| p-value: | 1e-13 |
| log p-value: | -3.029e+01 |
| Information Content per bp: | 1.946 |
| Number of Target Sequences with motif | 644.0 |
| Percentage of Target Sequences with motif | 14.97% |
| Number of Background Sequences with motif | 2276.0 |
| Percentage of Background Sequences with motif | 11.24% |
| Average Position of motif in Targets | 357.4 +/- 305.6bp |
| Average Position of motif in Background | 295.1 +/- 183.9bp |
| Strand Bias (log2 ratio + to - strand density) | -0.0 |
| Multiplicity (# of sites on avg that occur together) | 1.09 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
cad/dmmpmm(Down)/fly
| Match Rank: | 1 |
| Score: | 0.85 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -AATTTTTC AAATTTTT- |
|

|
|
SFP1/SacCer-Promoters/Homer
| Match Rank: | 2 |
| Score: | 0.83 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----AATTTTTC DDAAAAATTTTY |
|

|
|
STB3/MA0390.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.80 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------AATTTTTC------- GTCCAAAATTTTTCACTCTGG |
|

|
|
SFP1/MA0378.1/Jaspar
| Match Rank: | 4 |
| Score: | 0.79 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------AATTTTTC----- ATTGAAAAAAATTTTCTACGG |
|

|
|
SUM1/MA0398.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.78 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --AATTTTTC AAAATTTTT- |
|

|
|
EDS1/MA0294.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.75 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | AATTTTTC-- -ATTTTTCCG |
|

|
|
NFATC2/MA0152.1/Jaspar
| Match Rank: | 7 |
| Score: | 0.70 |
| Offset: | 3 |
| Orientation: | forward strand |
| Alignment: | AATTTTTC-- ---TTTTCCA |
|

|
|
dl/dmmpmm(Bigfoot)/fly
| Match Rank: | 8 |
| Score: | 0.69 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -AATTTTTC-- GGATTTTCCCC |
|

|
|
dl/dmmpmm(SeSiMCMC)/fly
| Match Rank: | 9 |
| Score: | 0.69 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -AATTTTTC GGATTTTCC |
|

|
|
NFAT5/MA0606.1/Jaspar
| Match Rank: | 10 |
| Score: | 0.69 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | AATTTTTC---- --ATTTTCCATT |
|

|
|