| p-value: | 1e-44 |
| log p-value: | -1.026e+02 |
| Information Content per bp: | 1.620 |
| Number of Target Sequences with motif | 1552.0 |
| Percentage of Target Sequences with motif | 36.20% |
| Number of Background Sequences with motif | 5693.3 |
| Percentage of Background Sequences with motif | 26.40% |
| Average Position of motif in Targets | 366.4 +/- 308.3bp |
| Average Position of motif in Background | 275.3 +/- 195.6bp |
| Strand Bias (log2 ratio + to - strand density) | -0.0 |
| Multiplicity (# of sites on avg that occur together) | 1.38 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
TATA-box/SacCer-Promoters/Homer
| Match Rank: | 1 |
| Score: | 0.87 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | CGTATATA---- --TATATAWDVV |
|

|
|
MOT2/MA0379.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.83 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | CGTATATA --TATAT- |
|

|
|
Cf2/dmmpmm(Bergman)/fly
| Match Rank: | 3 |
| Score: | 0.82 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | CGTATATA-- -GTATATATA |
|

|
|
Cf2/MA0015.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.81 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | CGTATATA--- -GTATATATAC |
|

|
|
PB0163.1_Six6_2/Jaspar
| Match Rank: | 5 |
| Score: | 0.79 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---CGTATATA------ ANNNGGATATATCCNNN |
|

|
|
POL012.1_TATA-Box/Jaspar
| Match Rank: | 6 |
| Score: | 0.78 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | CGTATATA-------- -GTATAAAAGGCGGGG |
|

|
|
TBP/MA0108.2/Jaspar
| Match Rank: | 7 |
| Score: | 0.78 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | CGTATATA-------- -GTATAAAAGGCGGGG |
|

|
|
bin/dmmpmm(Bergman)/fly
| Match Rank: | 8 |
| Score: | 0.76 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | CGTATATA -ATAAATA |
|

|
|
TBP(- other)/several species/AthaMap
| Match Rank: | 9 |
| Score: | 0.75 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | CGTATATA---- ACTATAAATACC |
|

|
|
NHP6A/MA0345.1/Jaspar
| Match Rank: | 10 |
| Score: | 0.75 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------CGTATATA------- ATGACCTATATATAAAAATGA |
|

|
|