| p-value: | 1e-3 |
| log p-value: | -8.481e+00 |
| Information Content per bp: | 1.530 |
| Number of Target Sequences with motif | 1241.0 |
| Percentage of Target Sequences with motif | 98.96% |
| Number of Background Sequences with motif | 7914.5 |
| Percentage of Background Sequences with motif | 97.53% |
| Average Position of motif in Targets | 165.8 +/- 95.2bp |
| Average Position of motif in Background | 163.0 +/- 98.2bp |
| Strand Bias (log2 ratio + to - strand density) | -0.0 |
| Multiplicity (# of sites on avg that occur together) | 4.34 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
TRA2(RRM)/Drosophila_melanogaster-RNCMPT00078-PBM/HughesRNA
| Match Rank: | 1 |
| Score: | 0.89 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | AGAAGAAG -GAAGAAG |
|
|
|
PABPN1(RRM)/Homo_sapiens-RNCMPT00157-PBM/HughesRNA
| Match Rank: | 2 |
| Score: | 0.83 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | AGAAGAAG AGAAGAN- |
|
|
|
Unknown4/Arabidopsis-Promoters/Homer
| Match Rank: | 3 |
| Score: | 0.82 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --AGAAGAAG RAAGAMGAMG |
|
|
|
PEND/MA0127.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.79 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -AGAAGAAG- AATAAGAAGT |
|
|
|
REF2(RRM)/Drosophila_melanogaster-RNCMPT00059-PBM/HughesRNA
| Match Rank: | 5 |
| Score: | 0.73 |
| Offset: | 3 |
| Orientation: | forward strand |
| Alignment: | AGAAGAAG-- ---AGAAGGC |
|
|
|
PU.1(ETS)/ThioMac-PU.1-ChIP-Seq(GSE21512)/Homer
| Match Rank: | 6 |
| Score: | 0.70 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | AGAAGAAG-- AGAGGAAGTG |
|
|
|
SFL1/MA0377.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.70 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------AGAAGAAG----- TAGAGAATAGAAGAAATAAAA |
|
|
|
RBM5(RRM)/Homo_sapiens-RNCMPT00154-PBM/HughesRNA
| Match Rank: | 8 |
| Score: | 0.68 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | AGAAGAAG -GAAGGAG |
|
|
|
POL008.1_DCE_S_I/Jaspar
| Match Rank: | 9 |
| Score: | 0.68 |
| Offset: | 3 |
| Orientation: | reverse strand |
| Alignment: | AGAAGAAG- ---NGAAGC |
|
|
|
Tb_0230(RRM)/Trypanosoma_brucei-RNCMPT00230-PBM/HughesRNA
| Match Rank: | 10 |
| Score: | 0.67 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | AGAAGAAG AGAAGGAC |
|
|
|