1 putative novel transcript ENST00000428222.1 novel transcript ENST00000413240.1 novel transcript ENST00000217909.7 novel protein (LOC203427) ENST00000488158.1 novel transcript ENST00000493093.1 novel transcript ENST00000495750.1 novel transcript ENST00000484058.1 novel transcript ENST00000414435.1 putative novel transcript ENST00000446986.1 novel transcript ENST00000445759.1 novel transcript ENST00000486230.1 novel protein (FLJ22965) ENST00000320339.4 novel protein (FLJ22965) ENST00000476164.1 alternatively spliced 5' UTR, shares CDS with Em:AC004000.4.1 ENST00000476164.1 novel protein (FLJ22965) ENST00000476164.1 alternative 5' UTR ENST00000469448.1 novel transcript ENST00000371558.2 ubiquitin-conjugating enzyme E2A (RAD6 homolog) (UBC2, HHR6A, RAD6A) ENST00000346330.3 ubiquitin-conjugating enzyme E2A (RAD6 homolog) (UBC2, HHR6A, RAD6A) ENST00000469205.1 ubiquitin-conjugating enzyme E2A (RAD6 homolog) (UBC2, HHR6A, RAD6A) ENST00000371569.5 ubiquitin-conjugating enzyme E2A (RAD6 homolog) (UBC2, HHR6A, RAD6A) ENST00000371527.1 NF-kappa B-repressing factor (ITBA4) (NRF) ENST00000304449.5 alternatively spliced 5' UTR, shares CDS with Em:AC004913.3.1 ENST00000304449.5 alternative 5' UTR ENST00000304449.5 NF-kappa B-repressing factor (ITBA4) (NRF) ENST00000487600.1 novel transcript ENST00000360156.7 septin 6 (SEP2, KIAA0128, MGC16619, MGC20339) (SEPT6) ENST00000354228.4 septin 6 (SEP2, KIAA0128, MGC16619, MGC20339) (SEPT6) ENST00000460411.1 septin 6 (SEP2, KIAA0128, MGC16619, MGC20339) (SEPT6) ENST00000489216.1 septin 6 (SEP2, KIAA0128, MGC16619, MGC20339) (SEPT6) ENST00000354416.3 septin 6 (SEP2, KIAA0128, MGC16619, MGC20339) (SEPT6) ENST00000343984.5 septin 6 (SEP2, KIAA0128, MGC16619, MGC20339) (SEPT6) ENST00000467310.1 septin 6 (SEP2, KIAA0128, MGC16619, MGC20339) (SEPT6) ENST00000481072.1 septin 6 (SEP2, KIAA0128, MGC16619, MGC20339) (SEPT6) ENST00000477403.1 ribosomal protein L39 ENST00000468844.1 ribosomal protein L39 ENST00000361575.3 ribosomal protein L39 ENST00000276201.2 UPF3 regulator of nonsense transcripts homolog B (yeast) (UPF3X, HUPF3B, RENT3B) ENST00000345865.2 UPF3 regulator of nonsense transcripts homolog B (yeast) (UPF3X, HUPF3B, RENT3B) ENST00000478840.1 UPF3 regulator of nonsense transcripts homolog B (yeast) (UPF3X, HUPF3B, RENT3B) ENST00000371437.4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 1, 7.5kDa (MWFE, CI-MWFE) ENST00000371431.3 A-kinase anchoring protein 28 (AKAP28) ENST00000371422.1 A-kinase anchoring protein 28 (AKAP28) ENST00000334356.2 A-kinase anchoring protein 28 (AKAP28) ENST00000491105.1 novel transcript ENST00000455986.1 putative novel transcript ENST00000477789.1 novel transcript ENST00000371410.3 novel protein (FLJ22626) ENST00000482407.1 novel transcript ENST00000403720.2 novel pseudogene ENST00000429708.1 eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) pseudogene ENST00000557385.1 alternative 5' UTR ENST00000309720.5 novel protein (FLJ20716) ENST00000371369.4 novel protein ENST00000371352.1 novel protein ENST00000519908.1 NP_001098015 ENST00000480821.1 novel transcript ENST00000439244.1 prefoldin 4 (PFDN4) pseudogene ENST00000218008.3 ATPase, (Na+)/K+ transporting, beta 4 polypeptide ENST00000361319.3 ATPase, (Na+)/K+ transporting, beta 4 polypeptide ENST00000434600.2 NP_001116078 ENST00000200639.4 lysosomal-associated membrane protein 2 (LAMPB, CD107b) ENST00000486593.1 lysosomal-associated membrane protein 2 (LAMPB, CD107b) ENST00000371335.4 lysosomal-associated membrane protein 2 (LAMPB, CD107b) ENST00000371322.5 N-terminal of protein translation has 115 extension compared to published sequence in TR:Q9BY37 ENST00000371322.5 cullin 4B (KIAA0695) ENST00000336592.6 cullin 4B (KIAA0695) ENST00000404115.3 cullin 4B ENST00000497616.1 cullin 4B ENST00000371323.2 cullin 4B (KIAA0695) ENST00000467641.1 cullin 4B (KIAA0695) ENST00000486604.1 cullin 4B ENST00000493879.1 novel transcript ENST00000493274.1 novel transcript ENST00000371317.5 MCT-1 protein (MCT-1) ENST00000371315.3 MCT-1 protein (MCT-1) ENST00000487133.1 novel transcript ENST00000484481.1 novel transcript ENST00000424799.1 novel transcript ENST00000427955.1 novel pseudogene ENST00000457020.2 novel protein similar to LOC347458 ENST00000430448.2 novel protein similar to LOC347458 ENST00000417256.2 novel protein similar to LOC347458 ENST00000457977.2 novel protein similar to LOC347458 ENST00000434883.2 novel protein similar to LOC347458 ENST00000439466.2 novel protein similar to LOC347458 ENST00000443600.2 novel protein similar to LOC347458 ENST00000415858.2 novel protein similar to LOC347458 ENST00000441330.2 novel protein similar to LOC347458 ENST00000433030.1 novel protein similar to Proliferation-associated protein 2G4 (Cell cycle protein p38-2G4 homolog) (hG4-1) (LOC347458) ENST00000458218.2 novel protein similar to LOC347458 ENST00000424220.1 E-cadherin binding protein E7 (HAKAI) pseudogene ENST00000425843.1 heat shock 70kDa protein 8 (HSPA8) pseudogene ENST00000449760.1 translationally-controlled 1 tumor protein (TPT1) pseudogene ENST00000457727.1 pseudogene similar to part of ubiquitin-conjugating enzyme E2 ENST00000436852.1 ribosomal protein L3 (RPL3) pseudogene ENST00000435941.1 possibly a psedogene ENST00000371266.1 glutamate receptor ionotrophic AMPA 3 ENST00000371264.3 glutamate receptor ionotrophic AMPA 3 ENST00000371256.5 glutamate receptor ionotrophic AMPA 3 ENST00000371251.1 glutamate receptor ionotrophic AMPA 3 ENST00000479118.1 glutamate receptor ionotrophic AMPA 3 ENST00000477389.1 glutamate receptor ionotrophic AMPA 3 ENST00000460123.1 glutamate receptor ionotrophic AMPA 3 ENST00000416267.1 H3 histone, family 3B (H3.3B) (H3F3B) pseudogene ENST00000450755.1 tubulin beta 4 (TUBB4) pseudogene ENST00000448128.1 THO complex 2, variant 3 ENST00000441692.1 THO complex 2, variant 9 ENST00000464992.1 THO complex 2, variant 7 ENST00000464982.1 THO complex 2, variant 6 ENST00000438358.1 THO complex 2, variant 8 ENST00000459945.1 THO complex 2, variant 4 ENST00000464161.1 THO complex 2, variant 5 ENST00000436391.1 fer (fps/fes related) tyrosine kinase (phosphoprotein NCP94) (FER) pseudogene ENST00000442332.1 novel transcript ENST00000468691.1 baculoviral IAP repeat-containing 4, variant 2 ENST00000458331.1 novel transcript ENST00000438019.1 par-6 partitioning defective 6 homolog beta (C. elegans) (PARD6B) pseudogene ENST00000455404.1 stromal antigen 2, variant 2 ENST00000455404.1 alternative 5' UTR ENST00000371157.3 stromal antigen 2, variant 1 ENST00000458176.1 stromal antigen 2, variant 5 ENST00000456074.1 zinc finger pseudogene ENST00000448737.1 heat shock 70kD protein 8 (HSPA8) pseudogene ENST00000428821.1 nucleophosmin (nucleolar phosphoprotein B23, numatrin (NPM1)) pseudogene ENST00000418891.1 testis expressed sequence 13 (TEX13) pseudogene ENST00000371139.4 SH2 domain protein 1A, Duncan's disease (lymphoproliferative syndrome) ENST00000360027.4 NP_001108409.1 ENST00000470647.1 SH2 domain protein 1A, Duncan's disease (lymphoproliferative syndrome) ENST00000491950.1 SH2 domain protein 1A, Duncan's disease (lymphoproliferative syndrome) ENST00000494073.1 SH2 domain protein 1A, Duncan's disease (lymphoproliferative syndrome) ENST00000477673.1 SH2 domain protein 1A, Duncan's disease (lymphoproliferative syndrome) ENST00000371130.3 odz, odd Oz/ten-m homolog 1 (Drosophila) ENST00000371130.3 odz, odd Oz/ten-m homolog 1(Drosophila) ENST00000461429.1 odz, odd Oz/ten-m homolog 1 (Drosophila) ENST00000415547.1 ribosomal protein (RPS26) pseudogene ENST00000422498.1 odz, odd Oz/ten-m homolog 1(Drosophila) (ODZ1) pseudogene ENST00000394467.2 filamin-binding LIM protein-1 (FBLP-1) pseudogene ENST00000438994.1 novel transcript ENST00000360028.2 novel protein similar to KIAA1892 ENST00000360028.2 probably a pseudogene ENST00000441633.1 prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase) (PTGS1) pseudogene ENST00000424002.1 pseudogene similar to part of NADH dehydrogenase 4 (MTND4) ENST00000371126.1 novel protein ENST00000417160.1 cytochrome b (MTCYB) pseudogene ENST00000371125.3 novel protein ENST00000422141.1 intracellular membrane-associated calcium-independent phospholipase A2 (IPLA2) pseudogene ENST00000417272.1 kinesin heavy chain member 2 (KIF2) pseudogene ENST00000446793.1 Huntingtin interacting protein K (HYPK) pseudogene ENST00000436514.1 novel pseudogene ENST00000435859.1 BTG family, member 3 (BTG3) pseudodgene ENST00000428208.1 actin-related protein pseudogene ENST00000417266.1 ribosomal protein L7a (RPL7A) pseudogene ENST00000449485.1 novel transcript ENST00000429864.1 RuvB-like 2 (E. coli) (RUVBL2) pseudogene ENST00000416086.1 keratin 18 (KRT18) pseudogene ENST00000415214.1 ribosomal protein L32 (RPL32) pseudogene ENST00000458202.1 tight junction protein 4 (peripheral) (TJP4) pseudogene ENST00000444468.1 ribosomal protein S26 (RPS26) pseudogene ENST00000371123.