| p-value: | 1e-16 |
| log p-value: | -3.909e+01 |
| Information Content per bp: | 1.799 |
| Number of Target Sequences with motif | 638.0 |
| Percentage of Target Sequences with motif | 18.57% |
| Number of Background Sequences with motif | 2754.3 |
| Percentage of Background Sequences with motif | 13.39% |
| Average Position of motif in Targets | 356.5 +/- 297.4bp |
| Average Position of motif in Background | 267.7 +/- 198.4bp |
| Strand Bias (log2 ratio + to - strand density) | 0.1 |
| Multiplicity (# of sites on avg that occur together) | 1.11 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
YAP3/MA0416.1/Jaspar
| Match Rank: | 1 |
| Score: | 0.95 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TACGTAAT TACGTAAT |
|

|
|
GMEB2/MA0862.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.91 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -TACGTAAT TTACGTAA- |
|

|
|
CIN5/CIN5_H2O2Lo/[](Harbison)/Yeast
| Match Rank: | 3 |
| Score: | 0.90 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -TACGTAAT TTACGTAA- |
|

|
|
YAP6(MacIsaac)/Yeast
| Match Rank: | 4 |
| Score: | 0.89 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TACGTAAT TTATGTAA- |
|

|
|
gt/MA0447.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.87 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --TACGTAAT ATTACGTAAT |
|

|
|
YAP1/MA0415.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.87 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------TACGTAAT----- ATTTGCTTACGTAAGCTCGT |
|

|
|
NAC025/MA0935.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.87 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | TACGTAAT TACGTAAC |
|

|
|
TEF/MA0843.1/Jaspar
| Match Rank: | 8 |
| Score: | 0.86 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---TACGTAAT- NGTTACGTAATN |
|

|
|
DBP/MA0639.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.86 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---TACGTAAT- NGTTACGTAATN |
|

|
|
NAC043/MA1045.1/Jaspar
| Match Rank: | 10 |
| Score: | 0.86 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TACGTAAT NTTACGTAAT |
|

|
|