# WARNING: this file is not sorted! # db id alt consensus E-value adj_p-value log_adj_p-value bin_location bin_width total_width sites_in_bin total_sites p_success p-value mult_tests 1 CTCCCAAAGTGCTGGGATTACA MEME-2 CTCCCAAAGTGCTGGGATTACA 1.6e-005 2.1e-008 -17.66 0.0 19 29 48 48 0.65517 1.5e-009 14 1 CAGAGCGAGACTCCRTCTCA MEME-4 CAGAGCGAGACTCCRTCTCA 4.6e-012 6.2e-015 -32.71 0.0 9 31 40 46 0.29032 4.2e-016 15 1 CCCAAAGTGCTGGGATTACAGGYRTGAGC MEME-5 CCCAAAGTGCTGGGATTACAGGYRTGAGC 2.6e-017 3.5e-020 -44.79 0.0 8 22 50 51 0.36364 3.5e-021 10 1 TGGCTCAYGCCTGTAATCCC MEME-7 TGGCTCAYGCCTGTAATCCC 3.1e-016 4.2e-019 -42.32 0.0 9 31 47 52 0.29032 2.8e-020 15 1 AGTGCTGGGATTACAGGCRTG MEME-8 AGTGCTGGGATTACAGGCRTG 1.0e-028 1.4e-031 -71.08 0.0 6 30 50 52 0.20000 9.6e-033 14 2 M0212_1.02 (TCFL5)_(Mus_musculus)_(DBD_1.00) NBCDCGHGVN 6.6e-007 8.8e-010 -20.85 0.0 19 41 31 31 0.46341 4.4e-011 20 2 M0398_1.02 (ZSCAN10)_(Mus_musculus)_(DBD_0.82) NGKRAGTGCNN 5.5e0000 7.4e-003 -4.90 0.0 24 40 43 52 0.60000 3.9e-004 19 2 M0413_1.02 (ZBTB1)_(Mus_musculus)_(DBD_0.99) NDTGCGKGDN 5.3e-002 7.2e-005 -9.54 0.0 17 41 34 45 0.41463 3.6e-006 20 2 M0424_1.02 (SNAI3)_(Mus_musculus)_(DBD_0.75) NNTGACAKNN 3.7e-025 5.0e-028 -62.87 0.0 1 41 30 72 0.02439 2.5e-029 20 2 M0428_1.02 (ZNF691)_(Mus_musculus)_(DBD_0.97) RKGAGYAC 9.9e-014 1.3e-016 -36.55 0.0 7 43 37 53 0.16279 6.4e-018 21 2 M0608_1.02 MLL NNNRSCGNDN 3.6e-003 4.8e-006 -12.24 0.0 19 41 33 38 0.46341 2.4e-007 20 2 M0635_1.02 (DMRTC2)_(Mus_musculus)_(DBD_1.00) NAMATGTATHMWN 4.7e-006 6.4e-009 -18.87 0.0 2 38 12 23 0.05263 3.5e-010 18 2 M0890_1.02 LHX6 NYAATCAN 3.2e-017 4.3e-020 -44.59 0.0 7 43 35 42 0.16279 2.1e-021 21 2 M0897_1.02 HOXB13 DTTWAYDRBN 3.0e0000 4.1e-003 -5.50 0.0 23 41 37 45 0.56098 2.1e-004 20 2 M0901_1.02 AC226150.2 CWTGTCAA 7.4e-022 9.9e-025 -55.27 0.0 1 43 28 77 0.02326 4.7e-026 21 2 M0958_1.02 (LHX4)_(Mus_musculus)_(DBD_1.00) BYAATYW 3.4e-022 4.6e-025 -56.03 0.0 6 44 38 45 0.13636 2.2e-026 21 2 M1030_1.02 (NKX2-3)_(Mus_musculus)_(DBD_1.00) NVYACTTVD 5.6e-002 7.5e-005 -9.50 0.0 24 42 51 60 0.57143 3.7e-006 20 2 M1266_1.02 (IRF6)_(Mus_musculus)_(DBD_1.00) NVNCGAWACY 4.7e-010 6.3e-013 -28.09 0.0 15 41 41 45 0.36585 3.2e-014 20 2 M1507_1.02 (LCOR)_(Meleagris_gallopavo)_(DBD_1.00) NDWTTNGGNN 8.4e0000 1.1e-002 -4.49 0.0 33 41 88 94 0.80488 5.7e-004 20 2 M1545_1.02 GMEB1 NNNRCGTNN 1.6e0000 2.1e-003 -6.16 0.0 12 42 17 26 0.28571 1.1e-004 20 2 M1581_1.02 (CIC)_(Mus_musculus)_(DBD_1.00) NNTGCTGACW 6.9e-007 9.3e-010 -20.79 0.0 17 41 40 45 0.41463 4.7e-011 20 2 M1628_1.02 (TBX10)_(Mus_musculus)_(DBD_0.87) AGGTGTGAANN 2.0e-003 2.7e-006 -12.83 0.0 16 40 36 46 0.40000 1.4e-007 