| p-value: | 1e-19 |
| log p-value: | -4.605e+01 |
| Information Content per bp: | 1.906 |
| Number of Target Sequences with motif | 132.0 |
| Percentage of Target Sequences with motif | 3.51% |
| Number of Background Sequences with motif | 104.7 |
| Percentage of Background Sequences with motif | 1.40% |
| Average Position of motif in Targets | 168.6 +/- 98.9bp |
| Average Position of motif in Background | 163.7 +/- 95.2bp |
| Strand Bias (log2 ratio + to - strand density) | 0.1 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| SVG Files for Logos: | forward logo reverse opposite |
CHA4(MacIsaac)/Yeast
| Match Rank: | 1 |
| Score: | 0.83 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TTCATCGC- CTCATCGCA |
|
|
|
TOD6/MA0350.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.74 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------TTCATCGC----- AGGCACAGCTCATCGCGTTTT |
|
|
|
RBM47(RRM)/Gallus_gallus-RNCMPT00279-PBM/HughesRNA
| Match Rank: | 3 |
| Score: | 0.74 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TTCATCGC NATCATC-- |
|
|
|
Rbm47(RRM)/Xenopus_tropicalis-RNCMPT00280-PBM/HughesRNA
| Match Rank: | 4 |
| Score: | 0.74 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TTCATCGC NATCATC-- |
|
|
|
DOT6/MA0351.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.73 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------TTCATCGC----- TTCTGCACCTCATCGCATCCT |
|
|
|
TOD6?/SacCer-Promoters/Homer
| Match Rank: | 6 |
| Score: | 0.72 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TTCATCGC AKCTCATCGC |
|
|
|
Hoxd9/MA0913.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.68 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TTCATCGC TTTTTATTGC |
|
|
|
Hmx1/MA0896.1/Jaspar
| Match Rank: | 8 |
| Score: | 0.68 |
| Offset: | -5 |
| Orientation: | reverse strand |
| Alignment: | -----TTCATCGC---- ANNCATTAATTGCTNGN |
|
|
|
PH0041.1_Hmx1/Jaspar
| Match Rank: | 9 |
| Score: | 0.68 |
| Offset: | -5 |
| Orientation: | reverse strand |
| Alignment: | -----TTCATCGC---- ANNCATTAATTGCTNGN |
|
|
|
RBP1-LIKE(RRM)/Drosophila_melanogaster-RNCMPT00127-PBM/HughesRNA
| Match Rank: | 10 |
| Score: | 0.67 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | TTCATCGC ATCAACG- |
|
|
|