| p-value: | 1e-46 |
| log p-value: | -1.072e+02 |
| Information Content per bp: | 1.632 |
| Number of Target Sequences with motif | 1155.0 |
| Percentage of Target Sequences with motif | 29.78% |
| Number of Background Sequences with motif | 4038.2 |
| Percentage of Background Sequences with motif | 20.03% |
| Average Position of motif in Targets | 441.5 +/- 354.9bp |
| Average Position of motif in Background | 286.7 +/- 258.8bp |
| Strand Bias (log2 ratio + to - strand density) | 0.1 |
| Multiplicity (# of sites on avg that occur together) | 1.46 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
STP1(MacIsaac)/Yeast
| Match Rank: | 1 |
| Score: | 0.84 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CGCCGCGC GCGCCGCA- |
|

|
|
STP1/MA0394.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.83 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CGCCGCGC GCGCCGCA- |
|

|
|
SUT1?/SacCer-Promoters/Homer
| Match Rank: | 3 |
| Score: | 0.79 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | CGCCGCGC CCCCGCGC |
|

|
|
SUT1(MacIsaac)/Yeast
| Match Rank: | 4 |
| Score: | 0.77 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CGCCGCGC CCCCGCG- |
|

|
|
SUT1/MA0399.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.77 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CGCCGCGC CCCCGCG- |
|

|
|
CRF2/MA0975.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.76 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -CGCCGCGC CCGCCGCC- |
|

|
|
ERF069/MA0997.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.74 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -CGCCGCGC GCGCCGCCA |
|

|
|
STP2/MA0395.1/Jaspar
| Match Rank: | 8 |
| Score: | 0.74 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------CGCCGCGC----- TGATCGGCGCCGCACGACGA |
|

|
|
CRF4/MA0976.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.74 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -CGCCGCGC GCGCCGCC- |
|

|
|
ERF109/MA1053.1/Jaspar
| Match Rank: | 10 |
| Score: | 0.73 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -CGCCGCGC GCGCCGCC- |
|

|
|