19 2 M1919_1.02 YY1 CAARATGGCBGC 4.6e-001 6.2e-004 -7.39 0.0 11 39 19 29 0.28205 3.2e-005 19 2 M1926_1.02 ZEB1 CAGGTGWGB 7.7e0000 1.0e-002 -4.57 0.0 12 42 23 43 0.28571 5.2e-004 20 2 M1928_1.02 NFKB1 KGGRMTTTCCM 3.9e-001 5.2e-004 -7.56 0.0 6 40 8 11 0.15000 2.8e-005 19 2 M1955_1.02 STAT1 TTTCYRGGAAA 6.9e-005 9.3e-008 -16.19 0.0 6 40 14 18 0.15000 4.9e-009 19 2 M1963_1.02 (ZFY)_(Mus_musculus)_(DBD_0.97) SSSGSCBVGGCCTS 1.8e0000 2.5e-003 -6.01 0.0 17 37 29 38 0.45946 1.4e-004 18 2 M2270_1.02 DUX4 TAAYYYAATCA 7.7e-010 1.0e-012 -27.60 0.0 12 40 42 52 0.30000 5.4e-014 19 2 M2278_1.02 FOS DVTGASTCATB 7.4e-004 1.0e-006 -13.82 0.0 28 40 47 47 0.70000 5.2e-008 19 2 M2292_1.02 JUND DRTGASTCATS 1.1e-003 1.4e-006 -13.46 0.0 28 40 46 46 0.70000 7.5e-008 19 2 M2296_1.02 MAFK MWDASTCAGCAWWWW 1.1e-009 1.5e-012 -27.25 0.0 16 36 41 42 0.44444 8.6e-014 17 2 M4452_1.02 BATF TYYYRDWATGASTCA 2.9e-002 3.8e-005 -10.17 0.0 16 36 50 69 0.44444 2.3e-006 17 2 M4463_1.02 IRF4 DNWSNGGAAVTGAVWSWD 6.2e0000 8.3e-003 -4.79 0.0 23 33 37 40 0.69697 5.2e-004 16 2 M4469_1.02 REST TCCRTGGTGCTGAA 8.3e-002 1.1e-004 -9.10 0.0 23 37 35 37 0.62162 6.2e-006 18 2 M4565_1.02 FOSL2 VDGGATGASTCAYH 4.3e-003 5.8e-006 -12.06 0.0 23 37 54 59 0.62162 3.2e-007 18 2 M4619_1.02 FOSL1 BGGTGASTCAK 1.9e-002 2.6e-005 -10.58 0.0 30 40 47 47 0.75000 1.3e-006 19 2 M4623_1.02 JUNB NDRTGASTCATNYHY 1.5e-003 2.0e-006 -13.11 0.0 24 36 52 54 0.66667 1.2e-007 17 2 M4640_1.02 ZBTB7A GGGSRRGGGKCBSNG 6.4e-005 8.7e-008 -16.26 0.0 6 36 29 58 0.16667 5.1e-009 17 2 M4681_1.02 BACH2 TGCTGAGTCA 9.1e-001 1.2e-003 -6.70 0.0 29 41 28 28 0.70732 6.2e-005 20 2 M4692_1.02 SIX5 ACTACAAYTC 5.0e-011 6.7e-014 -30.33 0.0 7 41 33 48 0.17073 3.4e-015 20 2 M4971_1.02 (FERD3L)_(Drosophila_melanogaster)_(DBD_0.89) GTVACAGVTG 1.3e-002 1.8e-005 -10.94 0.0 5 41 13 24 0.12195 8.8e-007 20 2 M5116_1.02 (ATOH8)_(Drosophila_melanogaster)_(DBD_0.70) RCCACCTGK 1.4e-006 1.9e-009 -20.07 0.0 10 42 30 42 0.23810 9.6e-011 20 2 M5320_1.02 CENPB CCCGCDTNNWRCGAA 2.6e0000 3.4e-003 -5.67 0.0 16 36 19 23 0.44444 2.0e-004 17 2 M5321_1.02 CLOCK AACACGTGTH 5.6e0000 7.6e-003 -4.88 0.0 9 41 11 18 0.21951 3.8e-004 20 2 M5345_1.02 DMBX1 NHTAATCCBH 6.8e-023 9.1e-026 -57.66 0.0 7 41 43 49 0.17073 4.6e-027 20 2 M5346_1.02 DPRX SHTAATCCNN 1.4e-021 1.9e-024 -54.61 0.0 7 41 40 45 0.17073 9.6e-026 20 2 M5349_1.02 DUXA NTRAYYTAATCAN 1.8e-008 2.4e-011 -24.47 0.0 12 38 38 46 0.31579 1.3e-012 18 2 M5430_1.02 FIGLA WMCACCTGKW 2.3e-005 3.1e-008 -17.28 0.0 9 41 28 43 0.21951 1.6e-009 20 2 M5497_1.02 GRHL1 AACCGGTYTAACCGGTT 6.2e-004 8.3e-007 -14.00 0.0 6 34 11 12 0.17647 5.2e-008 16 2 M5500_1.02 GSC VYTAATCCSH 1.2e-024 