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 ENST00000371122.4 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 ENST00000450039.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 ENST00000478420.1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 ENST00000486673.1 oculocerebrorenal syndrome of Lowe ENST00000371113.4 oculocerebrorenal syndrome of Lowe ENST00000357121.5 oculocerebrorenal syndrome of Lowe ENST00000468314.1 oculocerebrorenal syndrome of Lowe ENST00000463271.1 oculocerebrorenal syndrome of Lowe ENST00000429967.1 apelin (APLN) ENST00000371105.3 X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound ENST00000371106.3 X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound ENST00000476532.1 chromosome X open reading frame 9 ENST00000356892.3 chromosome X open reading frame 9 ENST00000432513.1 putative novel transcript ENST00000357166.6 zinc finger, DHHC domain containing 9 (CGI-89, ZNF379) ENST00000357166.6 non-canonical donor splice site at 5th coding exon, and acceptor splice site at 6th coding exon ENST00000371064.3 zinc finger, DHHC domain containing 9 (CGI-89, ZNF379) ENST00000371064.3 non-canonical donor splice site at 5th coding exon, and acceptor splice site at 6th coding exon ENST00000433917.1 zinc finger, DHHC domain containing 9 (CGI-89, ZNF379) ENST00000433917.1 non-canonical donor splice site at 4th coding exon, and acceptor splice site at 5th coding exon ENST00000406492.2 zinc finger, DHHC domain containing 9 (CGI-89, ZNF379) ENST00000491039.1 zinc finger, DHHC domain containing 9 (CGI-89, ZNF379) ENST00000432062.1 putative novel transcript ENST00000423288.1 sal-like family pseudogene ENST00000394422.3 serologically defined colon cancer antigen 16 (NY-CO-16) ENST00000427972.1 serologically defined colon cancer antigen 16 (NY-CO-16) ENST00000498179.1 serologically defined colon cancer antigen 16 (NY-CO-16) ENST00000488135.1 novel transcript ENST00000218147.7 novel protein (FLJ11362) ENST00000456822.1 novel protein ENST00000441294.1 novel protein ENST00000335997.7 E74-like factor 4 (ets domain transcription factor) (MEF, ELFR) ENST00000308167.5 E74-like factor 4 (ets domain transcription factor) (MEF, ELFR) ENST00000434609.1 E74-like factor 4 (ets domain transcription factor) (MEF, ELFR) ENST00000460436.2 NP_001124318 ENST00000257017.4 RAB33A, member RAS oncogene family (S10, RabS10) ENST00000370978.4 novel protein (FLJ20095) ENST00000447817.1 nove protein ENST00000420331.1 SNRPN upstream reading frame (SNURF) pseudogene ENST00000495156.1 solute carrier family 25 (mitochondrial carrier, brain),member 14 (UCP5, BMCP1) ENST00000464342.1 solute carrier family 25 (mitochondrial carrier, brain),member 14 (UCP5, BMCP1) ENST00000464184.1 solute carrier family 25 (mitochondrial carrier, brain),member 14 (UCP5, BMCP1) ENST00000424447.1 solute carrier family 25 (mitochondrial carrier, brain),member 14 (UCP5, BMCP1) ENST00000424447.1 alternatively spliced 5' UTR, shares CDS with dJ20I3.1.1 (partial) ENST00000424447.1 alternative 5' UTR ENST00000218197.5 solute carrier family 25 (mitochondrial carrier, brain),member 14 (UCP5, BMCP1) ENST00000467496.1 solute carrier family 25 (mitochondrial carrier, brain),member 14 (UCP5, BMCP1) ENST00000361980.5 solute carrier family 25 (mitochondrial carrier, brain),member 14 (UCP5, BMCP1) ENST00000339231.3 solute carrier family 25 (mitochondrial carrier, brain),member 14 (UCP5, BMCP1) ENST00000478474.1 solute carrier family 25 (mitochondrial carrier, brain),member 14 (UCP5, BMCP1) ENST00000467346.1 solute carrier family 25 (mitochondrial carrier, brain),member 14 (UCP5, BMCP1) ENST00000471795.1 solute carrier family 25 (mitochondrial carrier, brain),member 14 (UCP5, BMCP1) ENST00000465988.1 solute carrier family 25 (mitochondrial carrier, brain),member 14 (UCP5, BMCP1) ENST00000305536.6 CGI-79 protein ENST00000469953.1 novel transcript ENST00000370947.1 CGI-79 protein ENST00000487274.1 novel transcript ENST00000458525.1 novel transcript ENST00000370935.1 cytosolic ovarian carcinoma antigen 1 ENST00000370927.1 cytosolic ovarian carcinoma antigen 1 ENST00000432489.1 cytosolic ovarian carcinoma antigen 1 ENST00000492263.1 cytosolic ovarian carcinoma antigen 1 ENST00000440178.1 novel pseudogene ENST00000412420.1 putative novel transcript ENST00000451431.1 putative novel transcript ENST00000412432.2 GenBank: AAH63790.1 ENST00000451582.1 unitary_pseudogene ENST00000370910.1 immunoglobulin superfamily member 1 ENST00000361420.3 immunoglobulin superfamily member 1 ENST00000370904.1 immunoglobulin superfamily member 1 ENST00000467244.1 immunoglobulin superfamily member 1 ENST00000469836.1 immunoglobulin superfamily member 1 ENST00000370901.4 immunoglobulin superfamily member 1 ENST00000370900.1 immunoglobulin superfamily member 1 ENST00000415818.1 olfactory receptor family pseudogene ENST00000415818.1 unitary_pseudogene ENST00000454101.1 olfactory receptor family pseudogene ENST00000454101.1 unitary_pseudogene ENST00000419597.1 unitary_pseudogene ENST00000419597.1 seven transmembrane helix receptor pseudogene ENST00000441066.1 pseudogene similar to part of seven transmembrane helix receptor ENST00000422384.1 pseudogene similar to part of PYRIN-containing Apaf1-like protein 3 (PYPAF3) ENST00000444577.1 seven transmembrane helix receptor pseudogene ENST00000456181.1 seven transmembrane helix receptor pseudogene ENST00000454899.1 seven transmembrane helix receptor pseudogene ENST00000427391.1 novel transcript, (LOC286467) ENST00000394346.2 novel pseudogene ENST00000435914.1 myofibrillogenesis regulator 1 (MR-1) (FKSG19) pseudogene ENST00000438615.1 pseudogene similar to part of SMT3 suppressor of mif two 3 (yeast) ENST00000481105.1 Genbank: BAG64601 ENST00000354719.6 Genbank: BAC11435 ENST00000394335.2 Genbank: BAC11406 ENST00000496850.1 NP_001035917.1 ENST00000370879.1 novel protein (LOC90167) ENST00000464296.1 Genbank:ACN56448 ENST00000513703.1 putative novel transcript ENST00000424708.1 novel pseudogene ENST00000342983.2 RAP2C (member of RAS oncogene family) ENST00000370874.1 alternatively splced 5' UTR, shares CDS with .1.1 ENST00000370874.1 RAP2C (member of RAS oncogene family) ENST00000370874.1 alternative 5' UTR ENST00000460462.1 RAP2C (member of RAS oncogene family) ENST00000490400.1 RAP2C (member of RAS oncogene family) ENST00000421483.1 putative novel transcript ENST00000441399.1 putative novel transcript ENST00000370857.3 muscleblind-like 3 (Drosophila) ENST00000370853.3 muscleblind-like 3 (Drosophila) ENST00000370849.3 muscleblind-like 3 (Drosophila) ENST00000370839.3 muscleblind-like 3 (Drosophila) ENST00000370844.1 muscleblind-like 3 (Drosophila) ENST00000442191.1 muscleblind-like 3 (Drosophila) ENST00000465964.1 