# WARNING: this file is not sorted!
# db	id                         alt	consensus	 E-value	adj_p-value	log_adj_p-value	bin_location	bin_width	total_width	sites_in_bin	total_sites	p_success	 p-value	mult_tests
   1	ACACACACACACACACACA     MEME-1	ACACACACACACACACACA	8.6e-016	   1.2e-018	         -41.30	         0.0	      118	        482	         156	        320	  0.24481	4.8e-021	       240
   1	TGTGTGTGTGTGTGTGTGTG    MEME-2	TGTGTGTGTGTGTGTGTGTG	2.3e-011	   3.0e-014	         -31.12	         0.0	      101	        481	         149	        375	  0.20998	1.3e-016	       240
   1	GTGTGTGTG               MEME-4	GTGTGTGTG	2.5e-012	   3.3e-015	         -33.34	         0.0	      116	        492	         158	        360	  0.23577	1.4e-017	       245
   1	ACACACCACACACA          MEME-6	ACACACCACACACA	4.7e0000	   6.4e-003	          -5.05	         0.0	      129	        487	          98	        256	  0.26489	2.6e-005	       243
   1	TGTGTGTGTGT             MEME-9	TGTGTGTGTGT	3.8e-012	   5.2e-015	         -32.90	         0.0	      112	        490	         170	        409	  0.22857	2.1e-017	       244
   3	M2310_1.02               RUNX2	MAAACCACARAMMMM	8.9e-002	   1.2e-004	          -9.03	         0.0	      244	        486	         336	        554	  0.50206	4.9e-007	       242
   3	M5875_1.02                TBX1	AGGTGTGAAAAAAGGTGTGA	6.8e0000	   9.1e-003	          -4.70	         0.0	      215	        481	         178	        319	  0.44699	3.8e-005	       240
   3	M5883_1.02               TBX20	TCACACSTTCACACCT	1.4e-004	   1.9e-007	         -15.50	         0.0	      115	        485	         152	        410	  0.23711	7.7e-010	       242
   3	M5981_1.02              ZSCAN4	TTTTCAGKGTGTGCA	1.9e-004	   2.5e-007	         -15.19	         0.0	       74	        486	         103	        374	  0.15226	1.0e-009	       242
   3	M6200_1.02                EGR3	WGAGTGGGYGT	2.7e-008	   3.6e-011	         -24.04	         0.0	      120	        490	         202	        518	  0.24490	1.5e-013	       244
   3	M6212_1.02               EPAS1	CMCACGYAYDCAC	2.3e-007	   3.1e-010	         -21.90	         0.0	       94	        488	         169	        525	  0.19262	1.3e-012	       243
   3	M6265_1.02                GLI2	GTGGGTGGTCY	4.9e-001	   6.6e-004	          -7.32	         0.0	      124	        490	         145	        406	  0.25306	2.7e-006	       244
   3	M6266_1.02                GLI3	BTGGGTGGTCY	5.0e-002	   6.7e-005	          -9.61	         0.0	       82	        490	         130	        508	  0.16735	2.7e-007	       244
   3	M6323_1.02                KLF3	HRCYWGGGTGKGGCT	7.0e-002	   9.4e-005	          -9.27	         0.0	      122	        486	         178	        507	  0.25103	3.9e-007	       242
   3	M6456_1.02               RREB1	DKGKKKGKGGKTGKTTKGGGKT	2.3e-008	   3.1e-011	         -24.21	         0.0	       75	        479	         145	        507	  0.15658	1.3e-013	       239
##
# Detailed descriptions of columns in this file:
#
# db:	The name of the database (file name) that contains the motif.
# id:	A name for the motif that is unique in the motif database file.
# alt:	An alternate name of the motif that may be provided
#	in the motif database file.
# consensus:	A consensus sequence computed from the motif.
# E-value:	The expected number motifs that would have least one.
#	region as enriched for best matches to the motif as the reported region.
#	The E-value is the p-value multiplied by the number of motifs in the
#	input database(s).
# adj_p-value:	The probability that any tested region would be as enriched for
#	best matches to this motif as the reported region is.
#	By default the p-value is calculated by using the one-tailed binomial
#	test on the number of sequences with a match to the motif 
#	that have their best match in the reported region, corrected for
#	the number of regions and score thresholds tested.
#	The test assumes that the probability that the best match in a sequence
#	falls in the region is the region width divided by the
#	number of places a motif
#	can align in the sequence (sequence length minus motif width plus 1).
#	When CentriMo is run in discriminative mode with a negative
#	set of sequences, the p-value of a region is calculated
#	using the Fisher exact test on the 
#	enrichment of best matches in the positive sequences relative
#	to the negative sequences, corrected
#	for the number of regions and score thresholds tested.
#	The test assumes that the probability that the best match (if any)
#	falls into a given region
#	is the same for all positive and negative sequences.
# log_adj_p-value:	Log of adjusted p-value.
# bin_location:	Location of the center of the most enriched region.
# bin_width:	The width (in sequence positions) of the most enriched region.
#	A best match to the motif is counted as being in the region if the
#	center of the motif falls in the region.
# total_width:	The window maximal size which can be reached for this motif:
#		rounded(sequence length - motif length +1)/2
# sites_in_bin:	The number of (positive) sequences whose best match to the motif
#	falls in the reported region.
#	Note: This number may be less than the number of
#	(positive) sequences that have a best match in the region.
#	The reason for this is that a sequence may have many matches that score
#	equally best.
#	If n matches have the best score in a sequence, 1/n is added to the
#	appropriate bin for each match.
# total_sites:	The number of sequences containing a match to the motif
#	above the score threshold.
# p_success:	The probability of falling in the enriched window:
#		bin width / total width
# p-value:	The uncorrected p-value before it gets adjusted to the
#	number of multiple tests to give the adjusted p-value.
# mult_tests:	This is the number of multiple tests (n) done for this motif.
#	It was used to correct the original p-value of a region for
#	multiple tests using the formula:
#		p' = 1 - (1-p)^n where p is the uncorrected p-value.
#	The number of multiple tests is the number of regions
#	considered times the number of score thresholds considered.
#	It depends on the motif length, sequence length, and the type of
#	optimizations being done (central enrichment, local enrichment,
#	score optimization).