| p-value: | 1e-2 |
| log p-value: | -6.007e+00 |
| Information Content per bp: | 1.832 |
| Number of Target Sequences with motif | 50.0 |
| Percentage of Target Sequences with motif | 2.03% |
| Number of Background Sequences with motif | 25.4 |
| Percentage of Background Sequences with motif | 1.03% |
| Average Position of motif in Targets | 31.6 +/- 11.5bp |
| Average Position of motif in Background | 33.6 +/- 15.5bp |
| Strand Bias (log2 ratio + to - strand density) | 0.3 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
ETS:RUNX(ETS,Runt)/Jurkat-RUNX1-ChIP-Seq(GSE17954)/Homer
| Match Rank: | 1 |
| Score: | 0.74 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CCGCATCC--- ACCACATCCTGT |
|

|
|
gcm/dmmpmm(Bergman)/fly
| Match Rank: | 2 |
| Score: | 0.71 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --CCGCATCC ACCCGCAT-- |
|

|
|
GCM2/MA0767.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.70 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---CCGCATCC TACCCGCATN- |
|

|
|
PB0024.1_Gcm1_1/Jaspar
| Match Rank: | 4 |
| Score: | 0.69 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------CCGCATCC-- TCGTACCCGCATCATT |
|

|
|
FUS3/MA0565.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.68 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CCGCATCC- GCGCATGCG |
|

|
|
DOT6/MA0351.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.68 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------CCGCATCC------ TTCTGCACCTCATCGCATCCT |
|

|
|
gcm2/MA0917.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.68 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --CCGCATCC ACCCGCAT-- |
|

|
|
TOD6/MA0350.1/Jaspar
| Match Rank: | 8 |
| Score: | 0.67 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------CCGCATCC------ AGGCACAGCTCATCGCGTTTT |
|

|
|
TOD6?/SacCer-Promoters/Homer
| Match Rank: | 9 |
| Score: | 0.65 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CCGCATCC- AKCTCATCGC |
|

|
|
GCM1/MA0646.1/Jaspar
| Match Rank: | 10 |
| Score: | 0.65 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----CCGCATCC GTACCCGCATN- |
|

|
|