| p-value: | 1e-4 |
| log p-value: | -1.024e+01 |
| Information Content per bp: | 1.847 |
| Number of Target Sequences with motif | 574.0 |
| Percentage of Target Sequences with motif | 13.34% |
| Number of Background Sequences with motif | 2301.6 |
| Percentage of Background Sequences with motif | 11.37% |
| Average Position of motif in Targets | 441.1 +/- 329.1bp |
| Average Position of motif in Background | 294.2 +/- 201.6bp |
| Strand Bias (log2 ratio + to - strand density) | 0.4 |
| Multiplicity (# of sites on avg that occur together) | 1.13 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
PB0148.1_Mtf1_2/Jaspar
| Match Rank: | 1 |
| Score: | 0.81 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --ATAAGAAA---- AAATAAGAAAAAAC |
|

|
|
PEND/MA0127.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.80 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -ATAAGAAA- AATAAGAAGT |
|

|
|
GLN3/GLN3_RAPA/8-GZF3,11-GLN3(Harbison)/Yeast
| Match Rank: | 3 |
| Score: | 0.80 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -ATAAGAAA GATAAGATA |
|

|
|
GLN3(MacIsaac)/Yeast
| Match Rank: | 4 |
| Score: | 0.75 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --ATAAGAAA AGATAAGATA |
|

|
|
DAL82/DAL82_SM/3-DAL82(Harbison)/Yeast
| Match Rank: | 5 |
| Score: | 0.74 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -ATAAGAAA GATAAGA-- |
|

|
|
hb/dmmpmm(Bergman)/fly
| Match Rank: | 6 |
| Score: | 0.74 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --ATAAGAAA CAATAAAAAA |
|

|
|
AZF1/MA0277.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.74 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -ATAAGAAA AAAAAGAAA |
|

|
|
Mecom/MA0029.1/Jaspar
| Match Rank: | 8 |
| Score: | 0.70 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---ATAAGAAA--- AAGATAAGATAACA |
|

|
|
PB0021.1_Gata3_1/Jaspar
| Match Rank: | 9 |
| Score: | 0.70 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------ATAAGAAA----- TTTTTAGAGATAAGAAATAAAG |
|

|
|
GZF3/Literature(Harbison)/Yeast
| Match Rank: | 10 |
| Score: | 0.69 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -ATAAGAAA GATAAG--- |
|

|
|