1.7e-027 -61.65 0.0 7 41 43 47 0.17073 8.4e-029 20 2 M5501_1.02 GSC2 NYTAATCCBH 2.3e-025 3.1e-028 -63.33 0.0 7 41 44 48 0.17073 1.6e-029 20 2 M5504_1.02 HES5 YGGCACGTGYCR 6.6e-001 8.9e-004 -7.02 0.0 17 39 12 12 0.43590 4.7e-005 19 2 M5506_1.02 HES7 YGGCACGTGCCR 3.5e0000 4.7e-003 -5.36 0.0 17 39 10 10 0.43590 2.5e-004 19 2 M5509_1.02 HEY1 GRCACGTGBC 5.6e0000 7.6e-003 -4.88 0.0 9 41 11 18 0.21951 3.8e-004 20 2 M5518_1.02 HMX1 NNTTAATTGNT 1.7e0000 2.3e-003 -6.09 0.0 26 40 46 52 0.65000 1.2e-004 19 2 M5519_1.02 HMX2 NDTTAAKTGBT 7.1e0000 9.6e-003 -4.64 0.0 28 40 53 59 0.70000 5.1e-004 19 2 M5520_1.02 HMX3 BNTTAAKTGNY 5.2e-003 7.0e-006 -11.86 0.0 26 40 46 48 0.65000 3.7e-007 19 2 M5547_1.02 HOXC11 DGTCRTWAAAH 4.5e0000 6.1e-003 -5.10 0.0 24 40 30 34 0.60000 3.2e-004 19 2 M5555_1.02 HOXD11 RTCGTAAAAH 3.3e0000 4.4e-003 -5.42 0.0 25 41 32 36 0.60976 2.2e-004 20 2 M5571_1.02 ID4 DVCAGGTGYN 6.6e-007 8.9e-010 -20.84 0.0 9 41 28 39 0.21951 4.5e-011 20 2 M5583_1.02 ISL2 YTAAKTGC 1.4e-006 1.9e-009 -20.09 0.0 25 43 53 55 0.58140 9.0e-011 21 2 M5621_1.02 MEIS3 SCTGTCAH 1.2e-019 1.6e-022 -50.16 0.0 1 43 27 82 0.02326 7.8e-024 21 2 M5627_1.02 MESP1 NVCAGGTGYD 8.5e-004 1.1e-006 -13.69 0.0 9 41 26 43 0.21951 5.7e-008 20 2 M5628_1.02 MGA AGGTGTGA 2.1e-013 2.9e-016 -35.79 0.0 17 43 70 82 0.39535 1.4e-017 21 2 M5636_1.02 MSC AACAGCTGTT 5.7e-001 7.6e-004 -7.18 0.0 9 41 10 13 0.21951 3.8e-005 20 2 M5689_1.02 NRL DWWNTGCTGAC 1.1e-006 1.5e-009 -20.33 0.0 22 40 44 45 0.55000 7.8e-011 19 2 M5717_1.02 PITX1 NHTAATCCC 1.6e-029 2.2e-032 -72.91 0.0 6 42 45 49 0.14286 1.1e-033 20 2 M5720_1.02 PITX3 NHTAATCCC 1.6e-029 2.2e-032 -72.91 0.0 6 42 45 49 0.14286 1.1e-033 20 2 M5722_1.02 PKNOX2 TGACACCTGTCA 6.4e-015 8.6e-018 -39.30 0.0 9 39 31 32 0.23077 4.5e-019 19 2 M5753_1.02 PROX1 YAAGACGYCTTA 1.4e-008 1.8e-011 -24.72 0.0 7 39 19 21 0.17949 9.7e-013 19 2 M5873_1.02 TBR1 AGGTGTGAAA 8.7e-005 1.2e-007 -15.96 0.0 15 41 38 49 0.36585 5.9e-009 20 2 M5875_1.02 TBX1 AGGTGTGAAAAAAGGTGTGA 1.6e-023 2.2e-026 -59.07 0.0 3 31 29 31 0.09677 1.5e-027 15 2 M5883_1.02 TBX20 TCACACSTTCACACCT 9.2e0000 1.2e-002 -4.40 0.0 25 35 28 29 0.71429 7.3e-004 17 2 M5896_1.02 TBX4 AGGTGTGA 1.3e-001 1.7e-004 -8.66 0.0 13 43 39 70 0.30233 8.3e-006 21 2 M5934_1.02 TGIF2 TGACASCTGTCA 6.4e-015 8.6e-018 -39.30 0.0 9 39 31 32 0.23077 4.5e-019 19 2 M5935_1.02 TGIF2LX TGACASCTGTCA 6.4e-015 8.6e-018 -39.30 0.0 9 39 31 32 0.23077 4.5e-019 19 2 M5959_1.02 ZBTB49 TTTCGCYTGGCVSGTCA 9.2e0000 1.2e-002 -4.39 0.0 2 34 3 4 0.05882 7.8e-004 16 2 M6131_1.02 (TFCP2L1)_(Mus_musculus)_(DBD_0.95) CYRGYTYHRDCYRGYTYNRDC 1.3e-006 1.8e-009 -20.15 0.0 10 30 35 43 0.33333 1.3e-010 14 2 