muscleblind-like 3 (Drosophila) ENST00000436215.1 muscleblind-like 3 (Drosophila) ENST00000421707.1 muscleblind-like 3 (Drosophila) ENST00000473364.1 muscleblind-like 3 (Drosophila) ENST00000370837.1 heparan sulfate 6-O-sulfotransferase 2 ENST00000461959.1 alternative 3' UTR ENST00000461959.1 alternatively spliced 3' UTR, shares CDS with .1.1 ENST00000461959.1 heparan sulfate 6-O-sulfotransferase 2 ENST00000521489.1 NP_001070656 ENST00000455269.1 putative novel transcript ENST00000428456.1 N-acetyltransferase 5 (ARD1 homolog, S. cerevisiae) (NAT5) pseudogene ENST00000511190.1 alternative 5' UTR ENST00000444622.1 DEAD (Asp-Glu-Ala-Asp) box polypeptide 53 (DDX53) pseudogene ENST00000310125.4 novel E2F-like protein (LOC51270) ENST00000370828.3 glypican 4 ENST00000370818.3 glypican 3 ENST00000406757.2 glypican 3 ENST00000426577.1 ribosomal protein S24 (RPS24) pseudogene ENST00000412013.1 laminin receptor 1 (ribosomal protein SA, 67kDa) pseudogene ENST00000455649.1 novel pseudogene ENST00000445940.1 translocase of inner mitochondrial membrane 8 homolog B (yeast) (TIMM8B) pseudogene ENST00000437229.1 novel pseudogene ENST00000517294.1 not organism-supported ENST00000399325.2 novel pseudogene ENST00000370803.3 PHD finger protein 6 ENST00000332070.3 PHD finger protein 6 ENST00000370799.1 PHD finger protein 6 ENST00000370800.4 PHD finger protein 6 ENST00000298556.7 hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome) ENST00000462974.1 hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome) ENST00000475720.1 hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan syndrome) ENST00000438135.1 ribosomal protein L36a (RPL36A) pseudogene ENST00000441492.1 novel transcript ENST00000440570.1 novel transcript ENST00000457876.1 novel transcript ENST00000414769.1 novel transcript ENST00000445415.1 novel transcript ENST00000434384.1 putative novel transcript ENST00000359237.4 placenta-specific 1 ENST00000476971.1 placenta-specific 1 ENST00000473897.1 placenta-specific 1 ENST00000466797.1 placenta-specific 1 ENST00000440614.1 novel transcript ENST00000443666.1 ribosomal protein L21 (RPL21) pseudogene ENST00000422385.1 ribosomal protein S7 (RPS7) pseudogene ENST00000370790.1 novel protein (LOC169090) ENST00000478384.1 novel transcript ENST00000465128.1 novel transcript ENST00000493333.1 novel transcript ENST00000467413.1 novel transcript ENST00000495147.1 novel transcript ENST00000370785.3 novel protein (LOC159091) ENST00000482240.1 novel transcript ENST00000475361.1 novel transcript ENST00000494709.1 novel transcript ENST00000470657.1 novel transcript ENST00000460216.1 novel transcript ENST00000463842.1 novel transcript ENST00000370783.3 novel protein ENST00000491609.1 novel transcript ENST00000370779.4 novel transcript ENST00000480721.1 novel transcript ENST00000370777.1 novel transcript ENST00000489890.1 novel transcript ENST00000462060.1 novel transcript ENST00000441841.1 novel transcript ENST00000413333.1 high-mobility group protein pseudogene ENST00000416078.1 nucleolin (NCL) pseudogene ENST00000455568.1 novel transcript ENST00000433425.1 novel transcript ENST00000437661.1 novel transcript ENST00000453528.1 novel transcript ENST00000423661.1 novel transcript ENST00000426364.1 novel transcript ENST00000416873.1 putative novel transcript ENST00000454984.1 zinc finger family pseudogene ENST00000276241.6 novel protein ENST00000344129.2 novel protein (FLJ20527) ENST00000441416.1 novel pseudogene ENST00000445718.1 novel pseudogene ENST00000442950.1 zinc finger protein family pseudogene ENST00000494295.1 zinc finger protein 75 (D8C6) ENST00000370766.3 zinc finger protein 75 (D8C6) ENST00000370764.1 zinc finger protein 75 (D8C6) ENST00000469456.1 zinc finger protein 75 (D8C6) ENST00000427686.1 novel transcript ENST00000454551.1 novel transcript ENST00000370761.3 novel protein (FLJ23614) ENST00000339249.4 novel protein (DKFZp313N1820) ENST00000439434.1 novel transcript ENST00000417443.1 novel transcript ENST00000426910.1 novel pseudogene ENST00000430820.1 putative novel transcript ENST00000370752.4 novel protein (LOC203522) ENST00000481908.1 novel transcript, variant 2 (FLJ39225) ENST00000481908.1 novel protein ENST00000493637.1 novel transcript ENST00000494957.1 novel transcript ENST00000481429.1 novel transcript ENST00000439300.1 v-ets erythroblastosis virus E26 oncogene homolog 2 (avian) (ETS2) pseudogene ENST00000442271.1 sarcoma antigen (SAGE) pseudogene ENST00000420011.1 sarcoma antigen (SAGE) pseudogene ENST00000370741.3 alternatively spliced 5' UTR, shared CDS with .1.1 ENST00000370741.3 novel protein (LOC257122) ENST00000370741.3 alternative 5' UTR ENST00000497301.1 novel protein (LOC257122) ENST00000482795.1 novel transcript ENST00000471213.1 novel protein similar to MGC27005 ENST00000495729.1 alternative 5' UTR ENST00000485366.1 novel protein similar to MGC27005 ENST00000449718.1 pseudogene similar to part of mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase (MGAT2) ENST00000427194.1 pseudogene similar to part of mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase (MGAT2) ENST00000487941.1 novel protein (MGC27005) ENST00000494421.1 alternative 5' UTR ENST00000463085.1 novel protein similar to MGC27005 ENST00000491480.1 alternative 5' UTR ENST00000491002.1 novel protein similar to MGC27005 ENST00000472834.1 alternative 5' UTR ENST00000370709.3 sarcoma antigen (SAGE) ENST00000448043.1 novel pseudogene ENST00000370707.3 novel protein ENST00000370701.1 solute carrier family 9 (sodium/hydrogen exchanger), isoform 6 ENST00000370698.3 solute carrier family 9 (sodium/hydrogen exchanger), isoform 6 ENST00000370695.4 solute carrier family 9 (sodium/hydrogen exchanger), isoform 6 ENST00000422905.2 glyceraldehyde-3-phosphate dehydrogenase (GAPD) pseudogene (LOC139543) ENST00000468625.1 E2F transcription factor 6 (E2F6) pseudogene (LOC139542) ENST00000370690.3 four and a half LIM domains 1 ENST00000420362.1 four and a half LIM domains 1 ENST00000420362.1 alternative 5' UTR ENST00000420362.1 alternatively spliced in 5' UTR, shares partial CDS with bA535K18.1.1 ENST00000458357.1 four and a half LIM domains 1 ENST00000458357.1 alternative 5' UTR ENST00000458357.1 alternatively spliced in 5' UTR, shares partial CDS with bA535K18.1.1 ENST00000452016.1 four and a half LIM domains 1 ENST00000452016.1 alternative 5' UTR ENST00000452016.1 alternatively spliced in 5' UTR, shares partial CDS with bA535K18.1.1 ENST00000434885.1 four and a half LIM domains 1 ENST00000434885.1 alternative 5' UTR ENST00000434885.1 alternatively spliced in 5' UTR, shares partial CDS with bA535K18.1.1 ENST00000456445.1 four and a half LIM domains 1 ENST00000456445.1 alternative 5' UTR ENST00000456445.1 alternatively spliced in 5' UTR, shares partial CDS with bA535K18.1.1 ENST00000449474.1 four and a half LIM domains 1 ENST00000449474.1 alternative 5' UTR ENST00000449474.1 alternatively spliced in 5' UTR, shares partial CDS with bA535K18.1.1 ENST00000345434.3 four and a half LIM domains 1 ENST00000370683.1 four and a half LIM domains 1 ENST00000370676.3 four and a half LIM domains 1 ENST00000477204.1 four and a half LIM domains 1 ENST00000370674.1 four and a half LIM domains 1 ENST00000370674.1 alternative 5' UTR ENST00000370674.1 alternatively spliced in 5' UTR, shares partial CDS with bA535K18.1.1 ENST00000477080.1 four and a half LIM domains 1 ENST00000370661.1 DKFZp686B2110 ENST00000471510.1 novel transcript ENST00000495432.1 novel transcript ENST00000455035.1 serine/threonine kinase 24 (STE20 homolog, yeast) (STK24) pseudogene ENST00000370648.3 bombesin-like receptor 3 ENST00000448450.1 alternatively spliced in 5' UTR, shares partial CDS with dJ196E23.2.1 ENST00000448450.1 HIV TAT specific factor 1 (TAT-SF1) ENST00000448450.1 alternative 5' UTR ENST00000425695.1 