| p-value: | 1e-34 |
| log p-value: | -7.986e+01 |
| Information Content per bp: | 1.895 |
| Number of Target Sequences with motif | 552.0 |
| Percentage of Target Sequences with motif | 13.23% |
| Number of Background Sequences with motif | 1647.0 |
| Percentage of Background Sequences with motif | 7.66% |
| Average Position of motif in Targets | 426.3 +/- 409.4bp |
| Average Position of motif in Background | 272.0 +/- 194.4bp |
| Strand Bias (log2 ratio + to - strand density) | 0.0 |
| Multiplicity (# of sites on avg that occur together) | 1.16 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
CHA4(MacIsaac)/Yeast
| Match Rank: | 1 |
| Score: | 0.93 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TCATCGCR CTCATCGCA |
|

|
|
TOD6/MA0350.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.84 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------TCATCGCR---- AGGCACAGCTCATCGCGTTTT |
|

|
|
DOT6/MA0351.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.83 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------TCATCGCR---- TTCTGCACCTCATCGCATCCT |
|

|
|
TOD6?/SacCer-Promoters/Homer
| Match Rank: | 4 |
| Score: | 0.80 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---TCATCGCR AKCTCATCGC- |
|

|
|
CDC5(MYB)/Arabidopsis thaliana/AthaMap
| Match Rank: | 5 |
| Score: | 0.64 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---TCATCGCR GGCTCAGCGCG |
|

|
|
CDC5/MA0579.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.64 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---TCATCGCR GGCTCAGCGCG |
|

|
|
Run/dmmpmm(Papatsenko)/fly
| Match Rank: | 7 |
| Score: | 0.64 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | TCATCGCR -CACCGCC |
|

|
|
GATA15/MA1016.1/Jaspar
| Match Rank: | 8 |
| Score: | 0.63 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TCATCGCR NNGATCANN |
|

|
|
MAFG::NFE2L1/MA0089.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.63 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TCATCGCR GTCATN--- |
|

|
|
RSC3/MA0374.1/Jaspar
| Match Rank: | 10 |
| Score: | 0.62 |
| Offset: | 4 |
| Orientation: | forward strand |
| Alignment: | TCATCGCR--- ----CGCGCGG |
|

|
|