| p-value: | 1e-6 |
| log p-value: | -1.529e+01 |
| Information Content per bp: | 1.828 |
| Number of Target Sequences with motif | 949.0 |
| Percentage of Target Sequences with motif | 21.26% |
| Number of Background Sequences with motif | 3641.4 |
| Percentage of Background Sequences with motif | 18.28% |
| Average Position of motif in Targets | 376.9 +/- 304.9bp |
| Average Position of motif in Background | 308.4 +/- 203.2bp |
| Strand Bias (log2 ratio + to - strand density) | 0.2 |
| Multiplicity (# of sites on avg that occur together) | 1.18 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
CIN5/CIN5_H2O2Lo/[](Harbison)/Yeast
| Match Rank: | 1 |
| Score: | 0.98 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TTACGTAA TTACGTAA |
|

|
|
gt/MA0447.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.95 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -TTACGTAA- ATTACGTAAT |
|

|
|
YAP6(MacIsaac)/Yeast
| Match Rank: | 3 |
| Score: | 0.94 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TTACGTAA TTATGTAA |
|

|
|
DBP/MA0639.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.94 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TTACGTAA-- NGTTACGTAATN |
|

|
|
GMEB2/MA0862.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.94 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TTACGTAA TTACGTAA |
|

|
|
TEF/MA0843.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.94 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TTACGTAA-- NGTTACGTAATN |
|

|
|
YAP1/MA0415.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.93 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------TTACGTAA------ ATTTGCTTACGTAAGCTCGT |
|

|
|
CIN5(MacIsaac)/Yeast
| Match Rank: | 8 |
| Score: | 0.92 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TTACGTAA- TTACGTAAG |
|

|
|
NFIL3/MA0025.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.92 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | TTACGTAA--- TTATGTAACAT |
|

|
|
HLF/MA0043.2/Jaspar
| Match Rank: | 10 |
| Score: | 0.91 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TTACGTAA-- NGTTACGTAANN |
|

|
|