M6139_1.02 AHR KCACGCRAH 3.3e-001 4.5e-004 -7.71 0.0 10 42 16 25 0.23810 2.2e-005 20 2 M6141_1.02 ALX1 TAATBYAATTAB 1.6e-008 2.2e-011 -24.54 0.0 13 39 43 53 0.33333 1.2e-012 19 2 M6151_1.02 ARNT BYRCGTGC 8.3e-003 1.1e-005 -11.40 0.0 11 43 19 26 0.25581 5.3e-007 21 2 M6182_1.02 CRX YTAATCHB 2.8e-022 3.8e-025 -56.23 0.0 7 43 41 47 0.16279 1.8e-026 21 2 M6187_1.02 DDIT3 GGGGATTGCABBB 8.1e-027 1.1e-029 -66.69 0.0 4 38 40 49 0.10526 6.0e-031 18 2 M6210_1.02 ENO1 YDSMCACRTGSYB 5.7e0000 7.7e-003 -4.86 0.0 26 38 40 44 0.68421 4.3e-004 18 2 M6212_1.02 EPAS1 CMCACGYAYDCAC 4.6e-010 6.3e-013 -28.10 0.0 8 38 27 32 0.21053 3.5e-014 18 2 M6213_1.02 ERG ACCGGAARTSM 3.4e-007 4.6e-010 -21.50 0.0 2 40 10 13 0.05000 2.4e-011 19 2 M6236_1.02 FOXC2 YCTRDSWAAACAAAC 4.6e-002 6.2e-005 -9.70 0.0 18 36 57 75 0.50000 3.6e-006 17 2 M6258_1.02 GATA6 NWGATAA 6.5e-019 8.8e-022 -48.49 0.0 8 44 41 49 0.18182 4.2e-023 21 2 M6259_1.02 GCM1 HWNATGCKGGYMBK 2.6e-006 3.5e-009 -19.46 0.0 17 37 41 45 0.45946 2.0e-010 18 2 M6262_1.02 GFI1B WGCMGTGATTT 2.7e-010 3.7e-013 -28.63 0.0 12 40 39 46 0.30000 1.9e-014 19 2 M6263_1.02 GFI1 RCWSTGATTT 2.8e-015 3.7e-018 -40.14 0.0 11 41 44 50 0.26829 1.9e-019 20 2 M6268_1.02 HAND1 AAWKCCAGAYVC 1.9e-011 2.6e-014 -31.27 0.0 15 39 49 54 0.38462 1.4e-015 19 2 M6273_1.02 HEY2 GBBGGCWCGTGGCHTBV 1.6e-005 2.2e-008 -17.63 0.0 16 34 34 36 0.47059 1.4e-009 16 2 M6278_1.02 HLTF KANKGCTGSMAM 8.0e0000 1.1e-002 -4.53 0.0 17 39 9 9 0.43590 5.7e-004 19 2 M6287_1.02 HSF2 VGAABRTTCTAGAA 5.8e-005 7.8e-008 -16.37 0.0 21 37 34 34 0.56757 4.3e-009 18 2 M6290_1.02 HOXA13 CCAATAAWAHC 3.9e-015 5.3e-018 -39.78 0.0 4 40 39 77 0.10000 2.8e-019 19 2 M6302_1.02 HOXD13 TCYCTAATAAA 3.5e-001 4.8e-004 -7.65 0.0 24 40 51 60 0.60000 2.5e-005 19 2 M6316_1.02 TCF4 VCAGGTGCD 4.2e-002 5.6e-005 -9.78 0.0 10 42 23 39 0.23810 2.8e-006 20 2 M6330_1.02 MAFA BTGCTGACBMYGCARYHTYCV 5.0e-001 6.7e-004 -7.31 0.0 6 30 15 27 0.20000 4.8e-005 14 2 M6331_1.02 MAFB WGCTGACDS 6.4e0000 8.6e-003 -4.76 0.0 32 42 44 46 0.76190 4.3e-004 20 2 M6332_1.02 MAF KTGCTGAC 1.7e0000 2.3e-003 -6.09 0.0 17 43 42 67 0.39535 1.1e-004 21 2 M6343_1.02 MEIS1 CDTWAAVCTGTCA 1.0e-001 1.4e-004 -8.90 0.0 10 38 14 18 0.26316 7.6e-006 18 2 M6344_1.02 MEIS2 KGACAVCTGTCAA 4.3e-014 5.7e-017 -37.40 0.0 8 38 31 34 0.21053 3.2e-018 18 2 M6345_1.02 MITF VKCACATGWY 4.0e-001 5.4e-004 -7.53 0.0 17 41 25 32 0.41463 2.7e-005 20 2 M6360_1.02 NFE2L2 VRTGACTCAGCA 2.6e-004 3.5e-007 -14.87 0.0 27 39 63 65 0.69231 1.8e-008 19 2 M6370_1.02 NFKB2 GRAATBYCCCT 8.1e-013 1.1e-015 -34.45 0.0 12 40 43 49 0.30000 5.7e-017 19 2 M6374_1.02 NKX2-1 STCAAGKGCH 6.9e0000 9.3e-003 -4.68 0.0 25 41 44 53 0.60976 