alternatively spliced in 5' UTR, shares partial CDS with dJ196E23.2.1 ENST00000425695.1 HIV TAT specific factor 1 (TAT-SF1) ENST00000425695.1 alternative 5' UTR ENST00000218364.4 HIV TAT specific factor 1 (TAT-SF1) ENST00000370634.3 vestgial like 1 (Drosophila) (TDU, VGL1, TONDU) ENST00000440515.1 vestgial like 1 (Drosophila) (TDU, VGL1, TONDU) ENST00000456412.1 vestgial like 1 (Drosophila) (TDU, VGL1, TONDU) ENST00000470358.1 vestgial like 1 (Drosophila) (TDU, VGL1, TONDU) ENST00000370629.2 tumor necrosis factor (ligand) superfamily, member 5 (hyper-IgM syndrome) ENST00000370628.2 tumor necrosis factor (ligand) superfamily, member 5 (hyper-IgM syndrome) ENST00000250617.6 Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 ENST00000370622.1 Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 ENST00000370620.1 Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 ENST00000429441.1 ribosomal protein L7 (RPL7) pseudogene ENST00000413361.1 RAN, member RAS oncogene family pseudogene ENST00000435597.1 novel transcript ENST00000427490.1 RAB28, member RAS oncogene family pseudogene ENST00000496459.1 RNA binding motif protein, X chromosome ENST00000419968.1 RNA binding motif protein, X chromosome ENST00000464781.1 RNA binding motif protein, X chromosome ENST00000320676.7 RNA binding motif protein, X chromosome ENST00000424306.1 FLJ31132 ENST00000431464.1 novel protein ENST00000438602.1 novel protein ENST00000440604.1 novel transcript ENST00000426911.1 serine/arginine repetitive matrix 1 (SRRM1) pseudogene (LOC347480) ENST00000298110.1 G protein-coupled receptor 101 ENST00000442158.1 ribosomal protein L28 (RPL28) pseudogene ENST00000419413.1 ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) (RAC1) pseudogene (LOC286472) ENST00000456631.1 novel transcript ENST00000442841.1 novel transcript ENST00000287538.5 Zic family member 3 heterotaxy (odd-paired homolog, Drosophila) ENST00000370606.3 Zic family member 3 heterotaxy (odd-paired homolog, Drosophila) ENST00000478471.1 Zic family member 3 heterotaxy (odd-paired homolog, Drosophila) ENST00000416133.1 pseudogene similar to part of MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor (MADHIP) ENST00000418272.1 melanoma antigen, family A, 11 (MAGEA11) pseudogene ENST00000399259.2 tau tubulin kinase pseudogene ENST00000411940.1 novel transcript ENST00000315930.6 fibroblast growth factor 13 ENST00000305414.4 fibroblast growth factor 13 ENST00000436198.1 fibroblast growth factor 13 ENST00000455663.1 fibroblast growth factor 13 ENST00000448673.1 fibroblast growth factor 13 ENST00000421460.1 fibroblast growth factor 13 ENST00000438238.1 novel transcript ENST00000446383.1 novel transcript ENST00000433780.1 tropomyosin 2 (beta) (TPM2) pseudogene ENST00000309296.5 probable pseudogene ENST00000309296.5 novel protein similar to SNRPN upstream reading frame (SNURF) ENST00000442297.1 steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1) (SRD5A1) pseudogene ENST00000479617.1 F9: coagulation factor IX (plasma thromboplastic component, Christmas disease, hemophilia B) (FIX, PTC, HEMB) ENST00000218099.2 F9: coagulation factor IX (plasma thromboplastic component, Christmas disease, hemophilia B) (FIX, PTC, HEMB) ENST00000520602.1 NP_001093325 ENST00000437564.1 MCF.2 cell line derived transforming sequence (DBL) ENST00000370576.4 MCF.2 cell line derived transforming sequence (DBL) ENST00000446225.1 MCF.2 cell line derived transforming sequence (DBL) ENST00000519895.1 NP_001165347 ENST00000370573.4 MCF.2 cell line derived transforming sequence (DBL) ENST00000338585.6 MCF.2 cell line derived transforming sequence (DBL) ENST00000483690.1 MCF.2 cell line derived transforming sequence (DBL) ENST00000370557.1 ATPase, Class VI, type 11C (ATPIG, ATPIQ) ENST00000433868.1 ATPase, Class VI, type 11C (ATPIG, ATPIQ) ENST00000450801.1 ATPase, Class VI, type 11C (ATPIG, ATPIQ) ENST00000471746.1 ATPase, Class VI, type 11C (ATPIG, ATPIQ) ENST00000422228.1 ATPase, Class VI, type 11C (ATPIG, ATPIQ) ENST00000485626.1 ATPase, Class VI, type 11C (ATPIG, ATPIQ) ENST00000370540.1 novel protein ENST00000417426.1 putative novel transcript ENST00000416838.1 heterogeneous nuclear ribonucleoprotein A3 (HNRPA3) pseudogene ENST00000453380.1 novel pseudogene ENST00000458577.1 putative novel transcript ENST00000420490.1 embryonic ectoderm development (EED) pseudogene ENST00000419392.1 ribosomal protein S17 (RPS17) pseudogene ENST00000455153.1 novel transcript ENST00000370535.3 novel protein (FLJ30416)(LOC286411) ENST00000498732.1 novel transcript ENST00000413328.1 putative novel transcript ENST00000449283.1 SPANX family member B2 ENST00000370530.1 SPANX family member B1 ENST00000399253.3 ribosomal protein L36a (RPL36A) pseudogene ENST00000460721.1 leucine zipper down-regulated in cancer 1 ENST00000358993.2 SPANX family member C ENST00000257020.6 CGI-79 protein (CGI-79) pseudogene ENST00000425910.1 NADH dehydrogenase (ubiquinone) 1 beta subcomplex 3 12kDa pseudogene ENST00000421554.1 FLJ36186 ENST00000370519.3 NP_038481.2 ENST00000370518.3 NP_663695.1 ENST00000412163.1 putative novel transcript ENST00000370515.3 SPANX family, member D ENST00000298296.1 MAGE family testis and tumor-specific protein-like ENST00000483584.1 MAGE family testis and tumor-specific protein-like ENST00000285879.4 melanoma antigen, family C, 1 ENST00000370511.1 melanoma antigen, family C, 1 ENST00000412173.1 MAGE (Melanoma Associated Antigen) family pseudogene ENST00000423985.1 MAGE (Melanoma Associated Antigen) family pseudogene ENST00000503029.1 melanoma antigen, family E, 1, cancer/testis specific (MAGEE1) pseudogene ENST00000247452.3 melanoma antigen, family E, 1, cancer/testis specific ENST00000446864.1 NP_001009613 ENST00000370504.3 LOC441525 ENST00000431432.1 novel transcript ENST00000421501.1 piggyBac transposable element derived 4 (PGBD4) pseudogene ENST00000446251.1 NADH dehydrogenase 1 (MTND1) pseudogene ENST00000457230.1 NADH dehydrogenase 2 (MTND2) pseudogene ENST00000370503.2 LOC139067 ENST00000453484.1 novel pseudogene ENST00000356928.1 novel protein (DKFZp547M2010) ENST00000338017.4 alternatively spliced 5' UTR, shares CDS with .2.1 ENST00000338017.4 novel protein (DKFZp547M2010) ENST00000338017.4 alternative 5' UTR ENST00000396845.2 heterogeneous nuclear ribonucleoprotein H pseudogene ENST00000423667.1 putative novel transcript ENST00000448562.1 pseudogene similar to part of ribosomal protein S7 (RPS7) ENST00000436312.1 pseudogene similar to part of ribonucleotide reductase M2 polypeptide (RRM2) ENST00000441721.1 pseudogene similar to part of ribonucleotide reductase M2 polypeptide (RRM2) ENST00000457130.1 heterogeneous nuclear ribonucleoprotein C (C1/C2) (HNRPC) pseudogene ENST00000448560.1 cytochrome c (CYCS) pseudogene ENST00000414071.1 putative novel transcript ENST00000443260.1 novel pseudogene ENST00000335565.4 novel protein (FLJ38959) ENST00000370490.1 novel protein (KIAA1854) ENST00000421173.1 ADP-ribosylation factor-like 5 (ARL5) pseudogene ENST00000446870.1 ELL gene (11-19 lysine-rich leukemia gene) (ELL) pseudogene ENST00000445173.1 novel pseudogene ENST00000438525.2 putative novel transcript ENST00000458472.1 putative novel transcript ENST00000421282.1 pseudogene similar to part of a putative dimethyladenosine transferase (HSA9761) ENST00000450437.1 SMT3 suppressor of mif two 3 homolog 1 (yeast) (SMT3H1) pseudogene ENST00000458303.1 novel pseudogene ENST00000456072.1 putative novel transcript ENST00000370477.1 fragile X mental retardation 1 ENST00000370475.4 fragile X mental retardation 1 ENST00000334557.6 fragile X mental retardation 1 ENST00000439526.2 fragile X mental retardation 1 ENST00000495717.1 fragile X mental retardation 1 ENST00000370470.1 fragile X mental retardation 1 ENST00000475038.1 fragile X mental retardation 1 ENST00000492846.1 