| p-value: | 1e-8 |
| log p-value: | -1.963e+01 |
| Information Content per bp: | 1.788 |
| Number of Target Sequences with motif | 1630.0 |
| Percentage of Target Sequences with motif | 6.39% |
| Number of Background Sequences with motif | 4102.9 |
| Percentage of Background Sequences with motif | 5.41% |
| Average Position of motif in Targets | 202.9 +/- 141.3bp |
| Average Position of motif in Background | 231.1 +/- 167.5bp |
| Strand Bias (log2 ratio + to - strand density) | -0.0 |
| Multiplicity (# of sites on avg that occur together) | 1.06 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
RFX1/MA0365.1/Jaspar
| Match Rank: | 1 |
| Score: | 0.72 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | TATAGCAA-- --TAGCAACC |
|

|
|
CEBP:AP1(bZIP)/ThioMac-CEBPb-ChIP-Seq(GSE21512)/Homer
| Match Rank: | 2 |
| Score: | 0.71 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --TATAGCAA NATGTTGCAA |
|

|
|
PB0056.1_Rfxdc2_1/Jaspar
| Match Rank: | 3 |
| Score: | 0.69 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---TATAGCAA---- CCGCATAGCAACGGA |
|

|
|
PB0055.1_Rfx4_1/Jaspar
| Match Rank: | 4 |
| Score: | 0.68 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---TATAGCAA---- TACCATAGCAACGGT |
|

|
|
br-Z2/dmmpmm(SeSiMCMC)/fly
| Match Rank: | 5 |
| Score: | 0.66 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | TATAGCAA --TAGTAA |
|

|
|
PB0054.1_Rfx3_1/Jaspar
| Match Rank: | 6 |
| Score: | 0.65 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------TATAGCAA-------- TGTGACCCTTAGCAACCGATTAA |
|

|
|
GTS1(MacIsaac)/Yeast
| Match Rank: | 7 |
| Score: | 0.65 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | TATAGCAA --TACCAA |
|

|
|
MAC1/Literature(Harbison)/Yeast
| Match Rank: | 8 |
| Score: | 0.64 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | TATAGCAA- --GAGCAAA |
|

|
|
Rfx5(HTH)/GM12878-Rfx5-ChIP-Seq(GSE31477)/Homer
| Match Rank: | 9 |
| Score: | 0.63 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -TATAGCAA--- SCCTAGCAACAG |
|

|
|
PB0119.1_Foxa2_2/Jaspar
| Match Rank: | 10 |
| Score: | 0.63 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---TATAGCAA---- AAAAATAACAAACGG |
|

|
|