# WARNING: this file is not sorted!
# db	id                         alt	consensus	 E-value	adj_p-value	log_adj_p-value	bin_location	bin_width	total_width	sites_in_bin	total_sites	p_success	 p-value	mult_tests
   1	WGWGDGWGWGDGWGWGDGWG    MEME-1	WGWGDGWGWGDGWGWGDGWG	4.8e-007	   6.4e-010	         -21.17	         0.0	      143	        481	         220	        494	  0.29730	2.7e-012	       240
   1	AGRGAGAGARAGAGRGAGAGAG  MEME-2	AGRGAGAGARAGAGRGAGAGAG	1.2e-002	   1.7e-005	         -11.00	         0.0	      269	        479	         183	        252	  0.56159	7.0e-008	       239
   1	GGAGAGAGRGAG            MEME-3	GGAGAGAGRGAG	1.4e-004	   1.9e-007	         -15.49	         0.0	       77	        489	         125	        467	  0.15746	7.7e-010	       244
   1	CACACACACACACACACACACACACACACAC MEME-4	CACACACACACACACACACACACACACACAC	5.4e-012	   7.3e-015	         -32.55	         0.0	      122	        470	          99	        177	  0.25957	3.1e-017	       234
   1	AKCASCABCAKCABCAKC      MEME-5	AKCASCABCAKCABCAKC	4.0e0000	   5.4e-003	          -5.22	         0.0	      105	        483	          48	        126	  0.21739	2.3e-005	       241
   1	TTATTGAGTGCACTCAGACCCAGYGGATTAACATCCAAAARCTGGGCCC MEME-6	TTATTGAGTGCACTCAGACCCAGYGGATTAACATCCAAAARCTGGGCCC	1.5e-006	   2.1e-009	         -20.00	         0.0	       64	        452	          13	         13	  0.14159	9.2e-012	       225
   1	TGCTGCTGCTGCTGCTGCTGCT  MEME-8	TGCTGCTGCTGCTGCTGCTGCT	1.5e0000	   2.0e-003	          -6.23	         0.0	      115	        479	          73	        190	  0.24008	8.2e-006	       239
   1	KGTGTGTGTGTGTGT        MEME-10	KGTGTGTGTGTGTGT	2.1e-010	   2.8e-013	         -28.90	         0.0	      152	        486	         135	        240	  0.31276	1.2e-015	       242
   2	TAYTGCAA               DREME-1	TAYTGCAA	9.9e-003	   1.3e-005	         -11.23	         0.0	       87	        493	          44	        113	  0.17647	5.4e-008	       246
   3	M5875_1.02                TBX1	AGGTGTGAAAAAAGGTGTGA	3.8e-001	   5.1e-004	          -7.59	         0.0	      159	        481	         133	        288	  0.33056	2.1e-006	       240
   3	M5883_1.02               TBX20	TCACACSTTCACACCT	5.6e-001	   7.5e-004	          -7.20	         0.0	      233	        485	         217	        362	  0.48041	3.1e-006	       242
   3	M5981_1.02              ZSCAN4	TTTTCAGKGTGTGCA	2.2e-002	   3.0e-005	         -10.42	         0.0	      168	        486	         142	        286	  0.34568	1.2e-007	       242
##
# Detailed descriptions of columns in this file:
#
# db:	The name of the database (file name) that contains the motif.
# id:	A name for the motif that is unique in the motif database file.
# alt:	An alternate name of the motif that may be provided
#	in the motif database file.
# consensus:	A consensus sequence computed from the motif.
# E-value:	The expected number motifs that would have least one.
#	region as enriched for best matches to the motif as the reported region.
#	The E-value is the p-value multiplied by the number of motifs in the
#	input database(s).
# adj_p-value:	The probability that any tested region would be as enriched for
#	best matches to this motif as the reported region is.
#	By default the p-value is calculated by using the one-tailed binomial
#	test on the number of sequences with a match to the motif 
#	that have their best match in the reported region, corrected for
#	the number of regions and score thresholds tested.
#	The test assumes that the probability that the best match in a sequence
#	falls in the region is the region width divided by the
#	number of places a motif
#	can align in the sequence (sequence length minus motif width plus 1).
#	When CentriMo is run in discriminative mode with a negative
#	set of sequences, the p-value of a region is calculated
#	using the Fisher exact test on the 
#	enrichment of best matches in the positive sequences relative
#	to the negative sequences, corrected
#	for the number of regions and score thresholds tested.
#	The test assumes that the probability that the best match (if any)
#	falls into a given region
#	is the same for all positive and negative sequences.
# log_adj_p-value:	Log of adjusted p-value.
# bin_location:	Location of the center of the most enriched region.
# bin_width:	The width (in sequence positions) of the most enriched region.
#	A best match to the motif is counted as being in the region if the
#	center of the motif falls in the region.
# total_width:	The window maximal size which can be reached for this motif:
#		rounded(sequence length - motif length +1)/2
# sites_in_bin:	The number of (positive) sequences whose best match to the motif
#	falls in the reported region.
#	Note: This number may be less than the number of
#	(positive) sequences that have a best match in the region.
#	The reason for this is that a sequence may have many matches that score
#	equally best.
#	If n matches have the best score in a sequence, 1/n is added to the
#	appropriate bin for each match.
# total_sites:	The number of sequences containing a match to the motif
#	above the score threshold.
# p_success:	The probability of falling in the enriched window:
#		bin width / total width
# p-value:	The uncorrected p-value before it gets adjusted to the
#	number of multiple tests to give the adjusted p-value.
# mult_tests:	This is the number of multiple tests (n) done for this motif.
#	It was used to correct the original p-value of a region for
#	multiple tests using the formula:
#		p' = 1 - (1-p)^n where p is the uncorrected p-value.
#	The number of multiple tests is the number of regions
#	considered times the number of score thresholds considered.
#	It depends on the motif length, sequence length, and the type of
#	optimizations being done (central enrichment, local enrichment,
#	score optimization).