fragile X mental retardation 1 ENST00000463120.1 fragile X mental retardation 1 ENST00000478848.1 fragile X mental retardation 1 ENST00000370467.3 novel protein (FLJ25736) ENST00000489034.1 novel protein ENST00000498161.1 ferritin heavy polypeptide 1 (FTH1) pseudogene ENST00000411473.1 HS1 binding protein (HAX1) pseudogene ENST00000446092.1 ribosomal protein L7 (RPL7) pseudogene ENST00000456981.1 novel transcript ENST00000370460.2 fragile X mental retardation 2 ENST00000342251.3 fragile X mental retardation 2 ENST00000370458.1 fragile X mental retardation 2 ENST00000435346.1 novel transcript ENST00000498002.1 pseudogene similar to part of taxol resistance associated gene 3 (TRAG3) ENST00000466323.1 iduronate 2-sulfatase (Hunter syndrome) (MPS2, SIDS) ENST00000490775.1 iduronate 2-sulfatase (Hunter syndrome) (MPS2, SIDS) ENST00000466019.1 iduronate 2-sulfatase (Hunter syndrome) (MPS2, SIDS) ENST00000428056.2 iduronate 2-sulfatase (Hunter syndrome) (MPS2, SIDS) ENST00000521702.1 alternative 5' UTR ENST00000441880.1 novel transcript ENST00000422081.1 novel transcript ENST00000412882.1 novel transcript ENST00000437981.1 novel transcript ENST00000431025.1 novel transcript ENST00000370438.2 novel transcript ENST00000324799.4 iduronate 2-sulfatase pseudogene 1 ENST00000430173.1 novel transcript ENST00000451969.1 novel transcript ENST00000447209.1 novel transcript ENST00000431214.1 novel transcript ENST00000436708.1 novel transcript ENST00000431132.2 alternative 5' UTR ENST00000450602.2 alternative 5' UTR ENST00000393985.3 alternative 5' UTR ENST00000423421.1 alternative 5' UTR ENST00000423540.2 alternative 5' UTR ENST00000514208.1 alternative 5' UTR ENST00000422892.2 alternative 5' UTR ENST00000359293.5 alternative 5' UTR ENST00000431993.1 putative novel transcript ENST00000513505.2 novel transcript ENST00000502858.2 novel transcript ENST00000507237.1 novel transcript ENST00000502900.1 novel transcript ENST00000511776.1 novel transcript ENST00000439010.2 alternative 5' UTR ENST00000298974.5 NP_005356 ENST00000522429.1 alternative 5' UTR ENST00000519822.1 alternative 5' UTR ENST00000523516.1 alternative 5' UTR ENST00000436482.1 melanoma antigen pseudogene ENST00000424782.1 dUTP pyrophosphatase (DUT) pseudogene ENST00000427671.1 putative novel transcript ENST00000286482.1 melanoma antigen, family A, 8 ENST00000345830.3 melanoma antigen, family A, 8 ENST00000493910.1 melanoma antigen, family A, 8 ENST00000370406.3 LOC91966 ENST00000355203.2 alternative 5' UTR; shares CDS with XX-FW81066F1.1-001 and XX-FW81066F1.1-006 ENST00000355203.2 alternative 5' UTR ENST00000370404.1 alternative 5' UTR; shares CDS with XX-FW81066F1.1-001 and XX-FW81066F1.1-002 ENST00000370404.1 alternative 5' UTR ENST00000449111.1 novel transcript ENST00000444489.1 novel transcript ENST00000455777.1 novel transcript ENST00000413076.1 novel transcript ENST00000332359.5 novel pseudogene ENST00000457831.1 thyroid autoantigen 70kDa (Ku antigen) (G22P1) pseudogene ENST00000358892.3 alternative 5' UTR ENST00000370396.2 myotubular myopathy 1 ENST00000424519.1 myotubular myopathy 1 ENST00000370393.1 myotubular myopathy 1 ENST00000306167.7 myotubular myopathy 1 ENST00000490530.1 myotubular myopathy 1 ENST00000493995.2 alternative 5' UTR ENST00000429965.2 alternative 5' UTR ENST00000434699.2 alternative 5' UTR ENST00000438018.1 not organism-supported ENST00000436701.1 not organism-supported ENST00000488357.1 myotubularin related protein 1 ENST00000370377.3 CD99 antigen-like 2 ENST00000346693.4 CD99 antigen-like 2 ENST00000418547.1 CD99 antigen-like 2 ENST00000491877.1 CD99 antigen-like 2 ENST00000430535.1 peptidylprolyl isomerase A (cyclophilin A)(PPIA) pseudogene ENST00000437772.1 novel transcript ENST00000424539.1 novel transcript ENST00000419110.1 high-mobility group box 3 ENST00000419110.1 alternative 5' UTR ENST00000419110.1 alternatively spliced 5' UTR; shares CDS with Em:AF003626.2.1, Em:AF003626.2.3 and Em:AF003626.2.4 ENST00000325307.7 alternatively spliced 5' UTR; shares CDS with Em:AF003626.2.2, Em:AF003626.2.3 and Em:AF003626.2.4 ENST00000325307.7 high-mobility group box 3 ENST00000325307.7 alternative 5' UTR ENST00000455596.1 alternatively spliced 5' UTR; shares CDS with Em:AF003626.2.1, Em:AF003626.2.2 and Em:AF003626.2.4 ENST00000455596.1 high-mobility group box 3 ENST00000455596.1 alternative 5' UTR ENST00000430118.1 high-mobility group box 3 ENST00000430118.1 alternative 5' UTR ENST00000430118.1 alternatively spliced 5' UTR; shares CDS with Em:AF003626.2.1, Em:AF003626.2.2 and Em:AF003626.2.3 ENST00000442676.1 pseudogene similar to part of ribosomal protein L12 (RPL12) ENST00000454196.1 novel transcript ENST00000218316.3 G protein-coupled receptor 50 ENST00000458074.1 NGFI-A binding protein 1 (EGR1 binding protein 1) (NAB1) pseudogene ENST00000477649.1 novel transcript ENST00000370361.1 novel protein (FLJ39516)(LOC203547) ENST00000330374.6 novel protein (FLJ39516)(LOC203547) ENST00000448726.1 transmembrane gamma-carboxyglutamic acid protein 3 (TMG3) ENST00000370354.1 transmembrane gamma-carboxyglutamic acid protein 3 (TMG3) ENST00000370353.3 transmembrane gamma-carboxyglutamic acid protein 3 (TMG3) ENST00000448324.1 transmembrane gamma-carboxyglutamic acid protein 3 (TMG3) ENST00000370350.3 fetal and adult testis expressed (FATE) ENST00000417321.1 fetal and adult testis expressed (FATE) ENST00000329903.4 cyclic nucleotide gated channel alpha 2 ENST00000411474.1 putative novel transcript ENST00000445330.1 putative novel transcript ENST00000424126.1 putative novel transcript ENST00000431963.1 melanoma antigen, family A, 4 ENST00000448295.1 melanoma antigen, family A, 4 ENST00000430273.1 melanoma antigen, family A, 4 ENST00000441865.1 melanoma antigen, family A, 4 ENST00000370340.3 melanoma antigen, family A, 4 ENST00000416020.1 melanoma antigen, family A, 4 ENST00000425182.1 melanoma antigen, family A, 4 ENST00000457310.1 melanoma antigen, family A, 4 ENST00000370335.1 melanoma antigen, family A, 4 ENST00000360243.2 melanoma antigen, family A, 4 ENST00000431971.1 melanoma antigen, family A, 4 ENST00000370328.3 gamma-aminobutyric acid (GABA) A receptor, epsilon ENST00000370325.1 gamma-aminobutyric acid (GABA) A receptor, epsilon ENST00000486255.1 gamma-aminobutyric acid (GABA) A receptor, epsilon ENST00000483564.1 gamma-aminobutyric acid (GABA) A receptor, epsilon ENST00000462018.1 gamma-aminobutyric acid (GABA) A receptor, epsilon ENST00000441219.1 gamma-aminobutyric acid (GABA) A receptor, epsilon ENST00000425556.1 gamma-aminobutyric acid (GABA) A receptor, epsilon ENST00000474932.1 gamma-aminobutyric acid (GABA) A receptor, epsilon ENST00000465405.1 gamma-aminobutyric acid (GABA) A receptor, epsilon ENST00000415403.1 laminin receptor 1 (ribosomal protein SA, 67kDa) (LAMR1) pseudogene ENST00000446757.1 melanoma antigen, family A pseudogene ENST00000370323.3 melanoma antigen, family A, 10 ENST00000370323.3 alternatively spliced 5' UTR, shares CDS with Em116666.2.2 and Em:AC116666.2.3 ENST00000370323.3 alternative 5' UTR ENST00000444834.1 melanoma antigen, family A, 10 ENST00000427322.1 melanoma antigen, family A, 10 ENST00000427322.1 alternative 5' UTR ENST00000427322.1 alternatively spliced 5' UTR, shares CDS with Em116666.2.1 and Em:AC116666.2.3 ENST00000453915.1 putative novel transcript ENST00000370314.4 gamma-aminobutyric acid (GABA) A receptor, alpha 3 ENST00000370311.1 gamma-aminobutyric acid (GABA) A receptor, alpha 3 ENST00000497894.1 gamma-aminobutyric acid (GABA) A receptor, alpha 3 ENST00000417858.1 gamma-aminobutyric acid (GABA) A receptor, alpha 3 ENST00000434750.1 keratin 8 (KT8) pseudogene ENST00000370306.2 gamma-aminobutyric acid (GABA) receptor, theta ENST00000435583.1 melanoma antigen, family A pseudogene ENST00000412733.1 alternative 5' UTR