# WARNING: this file is not sorted! # db id alt consensus E-value adj_p-value log_adj_p-value bin_location bin_width total_width sites_in_bin total_sites p_success p-value mult_tests 1 SNGSNKGTKMTGGARB MEME-1 SNGSNKGTKMTGGARB 2.3e-058 3.1e-061 -139.32 0.0 97 485 306 600 0.20000 1.3e-063 242 1 ATTTAGAGTCAGTATAAATATTGAYRCRTAGTCCYTTTGCAAG MEME-2 ATTTAGAGTCAGTATAAATATTGAYRCRTAGTCCYTTTGCAAG 8.9e-002 1.2e-004 -9.04 0.0 58 458 7 7 0.12664 5.2e-007 228 1 CATGCTGTTATATGGGCAGAAA MEME-3 CATGCTGTTATATGGGCAGAAA 4.9e-001 6.6e-004 -7.32 0.0 77 479 7 7 0.16075 2.8e-006 239 1 GCAGAACAG MEME-6 GCAGAACAG 2.4e-027 3.2e-030 -67.91 0.0 158 492 243 396 0.32114 1.3e-032 245 1 TGAGTCA MEME-8 TGAGTCA 1.2e-004 1.6e-007 -15.65 0.0 228 494 96 132 0.46154 6.5e-010 246 2 GTTMTGS DREME-1 GTTCTGS 3.7e-032 4.9e-035 -79.00 0.0 80 494 128 250 0.16194 2.0e-037 246 3 M0433_1.02 (ZBTB12)_(Mus_musculus)_(DBD_1.00) NYCTAGAACN 6.9e0000 9.3e-003 -4.68 0.0 27 491 57 585 0.05499 3.8e-005 245 3 M4469_1.02 REST TCCRTGGTGCTGAA 1.2e-002 1.7e-005 -11.01 0.0 167 487 207 445 0.34292 6.8e-008 243 3 M4681_1.02 BACH2 TGCTGAGTCA 3.2e-002 4.3e-005 -10.05 0.0 225 491 257 442 0.45825 1.8e-007 245 3 M6331_1.02 MAFB WGCTGACDS 4.4e0000 5.8e-003 -5.14 0.0 400 492 522 596 0.81301 2.4e-005 245 3 M6465_1.02 SMAD3 STGTCTGBCY 9.3e0000 1.2e-002 -4.39 0.0 17 491 41 597 0.03462 5.1e-005 245 ## # Detailed descriptions of columns in this file: # # db: The name of the database (file name) that contains the motif. # id: A name for the motif that is unique in the motif database file. # alt: An alternate name of the motif that may be provided # in the motif database file. # consensus: A consensus sequence computed from the motif. # E-value: The expected number motifs that would have least one. # region as enriched for best matches to the motif as the reported region. # The E-value is the p-value multiplied by the number of motifs in the # input database(s). # adj_p-value: The probability that any tested region would be as enriched for # best matches to this motif as the reported region is. # By default the p-value is calculated by using the one-tailed binomial # test on the number of sequences with a match to the motif # that have their best match in the reported region, corrected for # the number of regions and score thresholds tested. # The test assumes that the probability that the best match in a sequence # falls in the region is the region width divided by the # number of places a motif # can align in the sequence (sequence length minus motif width plus 1). # When CentriMo is run in discriminative mode with a negative # set of sequences, the p-value of a region is calculated # using the Fisher exact test on the # enrichment of best matches in the positive sequences relative # to the negative sequences, corrected # for the number of regions and score thresholds tested. # The test assumes that the probability that the best match (if any) # falls into a given region # is the same for all positive and negative sequences. # log_adj_p-value: Log of adjusted p-value. # bin_location: Location of the center of the most enriched region. # bin_width: The width (in sequence positions) of the most enriched region. # A best match to the motif is counted as being in the region if the # center of the motif falls in the region. # total_width: The window maximal size which can be reached for this motif: # rounded(sequence length - motif length +1)/2 # sites_in_bin: The number of (positive) sequences whose best match to the motif # falls in the reported region. # Note: This number may be less than the number of # (positive) sequences that have a best match in the region. # The reason for this is that a sequence may have many matches that score # equally best. # If n matches have the best score in a sequence, 1/n is added to the # appropriate bin for each match. # total_sites: The number of sequences containing a match to the motif # above the score threshold. # p_success: The probability of falling in the enriched window: # bin width / total width # p-value: The uncorrected p-value before it gets adjusted to the # number of multiple tests to give the adjusted p-value. # mult_tests: This is the number of multiple tests (n) done for this motif. # It was used to correct the original p-value of a region for # multiple tests using the formula: # p' = 1 - (1-p)^n where p is the uncorrected p-value. # The number of multiple tests is the number of regions # considered times the number of score thresholds considered. # It depends on the motif length, sequence length, and the type of # optimizations being done (central enrichment, local enrichment, # score optimization).