| p-value: | 1e-29 |
| log p-value: | -6.697e+01 |
| Information Content per bp: | 1.924 |
| Number of Target Sequences with motif | 416.0 |
| Percentage of Target Sequences with motif | 11.12% |
| Number of Background Sequences with motif | 1228.3 |
| Percentage of Background Sequences with motif | 6.20% |
| Average Position of motif in Targets | 393.6 +/- 316.5bp |
| Average Position of motif in Background | 281.7 +/- 218.6bp |
| Strand Bias (log2 ratio + to - strand density) | -0.4 |
| Multiplicity (# of sites on avg that occur together) | 1.17 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
TOD6?/SacCer-Promoters/Homer
| Match Rank: | 1 |
| Score: | 0.95 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --CTCATCGC AKCTCATCGC |
|

|
|
TOD6/MA0350.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.90 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------CTCATCGC----- AGGCACAGCTCATCGCGTTTT |
|

|
|
DOT6/MA0351.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.89 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------CTCATCGC----- TTCTGCACCTCATCGCATCCT |
|

|
|
CHA4(MacIsaac)/Yeast
| Match Rank: | 4 |
| Score: | 0.88 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CTCATCGC- CTCATCGCA |
|

|
|
CDC5(MYB)/Arabidopsis thaliana/AthaMap
| Match Rank: | 5 |
| Score: | 0.74 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --CTCATCGC- GGCTCAGCGCG |
|

|
|
CDC5/MA0579.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.74 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --CTCATCGC- GGCTCAGCGCG |
|

|
|
GZF3/Literature(Harbison)/Yeast
| Match Rank: | 7 |
| Score: | 0.70 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CTCATCGC CTTATC-- |
|

|
|
GZF3(MacIsaac)/Yeast
| Match Rank: | 8 |
| Score: | 0.70 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CTCATCGC CTTATC-- |
|

|
|
DAL80/MA0289.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.70 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CTCATCGC CTTATCG- |
|

|
|
GAT1/GAT1_RAPA/1-GZF3,2-GLN3(Harbison)/Yeast
| Match Rank: | 10 |
| Score: | 0.69 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CTCATCGC CTTATCT- |
|

|
|