ENST00000457643.1 alternative 5' UTR ENST00000423993.1 alternative 5' UTR ENST00000447530.1 alternative 5' UTR ENST00000458057.1 alternative 5' UTR ENST00000422085.1 alternative 5' UTR ENST00000453150.1 alternative 5' UTR ENST00000409560.1 alternative 5' UTR ENST00000437309.1 putative novel transcript ENST00000357916.4 melanoma antigen, family A, 12 ENST00000370284.1 melanoma antigen, family A, 2 ENST00000480629.1 melanoma antigen, family A, 2 ENST00000479268.1 melanoma antigen, family A, 2 ENST00000469970.1 melanoma antigen, family A, 2 ENST00000370278.3 alternative 5' UTR; shares CDS with Em:AF002997.12.2 ENST00000370278.3 melanoma antigen, family A, 3 ENST00000370278.3 alternative 5' UTR ENST00000417212.1 alternative 5' UTR; shares CDS with Em:AF002997.12.1 ENST00000417212.1 melanoma antigen, family A, 3 ENST00000417212.1 alternative 5' UTR ENST00000431382.1 pseudogene similar to melanoma antigen family protein ENST00000370277.3 centrin, EF-hand protein, 2 ENST00000493482.1 centrin, EF-hand protein, 2 ENST00000370274.3 NAD(P)-dependent steroid dehydrogenase-like (H105E3) ENST00000432467.1 NAD(P)-dependent steroid dehydrogenase-like (H105E3) ENST00000370268.4 NP_009081 ENST00000370270.1 Zinc finger protein 185 (LIM-domain protein ZNF185) (P1-A) ENST00000426821.1 Zinc finger protein 185 (LIM-domain protein ZNF185) (P1-A) ENST00000447088.1 Zinc finger protein 185 (LIM-domain protein ZNF185) (P1-A) ENST00000447792.1 Zinc finger protein 185 (LIM-domain protein ZNF185) (P1-A) ENST00000436731.1 Zinc finger protein 185 (LIM-domain protein ZNF185) (P1-A) ENST00000454925.1 Zinc finger protein 185 (LIM-domain protein ZNF185) (P1-A) ENST00000361887.5 paraneoplastic antigen like 5 ENST00000437210.1 paraneoplastic antigen like 5 ENST00000452967.1 paraneoplastic antigen pseudogene ENST00000421099.1 high-mobility group nucleosomal binding domain 2 (HMGN2) pseudogene ENST00000453825.2 novel protein (MGC15827) ENST00000370261.1 novel protein ENST00000370261.1 CDS identical to Em:U82670.2 ENST00000420160.1 novel transcript ENST00000420988.1 novel transcript ENST00000356661.5 melanoma antigen, family A, 1 (directs expression of antigen MZ2-E) ENST00000370251.2 confirm experimentally ENST00000370251.2 NP_001073954 ENST00000445091.1 novel pseudogene ENST00000411617.1 zink finger protein pseudogene, partial ENST00000330912.2 three prime repair exonuclease 2 ENST00000330912.2 alternative 5' UTR ENST00000330912.2 alternatively spliced 5'UTR; shares CDS with Em:U82695.1.4 ENST00000338525.2 alternatively spliced 5'UTR; shares CDS with Em:U82695.1.1 ENST00000338525.2 three prime repair exonuclease 2 ENST00000338525.2 alternative 5' UTR ENST00000334497.2 three prime repair exonuclease 2 ENST00000334497.2 alternatively spliced 5'UTR; shares CDS with Em:U82695.1.6 ENST00000334497.2 alternative 5' UTR ENST00000370232.1 alternatively spliced 5'UTR; shares CDS with Em:U82695.1.5 ENST00000370232.1 three prime repair exonuclease 2 ENST00000370232.1 alternative 5' UTR ENST00000474022.1 three prime repair exonuclease 2 ENST00000460898.1 three prime repair exonuclease 2 ENST00000484394.1 three prime repair exonuclease 2 ENST00000477380.1 three prime repair exonuclease 2 ENST00000437046.2 three prime repair exonuclease 2 ENST00000491286.1 three prime repair exonuclease 2 ENST00000490165.1 three prime repair exonuclease 2 ENST00000472228.1 three prime repair exonuclease 2 ENST00000490453.1 three prime repair exonuclease 2 ENST00000464993.1 three prime repair exonuclease 2 ENST00000492596.1 three prime repair exonuclease 2 ENST00000331595.4 biglycan ENST00000472615.1 biglycan ENST00000480756.1 biglycan ENST00000431891.1 biglycan ENST00000370204.1 biglycan ENST00000492658.1 biglycan ENST00000349466.2 ATPase, Ca++ transporting, plasma membrane 3 ENST00000370186.1 ATPase, Ca++ transporting, plasma membrane 3 ENST00000393842.1 ATPase, Ca++ transporting, plasma membrane 3 ENST00000393842.1 novel transcript ENST00000460549.1 ATPase, Ca++ transporting, plasma membrane 3 ENST00000496610.1 novel transcript ENST00000370175.4 MGC29729 ENST00000370173.3 MGC29729 ENST00000370171.1 MGC29729 ENST00000276345.7 MGC29729 ENST00000429336.1 MGC29729 ENST00000440428.1 MGC29729 ENST00000428722.1 MGC29729 ENST00000434763.1 keratin 18 (KRT18) pseudogene ENST00000406288.2 T-cell activation protein (PGR1) pseudogene ENST00000446370.1 putative novel transcript ENST00000342782.3 alternative 5' UTR; shares CDS with U52111.9-001 ENST00000342782.3 alternative 5' UTR ENST00000370150.1 alternative 5' UTR ENST00000447676.2 NP_001034671.2 ENST00000439087.1 alternative 5' UTR ENST00000419804.1 alternative 5' UTR ENST00000458354.1 alternative 5' UTR ENST00000434652.1 alternative 5' UTR ENST00000425526.1 alternative 5' UTR ENST00000423545.1 alternative 5' UTR ENST00000253122.5 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 ENST00000476466.1 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 ENST00000430077.2 NP_001136278 ENST00000466243.1 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 ENST00000467402.1 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 ENST00000429147.1 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 ENST00000485324.1 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 ENST00000413787.1 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 ENST00000442457.1 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 ENST00000457723.1 solute carrier family 6 (neurotransmitter transporter, creatine), member 8 ENST00000345046.6 accessory protein BAP31 (BCAP31) ENST00000477175.1 novel transcript ENST00000458587.2 NP_001132929 ENST00000442093.1 accessory protein BAP31 (BCAP31) ENST00000429550.1 accessory protein BAP31 (BCAP31) ENST00000416815.1 alternative 5' UTR ENST00000416815.1 accessory protein BAP31 (BCAP31) ENST00000423827.1 accessory protein BAP31 (BCAP31) ENST00000430088.1 accessory protein BAP31 (BCAP31) ENST00000468947.1 novel transcript ENST00000218104.3 ATP-binding cassette, sub-family D (ALD), member 1 ENST00000370129.3 ATP-binding cassette, sub-family D (ALD), member 1 ENST00000443684.1 ATP-binding cassette, sub-family D (ALD), member 1 ENST00000434284.1 novel transcript ENST00000416854.1 novel transcript ENST00000361971.5 Plexin B3 ENST00000411613.1 Plexin B3 ENST00000482654.1 Plexin B3 ENST00000455214.1 Plexin B3 ENST00000485980.1 Plexin B3 ENST00000448847.1 Plexin B3 ENST00000469190.1 Plexin B3 ENST00000472415.1 Plexin B3 ENST00000370104.1 serine/threonine kinase 23 ENST00000370108.3 serine/threonine kinase 23 ENST00000370101.3 NP_055185 ENST00000430541.1 serine/threonine kinase 23 ENST00000370100.1 serine/threonine kinase 23 ENST00000458681.1 serine/threonine kinase 23 ENST00000424541.1 isocitrate dehydrogenase 3 (NAD+) gamma ENST00000490525.1 isocitrate dehydrogenase 3 (NAD+) gamma ENST00000427365.2 isocitrate dehydrogenase 3 (NAD+) gamma ENST00000479521.1 isocitrate dehydrogenase 3 (NAD+) gamma ENST00000444338.1 isocitrate dehydrogenase 3 (NAD+) gamma ENST00000320857.3 signal sequence receptor, delta (translocon-associated protein delta) ENST00000491833.1 signal sequence receptor, delta (translocon-associated protein delta) ENST00000370087.1 signal sequence receptor, delta (translocon-associated protein delta) ENST00000482902.1 signal sequence receptor, delta (translocon-associated protein delta) ENST00000370086.3 signal sequence receptor, delta (translocon-associated protein delta) ENST00000460616.1 signal sequence receptor, delta (translocon-associated protein delta) ENST00000370085.3 signal sequence receptor, delta (translocon-associated protein delta) ENST00000471724.1 signal sequence receptor, delta (translocon-associated protein delta) ENST00000471880.1 signal sequence receptor, delta (translocon-associated protein delta) ENST00000489777.1 signal sequence