| p-value: | 1e-19 |
| log p-value: | -4.447e+01 |
| Information Content per bp: | 1.895 |
| Number of Target Sequences with motif | 411.0 |
| Percentage of Target Sequences with motif | 9.63% |
| Number of Background Sequences with motif | 1272.1 |
| Percentage of Background Sequences with motif | 6.04% |
| Average Position of motif in Targets | 399.3 +/- 318.0bp |
| Average Position of motif in Background | 271.6 +/- 197.3bp |
| Strand Bias (log2 ratio + to - strand density) | -0.1 |
| Multiplicity (# of sites on avg that occur together) | 1.05 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
RPH1/Literature(Harbison)/Yeast
| Match Rank: | 1 |
| Score: | 0.76 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | CGCCTTAA-- CCCCTTAAGG |
|

|
|
RPH1(MacIsaac)/Yeast
| Match Rank: | 2 |
| Score: | 0.76 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | CGCCTTAA-- CCCCTTAAGG |
|

|
|
PB0180.1_Sp4_2/Jaspar
| Match Rank: | 3 |
| Score: | 0.67 |
| Offset: | -7 |
| Orientation: | reverse strand |
| Alignment: | -------CGCCTTAA NNGGCCACGCCTTTN |
|

|
|
PROX1/MA0794.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.67 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----CGCCTTAA CAAGACGCCTTA- |
|

|
|
MSN4(MacIsaac)/Yeast
| Match Rank: | 5 |
| Score: | 0.67 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CGCCTTAA CCCCCTT-- |
|

|
|
PHO2(MacIsaac)/Yeast
| Match Rank: | 6 |
| Score: | 0.66 |
| Offset: | 3 |
| Orientation: | reverse strand |
| Alignment: | CGCCTTAA- ---CTTAAT |
|

|
|
RPH1/MA0372.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.66 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -CGCCTTAA ACCCCTAA- |
|

|
|
USV1/MA0413.1/Jaspar
| Match Rank: | 8 |
| Score: | 0.65 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------CGCCTTAA------ AAATTCCCCCTGAATTTGTG |
|

|
|
YY2/MA0748.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.64 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---CGCCTTAA GTCCGCCATTA |
|

|
|
GIS1/MA0306.1/Jaspar
| Match Rank: | 10 |
| Score: | 0.64 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -CGCCTTAA ACCCCTAAA |
|

|
|