| p-value: | 1e-36 |
| log p-value: | -8.407e+01 |
| Information Content per bp: | 1.689 |
| Number of Target Sequences with motif | 695.0 |
| Percentage of Target Sequences with motif | 16.61% |
| Number of Background Sequences with motif | 2109.9 |
| Percentage of Background Sequences with motif | 10.20% |
| Average Position of motif in Targets | 447.7 +/- 393.8bp |
| Average Position of motif in Background | 285.4 +/- 210.9bp |
| Strand Bias (log2 ratio + to - strand density) | -0.4 |
| Multiplicity (# of sites on avg that occur together) | 1.21 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
TOD6?/SacCer-Promoters/Homer
| Match Rank: | 1 |
| Score: | 0.82 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --CGCAYCGC AKCTCATCGC |
|

|
|
CHA4(MacIsaac)/Yeast
| Match Rank: | 2 |
| Score: | 0.80 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CGCAYCGC- CTCATCGCA |
|

|
|
TOD6/MA0350.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.78 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------CGCAYCGC----- AGGCACAGCTCATCGCGTTTT |
|

|
|
DOT6/MA0351.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.77 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------CGCAYCGC----- TTCTGCACCTCATCGCATCCT |
|

|
|
Run/dmmpmm(Papatsenko)/fly
| Match Rank: | 5 |
| Score: | 0.73 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | CGCAYCGC- --CACCGCC |
|

|
|
PHO2/PHO2_H2O2Hi/[](Harbison)/Yeast
| Match Rank: | 6 |
| Score: | 0.70 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CGCAYCGC--- CGCACCGCACG |
|

|
|
pros/dmmpmm(Bergman)/fly
| Match Rank: | 7 |
| Score: | 0.68 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | CGCAYCGC- --CATGNCT |
|

|
|
CDC5(MYB)/Arabidopsis thaliana/AthaMap
| Match Rank: | 8 |
| Score: | 0.66 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --CGCAYCGC- GGCTCAGCGCG |
|

|
|
CDC5/MA0579.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.66 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --CGCAYCGC- GGCTCAGCGCG |
|

|
|
ABI4(1)(AP2/EREBP)/Zea mays/AthaMap
| Match Rank: | 10 |
| Score: | 0.65 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | CGCAYCGC---- --CACCGCCCCC |
|

|
|