| p-value: | 1e-2 |
| log p-value: | -5.303e+00 |
| Information Content per bp: | 1.733 |
| Number of Target Sequences with motif | 23.0 |
| Percentage of Target Sequences with motif | 4.86% |
| Number of Background Sequences with motif | 9.0 |
| Percentage of Background Sequences with motif | 1.91% |
| Average Position of motif in Targets | 10.8 +/- 2.9bp |
| Average Position of motif in Background | 12.8 +/- 3.1bp |
| Strand Bias (log2 ratio + to - strand density) | 0.6 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
YER184C/MA0424.1/Jaspar
| Match Rank: | 1 |
| Score: | 0.82 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | TCYCCGGA- -CTCCGGAA |
|

|
|
ECM22/MA0292.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.82 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | TCYCCGGA -CTCCGGA |
|

|
|
SIP4/MA0380.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.80 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | TCYCCGGA -CTCCGGA |
|

|
|
CAT8/MA0280.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.79 |
| Offset: | 3 |
| Orientation: | forward strand |
| Alignment: | TCYCCGGA- ---CCGGAA |
|

|
|
GSM1/MA0308.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.77 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------TCYCCGGA----- ATTAAAAAACTCCGGAGTATA |
|

|
|
NHP10/MA0344.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.77 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TCYCCGGA TCCCCGGC |
|

|
|
ASG1/MA0275.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.75 |
| Offset: | 3 |
| Orientation: | forward strand |
| Alignment: | TCYCCGGA- ---CCGGAA |
|

|
|
OAF1/MA0348.1/Jaspar
| Match Rank: | 8 |
| Score: | 0.74 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TCYCCGGA TATCTCCGA- |
|

|
|
PDR3/MA0353.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.74 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | TCYCCGGA TCCGCGGA |
|

|
|
PDR3/Literature(Harbison)/Yeast
| Match Rank: | 10 |
| Score: | 0.74 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | TCYCCGGA TCCGCGGA |
|

|
|