| p-value: | 1e-12 |
| log p-value: | -2.882e+01 |
| Information Content per bp: | 1.923 |
| Number of Target Sequences with motif | 50.0 |
| Percentage of Target Sequences with motif | 1.33% |
| Number of Background Sequences with motif | 29.6 |
| Percentage of Background Sequences with motif | 0.40% |
| Average Position of motif in Targets | 155.7 +/- 102.3bp |
| Average Position of motif in Background | 114.5 +/- 103.6bp |
| Strand Bias (log2 ratio + to - strand density) | 1.6 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
TYE7/MA0409.1/Jaspar
| Match Rank: | 1 |
| Score: | 0.76 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -ACGTGAGC CACGTGA-- |
|
|
|
TGA2/MA1068.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.75 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | ACGTGAGC ACGTCATC |
|
|
|
CBF1/MA0281.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.75 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --ACGTGAGC GCACGTGA-- |
|
|
|
bZIP910(2)(bZIP)/Antirrhinum majus/AthaMap
| Match Rank: | 4 |
| Score: | 0.75 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | ACGTGAGC---- ACGTCAGCACCC |
|
|
|
CBF1/CBF1_SM/72-CBF1(Harbison)/Yeast
| Match Rank: | 5 |
| Score: | 0.75 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -ACGTGAGC CACGTGA-- |
|
|
|
TGA1a(bZIP)/Nicotiana tabacum/AthaMap
| Match Rank: | 6 |
| Score: | 0.75 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---ACGTGAGC CTCACGTGAG- |
|
|
|
PB0007.1_Bhlhb2_1/Jaspar
| Match Rank: | 7 |
| Score: | 0.72 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------ACGTGAGC----- GGAAGAGTCACGTGACCAATAC |
|
|
|
bZIP42(bZIP)/colamp-bZIP42-DAP-Seq(GSE60143)/Homer
| Match Rank: | 8 |
| Score: | 0.72 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---ACGTGAGC- GCCACGTCAGCA |
|
|
|
Arntl/MA0603.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.72 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --ACGTGAGC NCACGTGACN |
|
|
|
BIM1/MA0964.1/Jaspar
| Match Rank: | 10 |
| Score: | 0.72 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --ACGTGAGC GCACGTGACC |
|
|
|