# WARNING: this file is not sorted!
# db	id                         alt	consensus	 E-value	adj_p-value	log_adj_p-value	bin_location	bin_width	total_width	sites_in_bin	total_sites	p_success	 p-value	mult_tests
   1	CACACACACACACACACACACA  MEME-1	CACACACACACACACACACACA	1.0e-012	   1.4e-015	         -34.19	         0.0	      157	        479	         115	        178	  0.32777	5.9e-018	       239
   1	CACACACACACACACA        MEME-2	CACACACACACACACA	1.2e-006	   1.6e-009	         -20.26	         0.0	      161	        485	         148	        278	  0.33196	6.6e-012	       242
   2	CYATAAA                DREME-1	CYATAAA	1.8e0000	   2.5e-003	          -5.99	         0.0	      210	        494	          61	         94	  0.42510	1.0e-005	       246
   3	M0719_1.02               FOXG1	RTAAACAW	5.5e-001	   7.5e-004	          -7.20	         0.0	      367	        493	         331	        394	  0.74442	3.1e-006	       246
   3	M0736_1.02 (FOXK2)_(Mus_musculus)_(DBD_0.90)	RTMAACAA	1.6e0000	   2.2e-003	          -6.12	         0.0	      391	        493	         452	        522	  0.79310	8.9e-006	       246
   3	M1628_1.02 (TBX10)_(Mus_musculus)_(DBD_0.87)	AGGTGTGAANN	6.5e0000	   8.9e-003	          -4.73	         0.0	      150	        490	         200	        513	  0.30612	3.6e-005	       244
   3	M2310_1.02               RUNX2	MAAACCACARAMMMM	1.5e-001	   2.0e-004	          -8.50	         0.0	      164	        486	         239	        546	  0.33745	8.4e-007	       242
   3	M5446_1.02             FOXD4L2	GTAAACA	6.3e0000	   8.6e-003	          -4.76	         0.0	      414	        494	         498	        555	  0.83806	3.5e-005	       246
   3	M5875_1.02                TBX1	AGGTGTGAAAAAAGGTGTGA	4.9e-003	   6.6e-006	         -11.93	         0.0	      275	        481	         186	        251	  0.57173	2.7e-008	       240
   3	M5883_1.02               TBX20	TCACACSTTCACACCT	4.5e0000	   6.1e-003	          -5.10	         0.0	      195	        485	         170	        331	  0.40206	2.5e-005	       242
   3	M5981_1.02              ZSCAN4	TTTTCAGKGTGTGCA	3.1e-003	   4.3e-006	         -12.37	         0.0	      100	        486	         109	        321	  0.20576	1.8e-008	       242
   3	M6244_1.02               FOXM1	RWAAWCAMWCAAV	4.0e0000	   5.4e-003	          -5.22	         0.0	      100	        488	         147	        526	  0.20492	2.2e-005	       243
   3	M6251_1.02               FUBP1	TYGTNTTTTTTT	1.5e0000	   2.1e-003	          -6.17	         0.0	       83	        489	         130	        531	  0.16973	8.6e-006	       244
##
# Detailed descriptions of columns in this file:
#
# db:	The name of the database (file name) that contains the motif.
# id:	A name for the motif that is unique in the motif database file.
# alt:	An alternate name of the motif that may be provided
#	in the motif database file.
# consensus:	A consensus sequence computed from the motif.
# E-value:	The expected number motifs that would have least one.
#	region as enriched for best matches to the motif as the reported region.
#	The E-value is the p-value multiplied by the number of motifs in the
#	input database(s).
# adj_p-value:	The probability that any tested region would be as enriched for
#	best matches to this motif as the reported region is.
#	By default the p-value is calculated by using the one-tailed binomial
#	test on the number of sequences with a match to the motif 
#	that have their best match in the reported region, corrected for
#	the number of regions and score thresholds tested.
#	The test assumes that the probability that the best match in a sequence
#	falls in the region is the region width divided by the
#	number of places a motif
#	can align in the sequence (sequence length minus motif width plus 1).
#	When CentriMo is run in discriminative mode with a negative
#	set of sequences, the p-value of a region is calculated
#	using the Fisher exact test on the 
#	enrichment of best matches in the positive sequences relative
#	to the negative sequences, corrected
#	for the number of regions and score thresholds tested.
#	The test assumes that the probability that the best match (if any)
#	falls into a given region
#	is the same for all positive and negative sequences.
# log_adj_p-value:	Log of adjusted p-value.
# bin_location:	Location of the center of the most enriched region.
# bin_width:	The width (in sequence positions) of the most enriched region.
#	A best match to the motif is counted as being in the region if the
#	center of the motif falls in the region.
# total_width:	The window maximal size which can be reached for this motif:
#		rounded(sequence length - motif length +1)/2
# sites_in_bin:	The number of (positive) sequences whose best match to the motif
#	falls in the reported region.
#	Note: This number may be less than the number of
#	(positive) sequences that have a best match in the region.
#	The reason for this is that a sequence may have many matches that score
#	equally best.
#	If n matches have the best score in a sequence, 1/n is added to the
#	appropriate bin for each match.
# total_sites:	The number of sequences containing a match to the motif
#	above the score threshold.
# p_success:	The probability of falling in the enriched window:
#		bin width / total width
# p-value:	The uncorrected p-value before it gets adjusted to the
#	number of multiple tests to give the adjusted p-value.
# mult_tests:	This is the number of multiple tests (n) done for this motif.
#	It was used to correct the original p-value of a region for
#	multiple tests using the formula:
#		p' = 1 - (1-p)^n where p is the uncorrected p-value.
#	The number of multiple tests is the number of regions
#	considered times the number of score thresholds considered.
#	It depends on the motif length, sequence length, and the type of
#	optimizations being done (central enrichment, local enrichment,
#	score optimization).