receptor, delta (translocon-associated protein delta) ENST00000486204.1 signal sequence receptor, delta (translocon-associated protein delta) ENST00000485612.1 signal sequence receptor, delta (translocon-associated protein delta) ENST00000447375.1 signal sequence receptor, delta (translocon-associated protein delta) ENST00000484792.1 novel transcript ENST00000475140.1 novel transcript ENST00000483693.1 novel transcript ENST00000480418.1 novel transcript ENST00000468491.1 novel transcript ENST00000480650.1 novel transcript ENST00000370060.1 L1 cell adhesion molecule (hydrocephalus, stenosis of aqueduct of Sylvius 1, MASA (mental retardation, aphasia, shuffling gait and adducted thumbs) syndrome, spastic paraplegia 1) ENST00000370058.3 L1 cell adhesion molecule (hydrocephalus, stenosis of aqueduct of Sylvius 1, MASA (mental retardation, aphasia, shuffling gait and adducted thumbs) syndrome, spastic paraplegia 1) ENST00000361699.4 L1 cell adhesion molecule (hydrocephalus, stenosis of aqueduct of Sylvius 1, MASA (mental retardation, aphasia, shuffling gait and adducted thumbs) syndrome, spastic paraplegia 1) ENST00000458029.1 alternative 5' UTR ENST00000484587.1 novel transcript ENST00000430697.1 GENCODE experimental pipeline ENST00000393721.1 GENCODE experimental pipeline ENST00000370028.3 Rho GTPase activating protein 4 ENST00000420383.1 Rho GTPase activating protein 4 ENST00000350060.5 Rho GTPase activating protein 4 ENST00000466928.1 Rho GTPase activating protein 4 ENST00000454164.1 Rho GTPase activating protein 4 ENST00000467421.1 Rho GTPase activating protein 4 ENST00000442172.1 Rho GTPase activating protein 4 ENST00000461739.1 Rho GTPase activating protein 4 ENST00000488269.1 Rho GTPase activating protein 4 ENST00000482485.1 ARD1 homolog, N-acetyltransferase (S. cerevisiae) ENST00000370015.4 GENCODE experimental pipeline ENST00000393712.3 GENCODE experimental pipeline ENST00000488481.1 ARD1 homolog, N-acetyltransferase (S. cerevisiae) ENST00000393700.3 NP_002901 ENST00000369984.4 host cell factor C1 (VP16-accessory protein) ENST00000461098.1 host cell factor C1 (VP16-accessory protein) ENST00000438219.1 putative novel transcript ENST00000431598.1 alternative 5' UTR ENST00000369980.3 interleukin-1 receptor-associated kinase 1 ENST00000369974.2 interleukin-1 receptor-associated kinase 1 ENST00000369973.3 interleukin-1 receptor-associated kinase 1 ENST00000444254.1 interleukin-1 receptor-associated kinase 1 ENST00000437278.1 interleukin-1 receptor-associated kinase 1 ENST00000393687.2 interleukin-1 receptor-associated kinase 1 ENST00000443220.1 interleukin-1 receptor-associated kinase 1 ENST00000467236.1 interleukin-1 receptor-associated kinase 1 ENST00000369951.4 upstream_ATG-15 ENST00000369935.5 opsin 1 (cone pigments), medium-wave-sensitive (color blindness, deutan) (CBD, DCB, GCP, CBBM) ENST00000369929.4 novel protein similar to opsin 1 (cone pigments), medium-wave-sensitive (color blindness, deutan) ENST00000430419.1 GENCODE experimental pipeline ENST00000420627.1 GENCODE experimental pipeline ENST00000369850.3 filamin A, alpha (actin binding protein 280) ENST00000490936.1 filamin A, alpha (actin binding protein 280) ENST00000498491.1 filamin A, alpha (actin binding protein 280) ENST00000462590.1 filamin A, alpha (actin binding protein 280) ENST00000474358.1 filamin A, alpha (actin binding protein 280) ENST00000415241.1 GENCODE experimental pipeline ENST00000474072.1 filamin A, alpha (actin binding protein 280) ENST00000466319.1 filamin A, alpha (actin binding protein 280) ENST00000486738.1 novel transcript ENST00000494443.1 novel transcript ENST00000471965.1 novel transcript ENST00000436473.1 alternative 5' UTR ENST00000014935.3 alternative 5' UTR ENST00000369808.3 alternative 5' UTR ENST00000369807.1 alternative 5' UTR ENST00000447892.1 GENCODE experimental pipeline ENST00000451865.1 alternative 5' UTR ENST00000412184.1 GENCODE experimental pipeline ENST00000424626.1 alternative 5' UTR ENST00000432135.1 alternative 5' UTR ENST00000488225.1 contains a non-canonical splice site ENST00000439735.1 GENCODE experimental pipeline ENST00000449556.1 GENCODE experimental pipeline ENST00000491569.1 FLJ33764 ENST00000393600.3 XAP5 ENST00000421431.1 GENCODE experimental pipeline ENST00000453912.1 XX-FW89031B12.2-002 ENST00000322269.6 novel transcript ENST00000369643.1 XX-FW89031B12.3-004 ENST00000447601.2 XX-FW89031B12.3-003 ENST00000469041.1 novel transcript ENST00000419205.1 novel transcript ENST00000475657.1 putative novel transcript ENST00000449971.1 novel transcript ENST00000416319.1 novel transcript ENST00000412894.1 novel transcript ENST00000470142.1 GENCODE experimental pipeline ENST00000393549.2 GENCODE experimental pipeline ENST00000424839.1 GENCODE experimental pipeline ENST00000429373.1 activating transcription factor 4 pseudogene (tax-responsive enhancer element B67 pseudogene) ENST00000333128.3 Manolis Kellis' Group at MIT evaluated this CDS as dubious on the basis of low cross-species conservation in studies done as part of the Biosapiens/ENCODE project ENST00000359887.4 identical to CTAG1A ENST00000369568.4 GRB2-associated binding protein 3 ENST00000424127.2 NP_001075042 ENST00000452771.1 GENCODE experimental pipeline ENST00000419615.1 No evidence visible on Fmap - pseudogene identified by Yale and UCSC as part of the ENCODE project - annotated by dottering evidence directly ENST00000369476.3 mature T-cell proliferation 1 ENST00000330045.7 AT-AC splice site ENST00000369462.1 AT-AC splice site between exons 4 and 5 ENST00000399026.1 AT-AC splice site ENST00000286428.5 von Hippel-Lindau binding protein 1 ENST00000460509.1 von Hippel-Lindau binding protein 1 ENST00000459836.1 von Hippel-Lindau binding protein 1 ENST00000415016.1 pseudogene similar to part of CD84 antigen (leukocyte antigen) (CD84) ENST00000369454.3 RAB39B, member RAS oncogene family ENST00000369449.2 chloride intracellular channel 2 ENST00000465553.1 chloride intracellular channel 2 ENST00000491205.1 chloride intracellular channel 2 ENST00000426370.1 PTK9 protein tyrosine kinase 9 pseudogene (PTK9) ENST00000452540.1 PHD finger protein pseudogene ENST00000419384.1 pseudogene similar to part of steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2) (SRD5A2) ENST00000412436.1 novel transcript ENST00000444722.1 novel transcript ENST00000453508.1 novel transcript ENST00000452506.1 novel transcript ENST00000433624.1 novel transcript ENST00000447347.1 putative novel transcript ENST00000334398.3 trimethyllysine hydroxylase, epsilon ENST00000449645.2 trimethyllysine hydroxylase, epsilon (TMLHE) ENST00000369439.4 trimethyllysine hydroxylase, epsilon ENST00000487422.1 trimethyllysine hydroxylase, epsilon ENST00000474677.1 trimethyllysine hydroxylase, epsilon ENST00000461075.1 trimethyllysine hydroxylase, epsilon ENST00000302805.2 sprouty homolog 3 (Drosophila) ENST00000412936.1 adenosylmethionine decarboxylase 1 (AMD1) pseudogene ENST00000422618.1 novel pseudogene ENST00000286448.6 synaptobrevin-like 1 ENST00000479687.1 synaptobrevin-like 1 ENST00000488344.1 synaptobrevin-like 1 ENST00000463317.1 synaptobrevin-like 1 ENST00000262640.6 synaptobrevin-like 1 ENST00000460621.1 NP_001138621 ENST00000460621.1 synaptobrevin-like 1 ENST00000421233.1 pseudogene similar to part of transient receptor potential cation channel, subfamily C, member 6 (TRPC6) ENST00000489233.1 interleukin 9 receptor ENST00000483543.1 interleukin 9 receptor ENST00000494962.1 interleukin 9 receptor ENST00000244174.5 interleukin 9 receptor ENST00000369423.2 interleukin 9 receptor ENST00000399966.4 not best-in-genome evidence ENST00000469624.1 novel transcript ENST00000479401.1 novel transcript ENST00000340131.7 novel transcript ENST00000492963.1 novel transcript ENST00000460206.1 novel transcript