4.7e-004 20 2 M6376_1.02 NKX2-5 TYAAGTG 3.5e-003 4.7e-006 -12.26 0.0 26 44 46 50 0.59091 2.3e-007 21 2 M6381_1.02 NR0B1 YSTCCCMCKC 1.8e-001 2.4e-004 -8.32 0.0 19 41 42 56 0.46341 1.2e-005 20 2 M6400_1.02 OTX1 BTAAKCCT 1.2e-018 1.6e-021 -47.87 0.0 7 43 37 44 0.16279 7.8e-023 21 2 M6401_1.02 OTX2 HYYTAATCCBWKHDM 1.7e-019 2.3e-022 -49.82 0.0 10 36 50 54 0.27778 1.4e-023 17 2 M6406_1.02 PAX2 RHTCAGTSAYGMGTGAYW 1.3e0000 1.7e-003 -6.37 0.0 15 33 29 38 0.45455 1.1e-004 16 2 M6410_1.02 PAX6 TSAWGCGTRAA 1.7e-005 2.3e-008 -17.57 0.0 10 40 27 37 0.25000 1.2e-009 19 2 M6418_1.02 PITX2 DBTAATCCMA 8.7e-028 1.2e-030 -68.92 0.0 7 41 51 58 0.17073 5.9e-032 20 2 M6439_1.02 PRRX1 TAAYCTG 1.5e-012 2.1e-015 -33.82 0.0 8 44 37 52 0.18182 9.8e-017 21 2 M6448_1.02 RELB RGGGRMTTTCCH 5.3e-002 7.1e-005 -9.56 0.0 9 39 10 11 0.23077 3.7e-006 19 2 M6449_1.02 REL DKGGRNWTTCCV 1.5e0000 2.0e-003 -6.20 0.0 5 39 8 14 0.12821 1.1e-004 19 2 M6464_1.02 SMAD2 GTGTCHGKCTV 7.9e-002 1.1e-004 -9.14 0.0 2 40 13 59 0.05000 5.6e-006 19 2 M6468_1.02 SNAI1 SCAGGTGK 2.8e-001 3.8e-004 -7.87 0.0 9 43 22 44 0.20930 1.8e-005 21 2 M6486_1.02 SPZ1 CGGCKGWWACMBYGGG 2.6e-007 3.5e-010 -21.77 0.0 3 35 20 41 0.08571 2.1e-011 17 2 M6503_1.02 TBX2 GKSRCDYYTCACACCTVTGWWKBCA 4.8e-009 6.4e-012 -25.77 0.0 12 26 47 50 0.46154 5.3e-013 12 2 M6504_1.02 TBX3 AGKWAGRSAMTTAGGTSWKAARAA 1.4e-001 1.8e-004 -8.60 0.0 3 27 9 16 0.11111 1.4e-005 13 2 M6505_1.02 TBX5 AGGTGTGA 1.7e-004 2.3e-007 -15.28 0.0 13 43 48 78 0.30233 1.1e-008 21 2 M6514_1.02 TFCP2 SCCWGMNMDSRCCRGA 1.3e-008 1.8e-011 -24.75 0.0 7 35 35 54 0.20000 1.0e-012 17 2 M6519_1.02 TGIF1 MWGSTGACACCTSMCA 5.2e0000 7.0e-003 -4.96 0.0 27 35 30 30 0.77143 4.2e-004 17 2 M6547_1.02 ZFX SVGSSSSSCAGGCCBVGSC 3.8e-004 5.2e-007 -14.47 0.0 4 32 22 50 0.12500 3.5e-008 15 2 M6550_1.02 ZIC3 BGGGTGGYC 9.9e0000 1.3e-002 -4.32 0.0 38 42 73 73 0.90476 6.7e-004 20 2 M6559_1.02 ZNF589 CCMASGGKWWYWRCCS 5.0e-003 6.7e-006 -11.91 0.0 5 35 11 15 0.14286 3.9e-007 17 ## # Detailed descriptions of columns in this file: # # db: The name of the database (file name) that contains the motif. # id: A name for the motif that is unique in the motif database file. # alt: An alternate name of the motif that may be provided # in the motif database file. # consensus: A consensus sequence computed from the motif. # E-value: The expected number motifs that would have least one. # region as enriched for best matches to the motif as the reported region. # The E-value is the p-value multiplied by the number of motifs in the # input database(s). # adj_p-value: The probability that any tested region would be as enriched for # best matches to this motif