| p-value: | 1e-22 |
| log p-value: | -5.128e+01 |
| Information Content per bp: | 1.930 |
| Number of Target Sequences with motif | 406.0 |
| Percentage of Target Sequences with motif | 9.84% |
| Number of Background Sequences with motif | 1237.5 |
| Percentage of Background Sequences with motif | 5.91% |
| Average Position of motif in Targets | 403.7 +/- 380.9bp |
| Average Position of motif in Background | 277.6 +/- 185.3bp |
| Strand Bias (log2 ratio + to - strand density) | -0.1 |
| Multiplicity (# of sites on avg that occur together) | 1.12 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
CHA4(MacIsaac)/Yeast
| Match Rank: | 1 |
| Score: | 0.86 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TCATCTCA CTCATCGCA |
|

|
|
TOD6?/SacCer-Promoters/Homer
| Match Rank: | 2 |
| Score: | 0.82 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---TCATCTCA AKCTCATCGC- |
|

|
|
DOT6/MA0351.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.75 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------TCATCTCA---- TTCTGCACCTCATCGCATCCT |
|

|
|
TOD6/MA0350.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.75 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------TCATCTCA---- AGGCACAGCTCATCGCGTTTT |
|

|
|
MAFG::NFE2L1/MA0089.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.70 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TCATCTCA GTCATN--- |
|

|
|
SREBF2/MA0596.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.70 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TCATCTCA- ATCACCCCAT |
|

|
|
SREBF1/MA0595.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.68 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -TCATCTCA- ATCACCCCAC |
|

|
|
Atf3/MA0605.1/Jaspar
| Match Rank: | 8 |
| Score: | 0.67 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---TCATCTCA ACGTCATC--- |
|

|
|
Tal1
| Match Rank: | 9 |
| Score: | 0.66 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | TCATCTCA -CATCTG- |
|

|
|
PB0098.1_Zfp410_1/Jaspar
| Match Rank: | 10 |
| Score: | 0.65 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----TCATCTCA----- NNNTCCATCCCATAANN |
|

|
|