ENST00000475594.1 novel transcript ENST00000482170.1 novel transcript ENST00000484415.1 novel transcript ENST00000483079.1 novel transcript ENST00000496301.1 novel transcript ENST00000483286.1 novel transcript ENST00000464205.1 novel transcript ENST00000359512.2 novel protein ENST00000476066.1 novel transcript ENST00000461007.1 novel transcript ENST00000496011.1 novel transcript ENST00000507418.1 pseudogene similar to part of a CHL1 helicase ENSTR0000399012.1 FLJ11323 ENSTR0000430923.2 alternative 5' UTR ENSTR0000445062.1 alternative 5' UTR ENSTR0000381657.2 alternative 5' UTR ENSTR0000429181.1 alternative 5' UTR ENSTR0000443019.1 alternative 5' UTR ENSTR0000415337.1 alternative 5' UTR ENSTR0000447472.1 alternative 5' UTR ENSTR0000448477.1 alternative 5' UTR ENSTR0000485332.1 novel transcript ENSTR0000400701.3 pseudoautosomal GTP-binding protein-like (PGPL) ENSTR0000452144.1 fatty acid binding protein 5 (psoriasis-associated) (FABP5) pseudogene ENSTR0000431919.1 pseudogene similar to part of keratin 18 (KRT18) ENSTR0000436474.1 ribosomal protein L14 (RPL14) pseudogene ENSTR0000381529.3 colony stimulating factor 2 receptor alpha chain isoform a precursor ENSTR0000381524.3 colony stimulating factor 2 receptor alpha chain isoform a precursor ENSTR0000355805.2 colony stimulating factor 2 receptor alpha chain isoform e precursor ENSTR0000486791.1 colony stimulating factor 2 receptor alpha chain isoform d precursor ENSTR0000355432.3 colony stimulating factor 2 receptor alpha chain isoform b precursor ENSTR0000381500.1 colony stimulating factor 2 receptor alpha chain isoform c precursor ENSTR0000331035.4 interleukin 3 receptor, alpha (low affinity) (IL3R, CD123, IL3RX, IL3RY, IL3RAY, hIL-3Ra, MGC34174) ENSTR0000432757.1 interleukin 3 receptor, alpha (low affinity) (IL3R, CD123, IL3RX, IL3RY, IL3RAY, hIL-3Ra, MGC34174) ENSTR0000381401.5 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (ANT3, ANT3Y, MGC17525) ENSTR0000475167.1 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (ANT3, ANT3Y, MGC17525) ENSTR0000484026.1 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (ANT3, ANT3Y, MGC17525) ENSTR0000447786.1 alternatively spliced 5' UTR, shares CDS with bA261P4.2.1 (partial) ENSTR0000447786.1 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (ANT3, ANT3Y, MGC17525) ENSTR0000447786.1 alternative 5' UTR ENSTR0000430235.1 putative novel transcript ENSTR0000419737.1 novel protein (FLJ13330) ENSTR0000381333.4 acetylserotonin O-methyltransferase-like (ASTML, ASMTLX) ENSTR0000381317.3 acetylserotonin O-methyltransferase-like (ASTML, ASMTLX) ENSTR0000463763.1 acetylserotonin O-methyltransferase-like (ASTML, ASMTLX) ENSTR0000462195.1 acetylserotonin O-methyltransferase-like (ASTML, ASMTLX) ENSTR0000474865.1 acetylserotonin O-methyltransferase-like (ASTML, ASMTLX) ENSTR0000381297.4 novel protein (LOC286530) ENSTR0000460672.1 novel transcript ENSTR0000381241.3 acetylserotonin O-methyltransferase (ASMTY, HIOMT, HIOMTY) ENSTR0000381229.4 acetylserotonin O-methyltransferase (ASMTY, HIOMT, HIOMTY) ENSTR0000381233.3 acetylserotonin O-methyltransferase (ASMTY, HIOMT, HIOMTY) ENSTR0000432523.1 acetylserotonin O-methyltransferase (ASMTY, HIOMT, HIOMTY) ENSTR0000509780.1 putative novel transcript ENSTR0000427886.1 putative novel transcript ENSTR0000432272.1 putative novel transcript ENSTR0000453953.1 putative novel transcript ENSTR0000381222.2 Ac-like transposable element ENSTR0000381218.3 alternative 5' UTR ENSTR0000461691.1 alternative 5' UTR ENSTR0000430562.1 novel transcript ENSTR0000414513.2 novel transcript ENSTR0000445785.1 novel transcript ENSTR0000381192.3 CD99 antigen ENSTR0000381187.3 CD99 antigen ENSTR0000381184.1 CD99 antigen ENSTR0000381180.3 CD99 antigen ENSTR0000449611.1 CD99 antigen ENSTR0000482293.1 CD99 antigen ENSTR0000497752.1 CD99 antigen ENSTR0000381177.1 CD99 antigen ENSTR0000302805.2 sprouty homolog 3 (Drosophila) ENSTR0000412936.1 adenosylmethionine decarboxylase 1 (AMD1) pseudogene ENSTR0000422618.1 novel pseudogene ENSTR0000286448.6 synaptobrevin-like 1 ENSTR0000479687.1 synaptobrevin-like 1 ENSTR0000488344.1 synaptobrevin-like 1 ENSTR0000463317.1 synaptobrevin-like 1 ENSTR0000262640.6 synaptobrevin-like 1 ENSTR0000460621.1 NP_001138621 ENSTR0000460621.1 synaptobrevin-like 1 ENSTR0000421233.1 pseudogene similar to part of transient receptor potential cation channel, subfamily C, member 6 (TRPC6) ENSTR0000489233.1 interleukin 9 receptor ENSTR0000483543.1 interleukin 9 receptor ENSTR0000494962.1 interleukin 9 receptor ENSTR0000244174.5 interleukin 9 receptor ENSTR0000369423.2 interleukin 9 receptor ENSTR0000399966.4 not best-in-genome evidence ENSTR0000469624.1 novel transcript ENSTR0000479401.1 novel transcript ENSTR0000340131.7 novel transcript ENSTR0000492963.1 novel transcript ENSTR0000460206.1 novel transcript ENSTR0000475594.1 novel transcript ENSTR0000482170.1 novel transcript ENSTR0000484415.1 novel transcript ENSTR0000483079.1 novel transcript ENSTR0000496301.1 novel transcript ENSTR0000483286.1 novel transcript ENSTR0000464205.1 novel transcript ENSTR0000359512.2 novel protein ENSTR0000476066.1 novel transcript ENSTR0000461007.1 novel transcript ENSTR0000496011.1 novel transcript ENSTR0000507418.1 pseudogene similar to part of a CHL1 helicase ENST00000383052.1 DKFZp434F2311 ENST00000443793.1 alternative 5' UTR ENST00000426950.2 similar to TSPY-S ENST00000383008.1 similar to TSPY-L ENST00000432394.1 similar to CYorf16 ENST00000287721.9 similar to TSPY-S ENST00000383000.1 similar to TSPY-L ENST00000436801.1 similar to CYorf16 ENST00000450658.1 similar to CYorf16 ENST00000414596.1 similar to CYorf16 ENST00000418016.1 similar to CYorf16 ENST00000428845.2 similar to TSPY-S ENST00000444056.1 similar to TSPY-L ENST00000430228.1 identical to testis-specific transcript, Y-linked 21 ENST00000417072.1 identical to testis-specific transcript, Y-linked 2 ENST00000250805.5 identical to testis-specific transcript, Y-linked 1 ENST00000452889.1 identical to testis-specific transcript, Y-linked 23 ENST00000440408.1 DKFZp434I143 ENST00000471409.1 FLJ33043 ENST00000458667.1 FLJ23014 ENST00000445421.1 pseudogene of the adrenal gland protein AD-004 isoform of TAF9 ENST00000442362.1 pseudogene of the known gene with interim symbol MGC57211 ENST00000442362.1 this pseudogene represents the first and third coding exons of the parent gene ENST00000454958.1 pseudogene of the adrenal gland protein AD-004 isoform of TAF9 ENST00000426660.1 KIAA0664 protein pseudogene ENST00000439490.1 FLJ42291 protein pseudogene ENST00000419557.1 FLJ23014 ENST00000458627.1 almost identical to AC015978.2-001 (FAM41AY) ENST00000432335.1 identical to AC022486.6-001 (TTTY9) ENST00000331787.2 TTTY14 ENST00000441139.1 FLJ93821 ENST00000400605.1 FLJ39821 ENST00000459719.1 FLJ45474 ENST00000464196.1 FLJ45762 ENST00000382764.1 FLJ22714 ENST00000253838.3 identical to testis-specific transcript, Y-linked 6 ENST00000436568.1 identical to testis-specific transcript, Y-linked 4 (TTTY4) ENST00000331070.3 NMD exception ENST00000343584.6 probable unprocessed pseudogene ENST00000306882.4 isoform b ENST00000382407.1 isoform a ENST00000441906.1 identical to testis-specific transcript, Y-linked 17 ENST00000420149.1 identical to testis-specific transcript, Y-linked 4 (TTTY4) ENST00000382392.1 PMID:1272427 ENST00000382392.1 PMID:1517755 ENST00000382392.1 NMD exception ENST00000382287.1 NMD exception ENST00000421387.1 identical to testis-specific transcript, Y-linked 17 ENST00000306641.1 identical to chondroitin sulfate proteoglycan 4-like, Y-linked (CSPG4LY) ENST00000306609.4 identical to chromodomain protein, Y-linked, 1 (CDY1) isoform b ENST00000306589.6 identical to PTPN13-like, Y-linked (PRY), howevef, this locus lacks exons 1 and 2 of the parent gene - likely to be an unprocessed pseudogene