as the reported region is. # By default the p-value is calculated by using the one-tailed binomial # test on the number of sequences with a match to the motif # that have their best match in the reported region, corrected for # the number of regions and score thresholds tested. # The test assumes that the probability that the best match in a sequence # falls in the region is the region width divided by the # number of places a motif # can align in the sequence (sequence length minus motif width plus 1). # When CentriMo is run in discriminative mode with a negative # set of sequences, the p-value of a region is calculated # using the Fisher exact test on the # enrichment of best matches in the positive sequences relative # to the negative sequences, corrected # for the number of regions and score thresholds tested. # The test assumes that the probability that the best match (if any) # falls into a given region # is the same for all positive and negative sequences. # log_adj_p-value: Log of adjusted p-value. # bin_location: Location of the center of the most enriched region. # bin_width: The width (in sequence positions) of the most enriched region. # A best match to the motif is counted as being in the region if the # center of the motif falls in the region. # total_width: The window maximal size which can be reached for this motif: # rounded(sequence length - motif length +1)/2 # sites_in_bin: The number of (positive) sequences whose best match to the motif # falls in the reported region. # Note: This number may be less than the number of # (positive) sequences that have a best match in the region. # The reason for this is that a sequence may have many matches that score # equally best. # If n matches have the best score in a sequence, 1/n is added to the # appropriate bin for each match. # total_sites: The number of sequences containing a match to the motif # above the score threshold. # p_success: The probability of falling in the enriched window: # bin width / total width # p-value: The uncorrected p-value before it gets adjusted to the # number of multiple tests to give the adjusted p-value. # mult_tests: This is the number of multiple tests (n) done for this motif. # It was used to correct the original p-value of a region for # multiple tests using the formula: # p' = 1 - (1-p)^n where p is the uncorrected p-value. # The number of multiple tests is the number of regions # considered times the number of score thresholds considered. # It depends on the motif length, sequence length, and the type of # optimizations being done (central enrichment, local enrichment, # score optimization).