| p-value: | 1e-2 |
| log p-value: | -4.660e+00 |
| Information Content per bp: | 1.809 |
| Number of Target Sequences with motif | 23.0 |
| Percentage of Target Sequences with motif | 4.86% |
| Number of Background Sequences with motif | 9.5 |
| Percentage of Background Sequences with motif | 2.02% |
| Average Position of motif in Targets | 11.1 +/- 4.0bp |
| Average Position of motif in Background | 11.5 +/- 6.3bp |
| Strand Bias (log2 ratio + to - strand density) | -0.7 |
| Multiplicity (# of sites on avg that occur together) | 1.04 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
XBP1(MacIsaac)/Yeast
| Match Rank: | 1 |
| Score: | 0.75 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TCCTCG-- TCCTCGAG |
|

|
|
Deaf1/dmmpmm(Pollard)/fly
| Match Rank: | 2 |
| Score: | 0.69 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | TCCTCG-- --TTCGGG |
|

|
|
Deaf1/MA0185.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.69 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | TCCTCG-- --TTCGGG |
|

|
|
NHP10/MA0344.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.69 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TCCTCG-- TCCCCGGC |
|

|
|
STB2(MacIsaac)/Yeast
| Match Rank: | 5 |
| Score: | 0.68 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TCCTCG NTTACCCG |
|

|
|
XBP1/MA0414.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.68 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | TCCTCG-- -NCTCGAG |
|

|
|
OAF1/MA0348.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.66 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TCCTCG- TATCTCCGA |
|

|
|
CHA4(MacIsaac)/Yeast
| Match Rank: | 8 |
| Score: | 0.66 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TCCTCG-- CTCATCGCA |
|

|
|
TOD6/MA0350.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.66 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------TCCTCG------ AGGCACAGCTCATCGCGTTTT |
|

|
|
REB1/REB1_YPD/61-REB1(Harbison)/Yeast
| Match Rank: | 10 |
| Score: | 0.66 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TCCTCG TTACCCG |
|

|
|