| p-value: | 1e-22 |
| log p-value: | -5.231e+01 |
| Information Content per bp: | 1.760 |
| Number of Target Sequences with motif | 836.0 |
| Percentage of Target Sequences with motif | 22.35% |
| Number of Background Sequences with motif | 3189.1 |
| Percentage of Background Sequences with motif | 16.10% |
| Average Position of motif in Targets | 404.1 +/- 325.9bp |
| Average Position of motif in Background | 291.2 +/- 215.0bp |
| Strand Bias (log2 ratio + to - strand density) | -0.1 |
| Multiplicity (# of sites on avg that occur together) | 1.18 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
GMEB2/MA0862.1/Jaspar
| Match Rank: | 1 |
| Score: | 0.87 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -TACGTAMT TTACGTAA- |
|

|
|
YAP3/MA0416.1/Jaspar
| Match Rank: | 2 |
| Score: | 0.84 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | TACGTAMT TACGTAAT |
|

|
|
Gmeb1/MA0615.1/Jaspar
| Match Rank: | 3 |
| Score: | 0.82 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----TACGTAMT---- GAGTGTACGTAAGATGG |
|

|
|
PB0027.1_Gmeb1_1/Jaspar
| Match Rank: | 4 |
| Score: | 0.82 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----TACGTAMT---- GAGTGTACGTAAGATGG |
|

|
|
NAC043/MA1045.1/Jaspar
| Match Rank: | 5 |
| Score: | 0.81 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TACGTAMT NTTACGTAAT |
|

|
|
NAC025/MA0935.1/Jaspar
| Match Rank: | 6 |
| Score: | 0.80 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --TACGTAMT GTTACGTA-- |
|

|
|
CIN5/CIN5_H2O2Lo/[](Harbison)/Yeast
| Match Rank: | 7 |
| Score: | 0.79 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -TACGTAMT TTACGTAA- |
|

|
|
YAP6(MacIsaac)/Yeast
| Match Rank: | 8 |
| Score: | 0.78 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -TACGTAMT TTACATAA- |
|

|
|
gt/MA0447.1/Jaspar
| Match Rank: | 9 |
| Score: | 0.78 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --TACGTAMT ATTACGTAAT |
|

|
|
YAP1/MA0415.1/Jaspar
| Match Rank: | 10 |
| Score: | 0.78 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------TACGTAMT----- ATTTGCTTACGTAAGCTCGT |
|

|
|