| p-value: | 1e-21 |
| log p-value: | -5.035e+01 |
| Information Content per bp: | 1.877 |
| Number of Target Sequences with motif | 589.0 |
| Percentage of Target Sequences with motif | 15.18% |
| Number of Background Sequences with motif | 2048.3 |
| Percentage of Background Sequences with motif | 10.16% |
| Average Position of motif in Targets | 393.7 +/- 331.0bp |
| Average Position of motif in Background | 283.2 +/- 198.9bp |
| Strand Bias (log2 ratio + to - strand density) | -0.4 |
| Multiplicity (# of sites on avg that occur together) | 1.11 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
CHA4(MacIsaac)/Yeast
| Match Rank: | 1 |
| Score: | 0.85 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --YATCGCAT CTCATCGCA- |
|

|
|
PB0098.1_Zfp410_1/Jaspar
| Match Rank: | 2 |
| Score: | 0.77 |
| Offset: | -5 |
| Orientation: | reverse strand |
| Alignment: | -----YATCGCAT---- NNNTCCATCCCATAANN |
|

|
|
Optix/dmmpmm(Noyes_hd)/fly
| Match Rank: | 3 |
| Score: | 0.69 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --YATCGCAT NNTATCACTT |
|

|
|
Su(H)/dmmpmm(Bergman)/fly
| Match Rank: | 4 |
| Score: | 0.68 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | YATCGCAT -CTCCCAC |
|

|
|
DOT6/MA0351.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.68 |
| Offset: | -10 |
| Orientation: | forward strand |
| Alignment: | ----------YATCGCAT--- TTCTGCACCTCATCGCATCCT |
|

|
|
Ddit3::Cebpa/MA0019.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.67 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --YATCGCAT-- GGGATTGCATNN |
|

|
|
BEAF-32B/dmmpmm(Pollard)/fly
| Match Rank: | 7 |
| Score: | 0.67 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --YATCGCAT AATATCGC-- |
|

|
|
TOD6?/SacCer-Promoters/Homer
| Match Rank: | 8 |
| Score: | 0.66 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | YATCGCAT--- -AKCTCATCGC |
|

|
|
GLN3/MA0307.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.65 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -YATCGCAT TTATC---- |
|

|
|
byn/dmmpmm(SeSiMCMC)/fly
| Match Rank: | 10 |
| Score: | 0.65 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -YATCGCAT AATTCGCAC |
|

|
|