# WARNING: this file is not sorted! # db id alt consensus E-value adj_p-value log_adj_p-value bin_location bin_width total_width sites_in_bin total_sites p_success p-value mult_tests 1 TATTATTATTDTTWTT MEME-1 TATTATTATTDTTWTT 4.8e-007 6.3e-010 -21.18 0.0 163 485 132 236 0.33608 2.6e-012 242 1 ACAMAMACAMAMACAMAMAYAM MEME-2 ACAMAMACAMAMACAMAMAYAM 4.3e-011 5.7e-014 -30.50 0.0 149 479 144 259 0.31106 2.4e-016 239 1 TTGCAGTGAGCCGAGATCGCGCCACTGCACTCCAGCCT MEME-3 TTGCAGTGAGCCGAGATCGCGCCACTGCACTCCAGCCT 5.0e0000 6.7e-003 -5.00 0.0 295 463 64 75 0.63715 2.9e-005 231 1 ACACACACACAC MEME-9 ACACACACACAC 3.2e-003 4.2e-006 -12.38 0.0 105 489 86 228 0.21472 1.7e-008 244 1 WTDTAYTATCTHAYTTAATBYTHABAAYAW MEME-10 WTDTAYTATCTHAYTTAATBYTHABAAYAW 7.2e-001 9.6e-004 -6.95 0.0 63 471 60 250 0.13376 4.1e-006 235 2 AATAATAA DREME-1 AATAATAA 5.8e-004 7.8e-007 -14.07 0.0 151 493 91 175 0.30629 3.2e-009 246 3 M1601_1.02 (SOX11)_(Mus_musculus)_(DBD_1.00) WTTGTBNNN 6.3e-001 8.3e-004 -7.09 0.0 50 492 92 564 0.10163 3.4e-006 245 3 M5335_1.02 CUX2 ATCGATAHNDTTATYGAT 1.1e0000 1.5e-003 -6.52 0.0 157 483 78 158 0.32505 6.1e-006 241 3 M5835_1.02 SOX7 AACAATRWBCAKTGTT 1.2e-002 1.6e-005 -11.03 0.0 87 485 60 172 0.17938 6.7e-008 242 3 M6212_1.02 EPAS1 CMCACGYAYDCAC 1.6e0000 2.2e-003 -6.13 0.0 344 488 421 534 0.70492 8.9e-006 243 3 M6456_1.02 RREB1 DKGKKKGKGGKTGKTTKGGGKT 2.5e0000 3.3e-003 -5.71 0.0 87 479 123 472 0.18163 1.4e-005 239 3 M6477_1.02 SOX5 WAACAATR 1.5e0000 2.0e-003 -6.21 0.0 53 493 86 497 0.10751 8.2e-006 246 ## # Detailed descriptions of columns in this file: # # db: The name of the database (file name) that contains the motif. # id: A name for the motif that is unique in the motif database file. # alt: An alternate name of the motif that may be provided # in the motif database file. # consensus: A consensus sequence computed from the motif. # E-value: The expected number motifs that would have least one. # region as enriched for best matches to the motif as the reported region. # The E-value is the p-value multiplied by the number of motifs in the # input database(s). # adj_p-value: The probability that any tested region would be as enriched for # best matches to this motif as the reported region is. # By default the p-value is calculated by using the one-tailed binomial # test on the number of sequences with a match to the motif # that have their best match in the reported region, corrected for # the number of regions and score thresholds tested. # The test assumes that the probability that the best match in a sequence # falls in the region is the region width divided by the # number of places a motif # can align in the sequence (sequence length minus motif width plus 1). # When CentriMo is run in discriminative mode with a negative # set of sequences, the p-value of a region is calculated # using the Fisher exact test on the # enrichment of best matches in the positive sequences relative # to the negative sequences, corrected # for the number of regions and score thresholds tested. # The test assumes that the probability that the best match (if any) # falls into a given region # is the same for all positive and negative sequences. # log_adj_p-value: Log of adjusted p-value. # bin_location: Location of the center of the most enriched region. # bin_width: The width (in sequence positions) of the most enriched region. # A best match to the motif is counted as being in the region if the # center of the motif falls in the region. # total_width: The window maximal size which can be reached for this motif: # rounded(sequence length - motif length +1)/2 # sites_in_bin: The number of (positive) sequences whose best match to the motif # falls in the reported region. # Note: This number may be less than the number of # (positive) sequences that have a best match in the region. # The reason for this is that a sequence may have many matches that score # equally best. # If n matches have the best score in a sequence, 1/n is added to the # appropriate bin for each match. # total_sites: The number of sequences containing a match to the motif # above the score threshold. # p_success: The probability of falling in the enriched window: # bin width / total width # p-value: The uncorrected p-value before it gets adjusted to the # number of multiple tests to give the adjusted p-value. # mult_tests: This is the number of multiple tests (n) done for this motif. # It was used to correct the original p-value of a region for # multiple tests using the formula: # p' = 1 - (1-p)^n where p is the uncorrected p-value. # The number of multiple tests is the number of regions # considered times the number of score thresholds considered. # It depends on the motif length, sequence length, and the type of # optimizations being done (central enrichment, local enrichment, # score optimization).